#FeatureNum = Agilent feature number
#Row = Row
#Col = Column
#ProbeName = Probe name
#Sequence = Sequence
#Locus ID = RAP locus identifier
#AccessionNum = Accession number
#Description = Description
FeatureNum	Row	Col	ProbeName	Sequence	Locus ID	AccessionNum	Description
1	1	1	GE_BrightCorner		
2	1	2	DarkCorner		
3	1	3	DarkCorner		
4	1	4	DarkCorner		
5	1	5	DarkCorner		
6	1	6	DarkCorner		
7	1	7	DarkCorner		
8	1	8	DarkCorner		
9	1	9	DarkCorner		
10	1	10	DarkCorner		
11	1	11	DarkCorner		
12	1	12	Os01g0532600|mRNA|AJ491820|CDS+3'UTR	ACAAGCGCACGAACTAGGTGATGATGATCAGAAGCGATCAGTATGCGATCGATGTTCTGC	Os01g0532600	AJ491820	Similar to HKT1 (High-affinity potassium uptake transporter).
13	1	13	Os01g0721700|COMBINER_EST|CI557169|4	GCCCCTTTATATCTTTGTAGTTTGTAATAAGCCTGCTAAATTCTCAATGTTCATGTGTTC	Os01g0721700	CI557169	Hypothetical protein.
14	1	14	Os06g0215600|mRNA|AK104039|CDS+3'UTR	GATATTTGATTAGTTATGCATCCAAATATATTGGGATTAATAAACGCAGATGTATTCACA	Os06g0215600	AK104039	Similar to Oxo-phytodienoic acid reductase.
15	1	15	Os09g0379500|mRNA|AK069390|CDS+3'UTR	GAAATTAGAATGGGCGACAAATTTAGGGACCTCAAGTAAACTTATTCCAAGGCAAAAACA	Os09g0379500	AK069390	Conserved hypothetical protein.
16	1	16	Os03g0199100|mRNA|AK069890|CDS+3'UTR	ATTACTGACTTTATTTATCACCTGTCCTGATCTCCATAGTTTATCAATGTGTTTGGCGTT	Os03g0199100	AK069890	Protein of unknown function DUF677 family protein.
17	1	17	Os01g0508500|mRNA|AK120501|CDS+3'UTR	ATATTTGTGACCAGATGAATTATATATTTGTACACAGATGAATTATATATTTGTGACCAG	Os01g0508500	AK120501	Conserved hypothetical protein.
18	1	18	Os06g0130000|mRNA|AK064427|CDS+3'UTR	TGGACGTTTACTCATCCGCATGGCCCATTTAGCGCCCCCATTTGCGATTTTTCGCAGCAT	Os06g0130000	AK064427	Similar to Tobacco mosaic virus helicase domain-binding protein (Fragment).
19	1	19	Os08g0446400|mRNA|AK102368|5'UTR+CDS	ACTGCCCAACTTTGAGACGAGTAATTCTCAACCAAAATAATCTCATTGGATCAATTCCAC	Os08g0446400	AK102368	Leucine rich repeat, N-terminal domain containing protein.
20	1	20	Os05g0433800|COMBINER_EST|Os05g0433800|8	ATCACAGCTCACATCTCTGTCGTGATCGCCACAGTTCAATCCACCAACAAATCAACAATC	Os05g0433800		Protein of unknown function DUF1218 family protein.
21	1	21	Os12g0152700|mRNA|AK099473|CDS+3'UTR	GCTGTCTGTAATTTCCTATAATTCGCTTGAACCTGTCGAAATCACAAGGATATGCATACA	Os12g0152700	AK099473	Amino acid-binding ACT domain containing protein.
22	1	22	Os03g0685100|mRNA|AK059852|CDS+3'UTR	GGCAGAACGTTAACTGTTTAAGTCATCCTTGATTTTTTAATAATTTTATTGTTCTTGTCC	Os03g0685100	AK059852	tRNA/rRNA methyltransferase, SpoU domain containing protein.
23	1	23	Os05g0285900|mRNA|AK061533|CDS+3'UTR	GAAAAGTTTCTCCATGGCAGATTGAGGCTGTTATTTCCTGTAGATTTAGGTTTCGCTGTA	Os05g0285900	AK061533	Conserved hypothetical protein.
24	1	24	Os03g0449000|COMBINER|CI260116|6	CGCGTGCACGAAGTACGCGTCGAATGGTCCGAAAAATTGGCTCCTCACCCTTGCGCAAAA	Os03g0449000	CI260116	(No Hit)
25	1	25	Os03g0775000|COMBINER_EST|AU057613|7	TGGTAGAAGCCTCTGCTTTTCCAGATGACCAGATCACTAAACAGGGCATTTAAGTCCATT	Os03g0775000	AU057613	Protein of unknown function Mtu_121 family protein.
26	1	26	Os11g0213500|COMBINER_EST|Os11g0213500|8	GAAGGCAGTGCTAGCAATTATGTTACCCTCTGTGGAATTTATGACGCAGTTGGTCAATCT	Os11g0213500		Tetratricopeptide-like helical domain containing protein.
27	1	27	Os09g0261100|mRNA|AK121607|CDS+3'UTR	AGAAAGTGGGATGACATTGCACATTGTGCTGGGTAAGTTTGGCAAATTGTGGTTTGAAAT	Os09g0261100	AK121607	Cyclin-like F-box domain containing protein.
28	1	28	Os02g0236600|COMBINER_EST|CI552267|0	CATAATATTGGTGGTGATCGATCGATCGATGCATTTGGTAATAATTTGAGCTGTAATTTT	Os02g0236600	CI552267	Similar to Class III peroxidase GvPx2b (Fragment).
29	1	29	Os10g0469200|mRNA|AK108708|CDS+3'UTR	GGAGCTCGAGCTCCTCCTCGGCATGGCGCTGCGAGCGCCTGCGATCGCGGAGGGGACGAT	Os10g0469200	AK108708	Conserved hypothetical protein.
30	1	30	Os02g0827200|mRNA|AY137242|CDS+3'UTR	ACCCAAGCTGCCAAACTCTTACAGATCTGCTGGGTTCCATGGATTTGGCTGAGCAGAACA	Os02g0827200	AY137242	Sucrose transporter.
31	1	31	Os09g0271000|mRNA|AK102955|CDS+3'UTR	AGGCCAACATGGCCAAATGATGTTGTCACGCTAGTGGGTTCGACGTGACAATATTGTTTT	Os09g0271000	AK102955	Conserved hypothetical protein.
32	1	32	Os08g0427500|mRNA|AK102608|CDS+3'UTR	AATGTAGTGGGTGTTAAAACTGTTAACAGTATATGCTTGTTTAAGTTTCAGCATAGTGCC	Os08g0427500	AK102608	DNA repair protein Rad4 family protein.
33	1	33	Os08g0379300|mRNA|AK103923|CDS+3'UTR	TGCATACAACTTGTGTAACAGTGTAACTCTATGAACTGTAATATGAGATAAACTTCATTT	Os08g0379300	AK103923	PDZ/DHR/GLGF domain containing protein.
34	1	34	Os12g0160900|mRNA|AK065838|CDS+3'UTR	TATTGAATTTGCTAATTGTTGTACTAGTTGTAAATTTGCTATTCACTAGTTGCATGAAGT	Os12g0160900	AK065838	FAR1 domain containing protein.
35	1	35	POsControl0013|genome		
36	1	36	Os06g0724300|mRNA|AK121941|CDS+3'UTR	CTGTAACTATACGTAAACCAATCGTGGTATGAGCTATTGTTTCCAAGGAAATGTTAACGG	Os06g0724300	AK121941	Protein of unknown function DUF616 family protein.
37	1	37	Os01g0582400|mRNA|AK069484|CDS+3'UTR	CGTTTCGCTATGTTGTGGTTCATGGTAGAGGGACCACCTGTAGACTAGTGCTTTTAACAT	Os01g0582400	AK069484	Similar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase.
38	1	38	Os06g0229400|COMBINER_EST|Os06g0229400|8	GTCGCTGGCGAACGCGACGTTCAGGTTCGGGGAGGCGTACGACTACTTCCAGGACATCAT	Os06g0229400		Lipolytic enzyme, G-D-S-L family protein.
39	1	39	Os01g0909100|COMBINER|CI421631|x	AGCAAAACAGGCAAAGAAGACACCTGTAAACAATGACACGGCTAAGCAATCCTCTGGCTA	Os01g0909100	CI421631	Conserved hypothetical protein.
40	1	40	Os07g0479500|mRNA|AK109231|CDS+3'UTR	TATCTACCGACGCCGCCACGCGGGGAGGAGGAGAGACAGCCAGACAGGACGAGGAGCGAG	Os07g0479500	AK109231	Conserved hypothetical protein.
41	1	41	Os12g0124300|mRNA|AK121957|UTR	ATCACCTGCTTTGCTTTCCCTGTTCCCAAATGTACTCTGAAAATAAGAACTATGTTATTT	Os12g0124300	AK121957	Non-protein coding transcript, unclassifiable transcript.
42	1	42	Os02g0542200|mRNA|AK066798|CDS+3'UTR	CTCTTGCTGACTTTCCTAAATGTTCGCAATTTGATGAAATGCAAGTAAAACGAATTCATG	Os02g0542200	AK066798	FAR1 domain containing protein.
43	1	43	Os11g0632200|mRNA|AK102163|CDS+3'UTR	TCAAGAAAACCTTGAGCGTTGGGTCTACAAGTTCTGATCCGGTGATGATCCAGGTTTCTA	Os11g0632200	AK102163	Conserved hypothetical protein.
44	1	44	Os04g0568400|mRNA|AK103546|CDS+3'UTR	ATCTTTCAGTGTAGATCAGATTTGTTCTTACTCCCCCCACTCAATTGCTCATTGAAATGA	Os04g0568400	AK103546	Quinoprotein amine dehydrogenase, beta chain-like domain containing protein.
45	1	45	Os11g0267300|mRNA|AK100529|CDS+3'UTR	AATGGGTAGGGACACATTGATCTTGCCAGTTATTTATTATGGGCAAACAACTGGCACTTG	Os11g0267300	AK100529	Conserved hypothetical protein.
46	1	46	Os01g0720900|COMBINER|CI405530|x	GCATCTCTCATTTCTTCAATGAAATATATAATCTTGTCCATTTTCGGAATATAATGTATG	Os01g0720900	CI405530	Protein kinase-like domain containing protein.
47	1	47	Os03g0567100|mRNA|AK109220|CDS+3'UTR	CTGTGTAATGACATGTGTGCCATCTGGCAGAATTACTACTTTAATTATTGAAGTGGATTA	Os03g0567100	AK109220	Conserved hypothetical protein.
48	1	48	Os05g0155200|mRNA|AK111696|CDS+3'UTR	GGCATGATGGTATAAGTTTCATTGGCATTCTTGATTGCAGTTGTGAGGGCGATTGGGTGA	Os05g0155200	AK111696	Similar to Ethylene receptor homolog.
49	1	49	Os08g0484600|mRNA|AK100591|CDS+3'UTR	CAGCCCCTTGCTGCCGGGTTGTGGTATAAATGTAGATGACAGCAAATTTAGTGAAATATC	Os08g0484600	AK100591	OSK4.
50	1	50	Os07g0175600|mRNA|AK073569|CDS+3'UTR	ATTATTATTATCTAGGATTGATTCATCACTTCCATTAATTCTGAATAAAAACTTGTATTT	Os07g0175600	AK073569	Plant lipid transfer protein/Par allergen family protein.
51	1	51	Os06g0109200|mRNA|AK099078|CDS+3'UTR	AATTATGGAACACTGTAAATCACCCTGCTCCCTGCAGCTCAAAATTCACTTGATGCTTAA	Os06g0109200	AK099078	Protein of unknown function DUF6, transmembrane domain containing protein.
52	1	52	Os08g0514200|COMBINER|AU174230|6	CTTCCCGGTATCGCTTTTGGAGAGCAATTGAGTTGAGAGTTGAGTTAGGGTTTCGAGTTT	Os08g0514200	AU174230	(No Hit)
53	1	53	Os07g0609000|mRNA|AK104937|CDS+3'UTR	AAACTCTAGTTGCCTTGTTTGATCGGTTGAGAATAATACAATCCTTGTGATTGGGTGTGC	Os07g0609000	AK104937	Dimeric alpha-beta barrel domain containing protein.
54	1	54	Os03g0234900|mRNA|AK104936|CDS+3'UTR	GAGTTATTCTTGTACTGTAAAACGGATTGAAGATCAATTTATTTCATTTACGGATTTGCT	Os03g0234900	AK104936	Similar to Peroxidase (EC 1.11.1.7).
55	1	55	Os05g0105500|COMBINER_EST|CB677483|7	GGAAAAATCCATTCCATTTATCCTGCTGCCAAAAGTCCATGGTCTTCTTGAAATCAACAG	Os05g0105500	CB677483	Conserved hypothetical protein.
56	1	56	Os05g0307000|COMBINER_EST|Os05g0307000|8	CGCCCTCTGCCCCGGCCAGGACGAGTGCTCCCTCGCCATCTACCTCACCGGCCTCCAGCA	Os05g0307000		Hypothetical protein.
57	1	57	Os03g0755800|COMBINER_EST|CI257805|6	ATTGTATACCTCTGCCTCTTAATACTATTTCCCAAGGACCAAATTCTCCATTAATATAGG	Os03g0755800	CI257805	Conserved hypothetical protein.
58	1	58	Os10g0352200|mRNA|AK111071|CDS+3'UTR	AAAGCAAGTTGGCTTACCAGCAAGGTGTTGTACATAATCGAAATCGACTGCACCAAATTC	Os10g0352200	AK111071	Conserved hypothetical protein.
59	1	59	Os06g0118600|mRNA|AK071942|CDS+3'UTR	CCTCCAGTGTCATAATCTTGTAATTTTTTTCTGTTTTATCAATAGAACTCGTTAAAAAAA	Os06g0118600	AK071942	Conserved hypothetical protein.
60	1	60	Os12g0167900|mRNA|D38597|CDS	TATGCCCTTAAGTATGACAGTGATGCTGGCAAGAAAGAAATCCAGATGCAACTTGAGAAG	Os12g0167900	D38597	60S ribosomal protein L3.
61	1	61	Os09g0321300|mRNA|AK064008|CDS+3'UTR	CTTGGCAATTGGTGGCGATGGTGGCGGTGGCTCAATCCTGTTGGATTTGAGAATATATTG	Os09g0321300	AK064008	Hypothetical protein.
62	1	62	Os07g0510200|mRNA|AK101250|CDS+3'UTR	TTTGGGATGACACTTTAGAGGAGCAGGCAGGGGCTGTATGTTTAGTGATTCTTTATTGTT	Os07g0510200	AK101250	Glycoside hydrolase, family 17 protein.
63	1	63	Os03g0159800|mRNA|AK067149|CDS+3'UTR	GCCTCGAAATTCTGTAGAAATCTTATGGGAATTAGTCAATTCCTTCAATGTCTGCAGAAG	Os03g0159800	AK067149	Complex 1 LYR protein family protein.
64	1	64	Os03g0151500|mRNA|AK109181|CDS+3'UTR	GTTTTACTCCGTTCGTGTTGATTAGTCCAGGCTTTCGAGGTGTAATAGAATACTGCAACA	Os03g0151500	AK109181	Conserved hypothetical protein.
65	1	65	Os11g0549300|COMBINER_EST|Os11g0549300|8	GGAAGAAGAAGCATGGGCTCATACAGTGATCATGAGCAATCTTTCAACCTCTTAGACCTT	Os11g0549300		KI domain interacting kinase 1.
66	1	66	Os06g0296700|mRNA|AK065533|CDS+3'UTR	AAATAATACGATTTTAATAGAAAATCGCAAAAATATAGGTCGGTTCGACGAAATCGTAAA	Os06g0296700	AK065533	Conserved hypothetical protein.
67	1	67	Os10g0470900|mRNA|AK059172|CDS+3'UTR	AAGTTTAGCCTTATCTGTCGGTGTGCTTTGTCATGAGTGGAATTTCAGTTGCTTCGTCTC	Os10g0470900	AK059172	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
68	1	68	Os03g0695400|mRNA|AK070048|CDS+3'UTR	TTATGAAACCCATTTTGCCTTTAGATGCGCTGCAGGTTATTATCTGGTAATCGATTTCAA	Os03g0695400	AK070048	Ankyrin repeat containing protein.
69	1	69	Os08g0326600|mRNA|AK065219|CDS+3'UTR	GAACTGCACTTATTAACTGTGCTTTCTATTCTTGAATAGATATCTTCACCTTTGAAGACC	Os08g0326600	AK065219	Similar to GMP synthetase.
70	1	70	Os09g0500100|mRNA|AK119477|CDS+3'UTR	CCACTTCTTGAGTTAGGCGACATTTAATTATTGTTTACACGTGTACAATCAGATGTTTAG	Os09g0500100	AK119477	Cyclin-like F-box domain containing protein.
71	1	71	Os04g0309400|mRNA|AK120707|CDS+3'UTR	TGGACTAGATCTTAATCATGTGGTCAGCTTGCACCTCCTTCCTTCCTCAGATCTGAACTA	Os04g0309400	AK120707	Conserved hypothetical protein.
72	1	72	Os08g0435900|mRNA|AK067809|CDS+3'UTR	GCAGTGTTCTAGCTATCTCATGGTCTCGATCTTAATTATGGTGGATAAACTACGCTTAAT	Os08g0435900	AK067809	Similar to LHC I type IV chlorophyll binding protein (Fragment).
73	1	73	Os12g0188700|mRNA|AK120500|CDS+3'UTR	GCCAAGGAGTACGTCGGCAAGATCATGTTCAAGAACGGCGAGAAGAAGGAGAGCGTCATC	Os12g0188700	AK120500	Similar to Thioredoxin (TRX).
74	1	74	Os11g0167800|mRNA|AF039573|CDS+3'UTR	TCAATGTATTTTTATCTGTACTTTGTACAAGTGAAGCAATATTTATCGAACCTTGACTTT	Os11g0167800	AF039573	Similar to Anth (Pollen-specific desiccation-associated LLA23 protein).
75	1	75	DarkCorner		
76	1	76	DarkCorner		
77	1	77	DarkCorner		
78	1	78	DarkCorner		
79	1	79	DarkCorner		
80	1	80	DarkCorner		
81	1	81	DarkCorner		
82	1	82	DarkCorner		
83	1	83	DarkCorner		
84	1	84	GE_BrightCorner		
85	1	85	GE_BrightCorner		
86	2	1	GE_BrightCorner		
87	2	2	DarkCorner		
88	2	3	DarkCorner		
89	2	4	DarkCorner		
90	2	5	DarkCorner		
91	2	6	DarkCorner		
92	2	7	DarkCorner		
93	2	8	DarkCorner		
94	2	9	DarkCorner		
95	2	10	DarkCorner		
96	2	11	Os12g0102700|mRNA|AK119290|CDS+3'UTR	TGTACGGACCACGTCCCAGGCAAACGCTTGGCTAACAAATCAATAAAGGAAAATCTCTTG	Os12g0102700	AK119290	Conserved hypothetical protein.
97	2	12	Os10g0580500|COMBINER_EST|CI442398|6	TTCCAGTAGGTTGCAAAGCCTCTCAAAGGATCTTGTGATTTTGTTGCATGAATGCCCAGA	Os10g0580500	CI442398	Conserved hypothetical protein.
98	2	13	Os12g0287200|mRNA|AK121477|CDS+3'UTR	GAATCTTAATACTTTGGTGCCTGGGATTGTTGTTGGATTGTGCAAGCTTTGGGTGCTCGT	Os12g0287200	AK121477	Similar to Mago nashi protein.
99	2	14	Os07g0641300|COMBINER_EST|Os07g0641300|8	TCACGCGTTCCAAAGGCCCCGAGAAATCATCCCGAATTGCTCGCATGGCTTTGCCGAATT	Os07g0641300		Hypothetical protein.
100	2	15	Os07g0484500|mRNA|AK064741|CDS+3'UTR	GTCAGGGCAAGTACTATAATGCTCTATATGCTACCCCTAAAATTGCCATATTGGATTGAG	Os07g0484500	AK064741	Protein of unknown function DUF1395 family protein.
101	2	16	Os04g0227500|mRNA|AK060052|CDS+3'UTR	CCCAGTGTGCTACCAACAAGACTTGTATGAAATATAGTATGCATTTTAAGATTTCGGATG	Os04g0227500	AK060052	DSBA oxidoreductase family protein.
102	2	17	Os06g0252300|mRNA|AY224502|CDS	GCAGGGCCAAGTACTGCGCCACCGGTTAGTAAGATGCAGCCTGAAGTCGAAGTGGATGAT	Os06g0252300	AY224502	Zinc finger, PHD-type domain containing protein.
103	2	18	Os09g0466400|mRNA|AK108246|CDS+3'UTR	TTAATTGGTGGCTTAGGTTAATCTGTAGCAAGAGAGACTGAGAGAGCATTCGTTCTCGGC	Os09g0466400	AK108246	Similar to ZF-HD homeobox protein.
104	2	19	Os05g0426300|mRNA|AK100779|CDS+3'UTR	AATTTCACAGGTTGGCGAAAGATGGCTCGGTGACTGCTGACTCTTGACAGTATACTCAAT	Os05g0426300	AK100779	Protein of unknown function DUF231, plant domain containing protein.
105	2	20	Os07g0490400|mRNA|AK067941|CDS+3'UTR	TGCCATTCTTTGTCATGAATCTCATGATGTTGGGGGGCATGTGTACCTTCTGCTGCTTTT	Os07g0490400	AK067941	Peptidylprolyl isomerase, FKBP-type domain containing protein.
106	2	21	Os07g0691800|mRNA|AK058808|UTR	CAAATTGCATTTCTCATGATTTGCCTTCTCAAGTACTGCACTGAATAATGAACTGTGGCT	Os07g0691800	AK058808	Similar to 26S proteasome subunit 4-like protein (26S proteasome subunit AtRPT2a).
107	2	22	Os01g0117500|COMBINER_EST|Os01g0117500|8	GTAGGGAAATGACACAGGAAGAGAAAGAAACGGTCAGACAGCTAGCCATTGTAGCGTTAT	Os01g0117500		Similar to LRK14.
108	2	23	Os05g0397800|mRNA|AK064931|CDS+3'UTR	CCCTTCAGAATGGGATCGAAATTGACTAAATGCCTGCCAATCCGAAGGGAACCAAACAAA	Os05g0397800	AK064931	Conserved hypothetical protein.
109	2	24	Os03g0299900|mRNA|AY338235|CDS	TGCATTTGGGCACAGAGAGAACATTATTGAAGCTGCGAGAAGACTGAAGCAGCTGTACAA	Os03g0299900	AY338235	Similar to Plastid aminotransferase (Fragment).
110	2	25	Os07g0491600|mRNA|AK059584|CDS+3'UTR	GATTCAGAATCTGTGAAAGTGGAAGATGTACATTTTACCTATCCTAGGACATTTGACCGG	Os07g0491600	AK059584	Conserved hypothetical protein.
111	2	26	Os09g0401300|mRNA|AK071001|CDS+3'UTR	TAGGCTTACAAAAACTGTACTATTCTTGTTTCTTGTATGAACTTACAAGCTGCAGAATGC	Os09g0401300	AK071001	ZIM domain containing protein.
112	2	27	Os02g0635800|mRNA|AK061568|CDS+3'UTR	CCATGGAACTTGTTTCAGTTTAGCTTCATCTACATCGTTGTCAGACCAAATCATTTGACA	Os02g0635800	AK061568	TCP transcription factor family protein.
113	2	28	Os04g0440100|mRNA|AK101324|CDS+3'UTR	TTCACCAGATAATTATGGGGGTATTGTTAAGAATGATGATATGATGTACAGCATCAAAGG	Os04g0440100	AK101324	Nonsense-mediated decay UPF3 domain containing protein.
114	2	29	Os03g0333100|mRNA|AK060242|CDS+3'UTR	TCTTTTGTTTGTTGTCAAATAATTTGCTATCATTTAAAAGGGGAATTGCTTTTATGGTCC	Os03g0333100	AK060242	Protein of unknown function DUF663 domain containing protein.
115	2	30	Os06g0147200|mRNA|AK070059|CDS+3'UTR	CATGTCCTATACTTTATATGGGAAATAATGTATCTATTATGTAAAGACTACAATGAATAT	Os06g0147200	AK070059	Conserved hypothetical protein.
116	2	31	Os02g0701600|mRNA|AK061746|CDS+3'UTR	TTGGGGAACAGCCAGTGCACTGTTACCACGTCATTGATTTTGTACTCGTCAGACTTAAAA	Os02g0701600	AK061746	Similar to Tocopherol O-methyltransferase, chloroplast precursor (EC 2.1.1.95) (Gamma-tocopherol methyltransferase).
117	2	32	(+)E1A_r60_3		
118	2	33	Os11g0672700|mRNA|AK101124|CDS+3'UTR	TCCTGCAGACATTGCGCACGAGAGAAATCATTACTATTTGCATGAGAAGTCTTCATTACA	Os11g0672700	AK101124	ATP-dependent DNA helicase RecQ family protein.
119	2	34	Os08g0490300|mRNA|AK066895|CDS+3'UTR	AATGTGTAAGATGCTTTGTAGTTTGGACCAATTTTTGGAAAACATTACTCTGAGGTGTAC	Os08g0490300	AK066895	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
120	2	35	Os04g0103200|mRNA|AK060850|CDS+3'UTR	GTTTAGAACATCTGGTGCGATTTTTCATAACAATTATGACAGTCATAGAACGTCTTGTTC	Os04g0103200	AK060850	Proteasome component region PCI domain containing protein.
121	2	36	Os07g0646300|mRNA|AK066044|CDS+3'UTR	CGATCAAGAGGGAGTAATTTCTGTACCTTGTTGATGTGAATACTTTGTAAGATGGTTCTT	Os07g0646300	AK066044	Conserved hypothetical protein.
122	2	37	Os03g0834000|mRNA|AK062149|CDS+3'UTR	TTTAGCACTGGTTCTCGCTTGAGTGTTGAACGGTGACCATGAAGAATTTGATCACCTTTT	Os03g0834000	AK062149	Flap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b).
123	2	38	Os12g0177500|mRNA|AK064771|CDS+3'UTR	CAGTCCCAGTCCCACTCTTGGTTGGCACAAAGTTCTTCCTGTATACTTGTAAGACTGAAT	Os12g0177500	AK064771	Peptidase A1, pepsin family protein.
124	2	39	Os07g0121000|mRNA|AK072975|CDS+3'UTR	AAATGTGTGCTACATATGCTGCTGCTGTTGGTCTAACTCAAAACTTATGTTTGTAAATGA	Os07g0121000	AK072975	Protein of unknown function DUF1719, Oryza sativa family protein.
125	2	40	Os02g0209100|mRNA|AK099955|CDS+3'UTR	CACATAGGTCCTTACTGTGGGTTCTCAGGATGCTTTATATATACGAGGGATGTTCCCTTC	Os02g0209100	AK099955	Similar to Coatomer beta' subunit (Beta'-coat protein) (Beta'-COP) (p102).
126	2	41	Os01g0844500|COMBINER_EST|CI189557|6	GTGTGACCTCAGCTACTACTAGTACTAGTAGGGTTTTTGCATGTAAAGATGGCGACACGT	Os01g0844500	CI189557	Peptidase A1, pepsin family protein.
127	2	42	Os09g0281600|mRNA|AK067020|CDS+3'UTR	TTCAACATGTCATTTGGTGTGTGTTTCCCCTTTTGTTTCACATGGTGATGTATTCATGTT	Os09g0281600	AK067020	SWAP/Surp domain containing protein.
128	2	43	Os11g0576400|COMBINER_EST|Os11g0576400|8	TGGGGTCTCCGCCTTGATATTGGAGTCCTTAACCTGGAAGATAAGAGCATCGATGAAATT	Os11g0576400		Conserved hypothetical protein.
129	2	44	Os02g0163300|mRNA|AK064737|CDS+3'UTR	CTTTATTAGAAAGGCTGTAAACCCATGAGATGATCTATGATCATTCCTTGATTTTGTGGT	Os02g0163300	AK064737	Conserved hypothetical protein.
130	2	45	Os10g0515400|COMBINER_EST|Os10g0515400|8	GGCGGGAGTACAAGAAAAACGGCGGCGAGCCGAAGAAGGAGACGACCACGTTCACGCACT	Os10g0515400		Cytochrome P450 family protein.
131	2	46	Os04g0632400|mRNA|AK101815|CDS+3'UTR	TTTGTAAACCATTGAAAATGAACCATACACCCACAAAGCAATCATATTCCTAGGTTCTTG	Os04g0632400	AK101815	Conserved hypothetical protein.
132	2	47	Os08g0229600|mRNA|AK065192|CDS+3'UTR	CCCGCAAAGTAAGAACTACTTCCTCCGTCAGTAACAAGTTGTAAAATCCTAAAAAATAAC	Os08g0229600	AK065192	Exo70 exocyst complex subunit family protein.
133	2	48	Os11g0231400|mRNA|AK108047|CDS+3'UTR	ATGTTTTTTCTGCACTGTAATAAGTTATTATATTATCGTTGTGTGTCTCTGATAGATGTT	Os11g0231400	AK108047	Protein of unknown function DUF295 family protein.
134	2	49	Os09g0500300|mRNA|AK100152|CDS+3'UTR	CCCAACAAAAGGAGTGTAGAGTCATTGGCATACCACTGCTAATAATTTGTGTGTTTTTTT	Os09g0500300	AK100152	Similar to Type II inositol-1,4,5-trisphosphate 5-phosphatase 12 (EC 3.1.3.36) (At5PTase12) (FRAGILE FIBER3 protein).
135	2	50	ETG02_36680		
136	2	51	Os01g0203000|mRNA|AK067471|5'UTR+CDS	TGGCACCACACCCAGATATTCATATGATGGATGCGGTTTCTGATGAGTTTGCATTTGGAA	Os01g0203000	AK067471	BZR1, transcriptional repressor family protein.
137	2	52	Os07g0608300|mRNA|AK106096|CDS+3'UTR	CCTGCTTCTTAAGCCTGTTATACCAAAACTGTTGCAATATCAATAGGCCATGTCTTCACC	Os07g0608300	AK106096	Esterase/lipase/thioesterase domain containing protein.
138	2	53	Os04g0555300|mRNA|AK103226|CDS+3'UTR	TTGTGCGAGAATGCAGCAGAAGTGTTGGTTCCTATCAGATGCTAATGTAATCTTGCTGAT	Os04g0555300	AK103226	Major facilitator superfamily protein.
139	2	54	Os06g0329900|mRNA|AK068748|CDS+3'UTR	ACAGTAAATCCATTCTTAAATCTGGTAGATTTTATACCACTATATTGGCCGATTTTAGTT	Os06g0329900	AK068748	SAM dependent carboxyl methyltransferase family protein.
140	2	55	Os01g0363500|mRNA|AK067388|CDS+3'UTR	TTGTCATGGTAGTGAAATAGTGATGATGCTTTAGCAGCCCAGTTGCCATGGGCATTCCTG	Os01g0363500	AK067388	Conserved hypothetical protein.
141	2	56	(+)E1A_r60_a97		
142	2	57	Os05g0339800|COMBINER|CI164552|6	GTGTTCGCTAGATGTGGCGAACCATTGTATATTCGGGAATCTGCCGCAAACCCTTTTATT	Os05g0339800	CI164552	(No Hit)
143	2	58	Os06g0604000|mRNA|AK061163|CDS+3'UTR	CCGTCATTATAGTCATACTGGTGAAAGCTCTGCTATGTATCAACGTCATCAGAGATCAGA	Os06g0604000	AK061163	Similar to Ethylene response factor 1.
144	2	59	Os09g0516900|mRNA|AK058746|CDS+3'UTR	GTTTAGCCGGAAAAAGGGGGTGCTTACAAGATCTAACAGTGTATAAATTGTCTATACATT	Os09g0516900	AK058746	C2 calcium/lipid-binding region, CaLB domain containing protein.
145	2	60	Os03g0802500|mRNA|AK070731|CDS+3'UTR	TGTTGTGCTAAATAATTTGACTCGATTTTCTTAGTGAACTGACAATCTGCTTAATTTGAA	Os03g0802500	AK070731	AAA ATPase domain containing protein.
146	2	61	Os02g0654300|mRNA|AK101944|CDS+3'UTR	TTAGATTTAGCGCGATTTTAGTGCGCAATGTATCCAACACTCTGGAACCCAGGGAAAGAA	Os02g0654300	AK101944	Similar to Protein kinase KIPK.
147	2	62	Os12g0552300|COMBINER_EST|Os12g0552300|8	TGAAGAAGAAAGAACAAGAATCGGCTACCAACGTATCCGCTACCTCTTCTTCGATGGCTA	Os12g0552300		Protein prenyltransferase domain containing protein.
148	2	63	Os09g0567400|mRNA|AY345241|CDS	CCTGCTGGAGCAACCCGTCGTCAACTTCGATAAGGTCGACGCCTACGTTCATCAGCTCAA	Os09g0567400	AY345241	Similar to Histidine-containing phosphotransfer protein.
149	2	64	Os05g0502000|COMBINER_EST|CI098691|6	AGAATATAGGATGAGTTATTTCTATCATGTGTTCCGTATTATATAACACCCGTACGTTGC	Os05g0502000	CI098691	Similar to Cyclic nucleotide-gated ion channel 4 (AtCNGC4) (Cyclic nucleotide-and calmodulin-regulated ion channel 4) (AtHLM1).
150	2	65	Os08g0486800|COMBINER|CI546700|x	GGAGGAGGTGGAGTAGTGGTGGTGATGGCGGCGGGGAGTAGCAGCTGCAGCAGCGGCGCC	Os08g0486800	CI546700	(No Hit)
151	2	66	Os03g0365200|mRNA|AK066283|CDS+3'UTR	CTTGGGAGGAAGGGGACGGGTATCTTTTGGTCCAAATATTTCGACAAGTGAAGTGAAGAG	Os03g0365200	AK066283	Conserved hypothetical protein.
152	2	67	Os03g0100200|mRNA|AK104982|CDS+3'UTR	TTTCAAAGCAAAGGCACCGGCAGAATTTGTGCCCAAAACCAAAAAACAAATAAAAAGGGA	Os03g0100200	AK104982	Transcriptional coactivator/pterin dehydratase family protein.
153	2	68	Os06g0497200|COMBINER_EST|Os06g0497200|8	TTTGCCCTGGAATGAATTTTGCACTTGCTAATATGGAGCTTGCTCTCGCAAGTCTTCTGT	Os06g0497200		Cytochrome P450 family protein.
154	2	69	Os01g0637800|COMBINER_EST|CI105260|6	TGAGTGAATCTGTAATTCCGAATCTTTTTGACAACACACGTTGTTGTATCTGCGTCACTG	Os01g0637800	CI105260	Similar to MYB8 protein.
155	2	70	Os06g0156600|mRNA|AK104394|CDS+3'UTR	AGTATGTATGAGATTGGGAGGCAATTTAATTATGTGTTGCAATTAATTAATTAAATCTTA	Os06g0156600	AK104394	Lipolytic enzyme, G-D-S-L family protein.
156	2	71	Os03g0578900|COMBINER_EST|CI275807|6	TTAGGTTGTATCGATCGTGACTGAGCAAAGTGCAAATCTTCGATGCCCCCAGTGAGGCTT	Os03g0578900	CI275807	Similar to Gibberellin MYB transcription factor.
157	2	72	Os12g0224400|COMBINER|CI432440|6	ATCACCTTCGACGAGATCATGGCGAGGATGAGGAGGATCAAGAATGGCGAGATCTTGGGA	Os12g0224400	CI432440	Exostosin-like family protein.
158	2	73	Os05g0129400|mRNA|AK102359|CDS+3'UTR	AGAAACCTGGAAGCTGCAATTACTATCTAGTACTACCTCCATATTTTAATGTATGACGTC	Os05g0129400	AK102359	Ankyrin repeat containing protein.
159	2	74	Os02g0490500|mRNA|AK071953|CDS+3'UTR	CCCACGCGGTTTCCTCCTCTAGTCTCTTATGTATATATTTATATATGTATGTATACGTTT	Os02g0490500	AK071953	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
160	2	75	DarkCorner		
161	2	76	DarkCorner		
162	2	77	DarkCorner		
163	2	78	DarkCorner		
164	2	79	DarkCorner		
165	2	80	DarkCorner		
166	2	81	DarkCorner		
167	2	82	DarkCorner		
168	2	83	DarkCorner		
169	2	84	DarkCorner		
170	2	85	GE_BrightCorner		
171	3	1	DarkCorner		
172	3	2	DarkCorner		
173	3	3	DarkCorner		
174	3	4	DarkCorner		
175	3	5	DarkCorner		
176	3	6	DarkCorner		
177	3	7	DarkCorner		
178	3	8	DarkCorner		
179	3	9	DarkCorner		
180	3	10	DarkCorner		
181	3	11	Os02g0617700|mRNA|AK058997|CDS+3'UTR	TGTCGTTAGTAGTTTTGCCCTGCAACTCACAAACGCCCAAACATTACGCATCACTTGGTA	Os02g0617700	AK058997	Nucleic acid-binding, OB-fold domain containing protein.
182	3	12	Os05g0383200|mRNA|AK107536|CDS+3'UTR	TACTGTGATGGCAGGCGTGGTCATGAAGTGGAATGAAATCAATGGATCGGCATGGATTTT	Os05g0383200	AK107536	Conserved hypothetical protein.
183	3	13	Os12g0244100|mRNA|AK119535|CDS+3'UTR	AAAGAGGAGGCAAAGGTTTTGATCGAAGAAGTAGCTGATTGATATGACCTTGTTCCTTGA	Os12g0244100	AK119535	Similar to Heat shock 70 protein.
184	3	14	Os08g0526300|mRNA|AK104593|CDS+3'UTR	TACATGAACTAAACTGTCGTCATATCATGATGAATGTCTGACTGGCCCATGCTTATTGAG	Os08g0526300	AK104593	tRNA-binding arm domain containing protein.
185	3	15	Os09g0296500|mRNA|AK106991|CDS+3'UTR	AGAGGATTAAGCCTTAGAAGGTGATCACGGTCGATGTACTTTGAATTTTGACGAATTAAT	Os09g0296500	AK106991	Conserved hypothetical protein.
186	3	16	Os12g0284000|mRNA|AK062069|CDS+3'UTR	CATTGCCAGTTCCTTTAAAACATGAGTAGCTGGCTTTTAACATCCTGTGAAATTTACCTT	Os12g0284000	AK062069	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
187	3	17	Os01g0136800|mRNA|AK072170|CDS+3'UTR	TCTTTGGCTGTAACTGAGTTAACTTGTTGGCCAGTGGTTTGGCTACTTTGGCACATTCAG	Os01g0136800	AK072170	Protein kinase-like domain containing protein.
188	3	18	Os01g0911300|mRNA|AK058462|CDS+3'UTR	ATCAGAGTCAAGACCATCGGAAATCATAACTTATATACTCTGCAGGGAAAGTTTACTCCA	Os01g0911300	AK058462	Similar to Transporter associated with antigen processing-like protein.
189	3	19	Os10g0329700|COMBINER_EST|CI223223|6	CTCCGGTTTAGTTTGTCTTGAAATATTGTAGCTGCATTATGTGTGAGTGTGAATTACTAC	Os10g0329700	CI223223	Protein kinase-like domain containing protein.
190	3	20	Os01g0234800|mRNA|AK103163|CDS+3'UTR	GATGGACAAGGCACATACCATCCAAAGCTGCATGGAATGTCTTGTGACTCAGACGTTTTA	Os01g0234800	AK103163	Similar to Vesicle transport protein-like.
191	3	21	Os03g0859300|mRNA|AK073135|CDS+3'UTR	TCGCTCAGAGAGTCAGGAAGTTGACAATTCGACAAGGATCTTTTGCAACTCAACTCGTTG	Os03g0859300	AK073135	RNA-binding protein Lupus La domain containing protein.
192	3	22	Os03g0816800|mRNA|AK071618|CDS+3'UTR	ATTGGTTGAGAAGTGAAAACAATTCAGAAAATTATACGGTGGATGATTGCAATTGATTAT	Os03g0816800	AK071618	Protein of unknown function DUF567 family protein.
193	3	23	Os07g0476900|mRNA|AK066045|CDS+3'UTR	TTTACACCACCACACTAGCTTGAGAAGATCAAGCTTGTTTTATACTGGGGACGATTTGAT	Os07g0476900	AK066045	Thioredoxin domain 2 containing protein.
194	3	24	Os02g0749800|mRNA|AK064731|CDS+3'UTR	TTTCTTGGATTGCATGCCTACTGTTGCAAAGCAAAAACTTAGGCAACCCAAGATTAGAAA	Os02g0749800	AK064731	Mitochodrial transcription termination factor-related family protein.
195	3	25	Os01g0192300|mRNA|AK062109|CDS+3'UTR	TTAGGAAGTGAAGCTTTTACTGGACTAATCTAGTCTTGCAAATAATAAAAGGAACGGCTG	Os01g0192300	AK062109	Similar to I-box binding factor (Fragment).
196	3	26	Os09g0306400|mRNA|AK098869|CDS+3'UTR	TTCTTGAGCATGCAAGAGGGGAGGCAAAGGATTTTGTGTAATGATGCTCTTCAAGGAAAG	Os09g0306400	AK098869	Eukaryotic transcription factor, DNA-binding domain containing protein.
197	3	27	Os06g0530200|mRNA|AK104077|CDS+3'UTR	TTTGCCAAAATACATTGATCATGGAGTTATGCCATGCAACTCAACTAATTGTCTTATTCC	Os06g0530200	AK104077	Conserved hypothetical protein.
198	3	28	Os04g0564300|mRNA|AK111391|CDS+3'UTR	TCAAGCACAGAGCAAATTTAACTCAAGATTGTGAGATGATGCATGTACAACTGAATAAAG	Os04g0564300	AK111391	Conserved hypothetical protein.
199	3	29	Os01g0764000|mRNA|AK060216|CDS+3'UTR	AGCATTCTTGTGCTCTGGCCTTCGCTCTTGAGAACCTTATAATAAATTCTGCTTTTAGTC	Os01g0764000	AK060216	Similar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi).
200	3	30	Os04g0674300|mRNA|AK059048|CDS+3'UTR	GCATTTAACTACATAGCTCGCCTTAATTTTTCACCTGTAAATTAAGTTGATGATCTACTG	Os04g0674300	AK059048	BTB domain containing protein.
201	3	31	Os10g0487900|mRNA|AK109184|5'UTR+CDS	CAAGATAAGCAAGAGCCATCACGTGAATATCCTAGATATGATGGAGAACATGACAAATAT	Os10g0487900	AK109184	Conserved hypothetical protein.
202	3	32	Os10g0467600|mRNA|U34598|CDS+3'UTR	GCCACTTAATTTTGCTCGTAACATACATTGACAATCAAGAGGAGCCATGGCATTGCGATC	Os10g0467600	U34598	cap-binding protein p28 [Oryza sativa (japonica cultivar-group)].
203	3	33	Os02g0158800|mRNA|AK065389|CDS+3'UTR	TTTTGAACAAACTTTAACATATTTCGAATGAATTATGACCTGAGATGAACGTTTTGAGCC	Os02g0158800	AK065389	Protein of unknown function DUF246, plant family protein.
204	3	34	Os12g0482700|mRNA|AK067039|CDS+3'UTR	CTTGCTGTAATGAGGCTTGTATATTGCTTCAACTACAAACTGTACCAAAAAACAAATTGC	Os12g0482700	AK067039	Similar to L-galactose dehydrogenase.
205	3	35	POsControl0023|genome		
206	3	36	Os08g0535400|mRNA|AK071527|CDS+3'UTR	AGCCCAAGAGCTTCCGGTTTGGATGGGGTATCTGTATATATATTTGTTGGAACAGACGTA	Os08g0535400	AK071527	Zinc finger, DHHC-type domain containing protein.
207	3	37	Os05g0408900|mRNA|AK104851|CDS+3'UTR	TGTATATCTAAGAAATGTTGTAAGTGGATAGATTTATTGATCATGATAAGGATTAGTCGG	Os05g0408900	AK104851	Similar to 1-D-deoxyxylulose 5-phosphate synthase.
208	3	38	Os10g0540300|mRNA|AK061781|CDS+3'UTR	CTTACGTGTGAAATGCTTGTATTGTAAGGTCGCCAGGTTTGTGATTGAGATGTCCATCCT	Os10g0540300	AK061781	Conserved hypothetical protein.
209	3	39	Os06g0109300|mRNA|AK059047|CDS+3'UTR	AGACTCACAGGACTGTACACATGAAGGAACATATGTGCTGAAATACTGTACCATTATGCT	Os06g0109300	AK059047	Protein of unknown function DUF6, transmembrane domain containing protein.
210	3	40	Os06g0117500|COMBINER|CI232886|6	TCGGTGTGATCGCGGCATCGATCGGATGGTGATTGAGGATACTGATGGTTGGAGTGGTAC	Os06g0117500	CI232886	Protein of unknown function DUF594 family protein.
211	3	41	Os04g0683900|mRNA|AK099749|CDS+3'UTR	CTCTCTGTAATAGCCTGTTCAGTTTTTGAGCCGTTAATTCTTATAGATTATTATTATTCA	Os04g0683900	AK099749	HMG-I and HMG-Y, DNA-binding domain containing protein.
212	3	42	Os03g0130400|mRNA|AK058635|CDS+3'UTR	TGAGATGTTAATCTTAATTTCTTGTTTTGATTTAGCCTGCTGAGAACAGGACTTCATCAG	Os03g0130400	AK058635	Adenylate kinase, subfamily protein.
213	3	43	Os12g0615700|mRNA|AK058512|CDS+3'UTR	TTGGTTTAGTTTCGTACAACTAAGATGCTTTTGTAGTGTGTTCTTGCTCCGAATTGGTAT	Os12g0615700	AK058512	Similar to TRANSPARENT TESTA 12 protein.
214	3	44	Os12g0152100|mRNA|AK070021|CDS+3'UTR	GTTAGCTTATCATCGATAGCCAAAAGTTAAAATTTCAAACTTATTAATTCTAGAGTTGAT	Os12g0152100	AK070021	Esterase/lipase/thioesterase domain containing protein.
215	3	45	RC5		
216	3	46	Os07g0273500|mRNA|AK063067|CDS+3'UTR	GCTCTCTCATGAGGAGTCAAACCCAGGATCTAAGGTGCTACTGAGGCTCTTGTAACCACT	Os07g0273500	AK063067	Non-protein coding transcript, unclassifiable transcript.
217	3	47	Os03g0570300|mRNA|AK069396|CDS+3'UTR	CTAGCTGCCGAAAGAACTCTGTGTAAGAAAATGGTCTGATGCTTTCTTGCTTGTTTGGTG	Os03g0570300	AK069396	Translation protein SH3-like domain containing protein.
218	3	48	Os12g0258700|COMBINER_EST|CI192951|6	GTGTGATGGATGTTGTGCGTTTCTCTAAGGAGGTCATCTTGTAATATTAATCGGGAGGTT	Os12g0258700	CI192951	Cupredoxin domain containing protein.
219	3	49	Os03g0738400|mRNA|AK061913|CDS+3'UTR	CTATATTAACCTTCACTATCTTCTTGGACAAGCAGTTACACATACTTTGGTGTATTCTGT	Os03g0738400	AK061913	Similar to Serine hydroxymethyltransferase, cytosolic (EC 2.1.2.1) (Serine methylase) (Glycine hydroxymethyltransferase) (SHMT).
220	3	50	POsControl0016|genome		
221	3	51	Os10g0444100|mRNA|AK071645|CDS+3'UTR	AATTGGATTGTAAATACTGTCTTATTGACAAATTGGAGGGGGTTCAGTCTCCAGGATCTT	Os10g0444100	AK071645	Homeodomain-like containing protein.
222	3	52	Os04g0677400|mRNA|AK069563|CDS+3'UTR	TTGTTAGAAATGTTGATATATACGATCAGATTTTTGTGTTGAAATGGAAAGTACATATTG	Os04g0677400	AK069563	Protein of unknown function DUF639 family protein.
223	3	53	Os03g0211900|mRNA|AK059280|CDS+3'UTR	CAGACACTGTTTCTCACAGCACTGTTCGAGGACAAGTTCACACACACAAAAGGCCACTTG	Os03g0211900	AK059280	Leucine rich repeat, N-terminal domain containing protein.
224	3	54	Os05g0500600|mRNA|AK070489|CDS+3'UTR	TCTGGTTGGATTTAGTGGATCGTTTTAAACTTCTACTTCCATGACAAGATATTTCAGTTG	Os05g0500600	AK070489	GRAS transcription factor domain containing protein.
225	3	55	Os11g0667700|mRNA|AK105217|CDS+3'UTR	TAGACGTCGCTCGCTGGCTTCAGAGTTCTTGTGCGTACAAACTCCGGGTCAAGATATCCC	Os11g0667700	AK105217	Protein kinase-like domain containing protein.
226	3	56	ETG10_13482		
227	3	57	Os05g0320800|mRNA|AK063142|CDS+3'UTR	GACTTTGCAATTTTGATGTGAATTGTATCCAGCTGGGAATTAATGTACTCTATCACAATC	Os05g0320800	AK063142	Conserved hypothetical protein.
228	3	58	Os07g0596000|mRNA|AK065600|CDS+3'UTR	TTCATTCGTGGTGCATCCAAAATGGTTGTAATTTTGCTCTCAGATGACAATGGAATCAAT	Os07g0596000	AK065600	Zinc finger, DHHC-type domain containing protein.
229	3	59	Os09g0410300|mRNA|AB118007|CDS+3'UTR	ATTGGTGCCAATTTCGAGCATTATTGCTTGTGGTGAAATCATGAGGCCTCATGCTAGCTT	Os09g0410300	AB118007	Conserved hypothetical protein.
230	3	60	Os01g0511700|mRNA|AK071691|CDS+3'UTR	AATTTGATGTTGCACTTTGTATAACTATATGCAGTTTCAGTTTCATCTTCTGTTTCTACC	Os01g0511700	AK071691	Non-protein coding transcript, unclassifiable transcript.
231	3	61	Os12g0640700|mRNA|AK108649|CDS+3'UTR	AATATTTTCCATGTTGAGCTGCTATTGTTGCAGGCAAATCGCTGCATATGATTGATCGCT	Os12g0640700	AK108649	N/apple PAN domain containing protein.
232	3	62	Os08g0489300|mRNA|AK059000|CDS+3'UTR	CTGAATGCCTCCACCTCGCCGACCGCTCCTGGGGCATTACCAACGTCGCTGCCTAATGAC	Os08g0489300	AK059000	DNA glycosylase family protein.
233	3	63	Os01g0917500|mRNA|AK120933|CDS+3'UTR	TATTAAGACCTTTTATCTTGTACTATTGTCACTGGTGGTTCCTGTGGCAATGTGAGTGCT	Os01g0917500	AK120933	Protein kinase-like domain containing protein.
234	3	64	Os09g0482200|mRNA|AK105666|CDS+3'UTR	CAATCCGAGATGATGAATCAATCGATCATTTTGTTTTGTTACAGTGACATATATATGGGG	Os09g0482200	AK105666	Peptidase A1, pepsin family protein.
235	3	65	ETG04_27747		
236	3	66	Os04g0462500|mRNA|AK101938|CDS+3'UTR	GTTTTTCTGTTTGCCTTTTTATTGGTGTTTATTGTTATGGTCAATCCTGTGTCTATATCT	Os04g0462500	AK101938	Similar to 14-3-3-like protein GF14-6.
237	3	67	Os12g0600200|mRNA|AK122147|CDS+3'UTR	TTGGTTGTATCCTGGATTAATGTTAAACTGATGTGGTACTAGACTGAAAATTGCTTCCAA	Os12g0600200	AK122147	Conserved hypothetical protein.
238	3	68	Os03g0762800|mRNA|AK063359|UTR	GATCAGAAGGAAGGGAGTAACCATCAGTCTGTTCCAAGCTTCCAACTCACTGCACAACGC	Os03g0762800	AK063359	Non-protein coding transcript, uncharacterized transcript.
239	3	69	Os01g0253900|mRNA|AK067101|CDS+3'UTR	TGAAGATCAAATGTCAATTAATTAGACTCTAAACTATATTAGAAATTTATTAATTGGACT	Os01g0253900	AK067101	Lipase, class 3 family protein.
240	3	70	Os06g0661500|mRNA|AK099401|CDS+3'UTR	AAACGCAGGAATCCATGTAGCTCATCTGGTTATAATATGTAAGACTCATCAAACAAACTA	Os06g0661500	AK099401	Conserved hypothetical protein.
241	3	71	Os07g0194000|mRNA|AK060910|CDS+3'UTR	ACTCCACAGCTAAATCTTAGTAAGAAGGAACAACTTGCATTTTCAAACCTGTGATCTTCA	Os07g0194000	AK060910	Similar to Vesicle-associated membrane protein 725 (AtVAMP725).
242	3	72	Os08g0120600|mRNA|AK104952|CDS+3'UTR	AAGTGATTTTGTCTGCTGTTTAACAGTGAATTAAAAAGTGGAGTACTACCTGATGATTCC	Os08g0120600	AK104952	Similar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13).
243	3	73	Os01g0734200|mRNA|X93301|CDS+3'UTR	TATTATTCATGCAGCTGAGTGTCTGGCTAAGGCCAGAAGCACGTTTTACTTTTGTATTTA	Os01g0734200	X93301	Similar to RbohAOsp (Fragment).
244	3	74	Os02g0101300|mRNA|AK105715|CDS+3'UTR	CTGCGGGTGTGTATGCTACTGAATTTTGCAGTCCTACCAGTTATTGGAATTTTACTGCGT	Os02g0101300	AK105715	Conserved hypothetical protein.
245	3	75	Os02g0733300|mRNA|AK101108|CDS+3'UTR	ACACTTGTACTGCTATGGTTCAGCGAGTGGATTATATATAAAGTGCACCACCGACGTTTC	Os02g0733300	AK101108	Similar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4).
246	3	76	Os01g0774500|mRNA|AK069241|CDS+3'UTR	AAACGTATTAGGCCTGAAAAGGGGCCCGAGTACAGCGCTGCAAGAGAAAAGAAGGTAGCA	Os01g0774500	AK069241	Conserved hypothetical protein.
247	3	77	DarkCorner		
248	3	78	DarkCorner		
249	3	79	DarkCorner		
250	3	80	DarkCorner		
251	3	81	DarkCorner		
252	3	82	DarkCorner		
253	3	83	DarkCorner		
254	3	84	DarkCorner		
255	3	85	DarkCorner		
256	4	1	DarkCorner		
257	4	2	DarkCorner		
258	4	3	DarkCorner		
259	4	4	DarkCorner		
260	4	5	DarkCorner		
261	4	6	DarkCorner		
262	4	7	DarkCorner		
263	4	8	DarkCorner		
264	4	9	DarkCorner		
265	4	10	Os08g0388300|mRNA|AK103311|CDS+3'UTR	GGTGATAACTGAAGGAGATTATGATTCATGAGGTTCATTCTTATGAGTGTTCTGAGTCTG	Os08g0388300	AK103311	Disease resistance protein family protein.
266	4	11	Os03g0418700|mRNA|AK101797|CDS+3'UTR	GACATATATATATCTACATGAGCAAGCAAACAGTAACACTGAGATCTTGCCAACCAAAAA	Os03g0418700	AK101797	Conserved hypothetical protein.
267	4	12	Os01g0128100|mRNA|AK071917|CDS+3'UTR	ACTATTTCCTTGTCATGATAAATCGAAATATATTCTTGAGCATGTGTGAAATGGGACTTA	Os01g0128100	AK071917	Similar to Bifunctional nuclease (Fragment).
268	4	13	Os03g0115300|COMBINER_EST|Os03g0115300|8	TACATGGGATGGATGAAGCTGCTAATTTGTTAAAGATGGAAGTGGGCATGGTTGATGGCA	Os03g0115300		Tetratricopeptide-like helical domain containing protein.
269	4	14	Os07g0663000|COMBINER|CI239180|6	TGTACAGCCATTGAATTTTTCAACATTTGTTGTTCTATCTGAAATTCGGTAGAGCGTTCC	Os07g0663000	CI239180	Conserved hypothetical protein.
270	4	15	Os06g0179800|mRNA|AK065817|CDS+3'UTR	TGAGTGTGGTGGAAAAGTGAATAACTTTACACTTTACATTGGGGCACCAAATTTAAGTAC	Os06g0179800	AK065817	Leucine rich repeat, N-terminal domain containing protein.
271	4	16	Os08g0322600|mRNA|AK069839|CDS+3'UTR	GAGAAAGATGTTGATTCAGTTGTTAGACTTGTTCTATGAGAACATGATCAGTATATGAGG	Os08g0322600	AK069839	Similar to PGT-2.
272	4	17	Os02g0777400|mRNA|AK060260|CDS+3'UTR	TGAATTTTGTAAGCACGGGTCAGTTAAAAATATCGCAGTGATCGGGAAAAATCCGCCTCT	Os02g0777400	AK060260	Similar to ERECTA-like kinase 1.
273	4	18	Os06g0715700|mRNA|AK121440|CDS+3'UTR	TTTCACTGTACATAAGGACTTGTAAAATTTGTGAAACCATTCTTGGAACCACACGATGTT	Os06g0715700	AK121440	Protein of unknown function DUF803 family protein.
274	4	19	osa-miR390|Os03|5'seq	GGTATGGAACAATCCTTGAAGCTCAGGAGGGATAGCGCCTCGAAATCAAACTAGGCGCTA			miRNA
275	4	20	Os09g0324000|mRNA|AK119722|CDS+3'UTR	GTGTAATGTTCCGTGTGTGTACAATAATTAGTTGCAAAATGCTGGATTGCTGGTACGGCG	Os09g0324000	AK119722	Similar to Oleosin.
276	4	21	Os03g0616600|COMBINER|CI484050|x	TGATCGCTGTTTCCCCGAGTTGTTAGGGGGAAAGCAGCCATCGCTCAAAATATAATTCAT	Os03g0616600	CI484050	Armadillo-like helical domain containing protein.
277	4	22	Os01g0843900|COMBINER_EST|Os01g0843900|8	GTGCACTTGAGCTGGGGCCTGTCCATGGCGTGGCTGGTCAACGACGGCCCTCTGCCGAGT	Os01g0843900		Laccase (EC 1.10.3.2).
278	4	23	Os01g0589300|mRNA|AK058846|CDS+3'UTR	GACAAGTTGGTGGTGGTGTTTTAGCATTACATTACAACTAATTAGCACATGCTGCAGTCA	Os01g0589300	AK058846	Similar to Single myb histone 1.
279	4	24	Os03g0310500|mRNA|AK068123|CDS+3'UTR	CCTTTGCCGGTATGTTACGAAAAACCTGGTATGTTAATAAAACCCATAATCCTCATGATG	Os03g0310500	AK068123	CAP protein family protein.
280	4	25	Os03g0151900|mRNA|AB032761|CDS+3'UTR	GTGTTCAATCGTATCGTATTGTATATGTTAATAGTGCCGTCGTGTAACATCTTAGTTTAC	Os03g0151900	AB032761	Similar to Small GTP-binding protein.
281	4	26	Os09g0468900|mRNA|AK120990|CDS+3'UTR	TGGATGCTCGAAGCTGAAGCATCCTGTAATCTCGTTGTAAAATACAACTGAAGATCTAAA	Os09g0468900	AK120990	Conserved hypothetical protein.
282	4	27	Os06g0163200|mRNA|AK068888|CDS+3'UTR	CATCGTGAGGGAAAGGCATACTCTACAACAAGTTGTCTCAGTTTATAATTGCTTATATTG	Os06g0163200	AK068888	Esterase/lipase/thioesterase domain containing protein.
283	4	28	Os11g0549600|mRNA|AK060533|CDS+3'UTR	ATTGTGAAGCGTTCAATCAATATCTCCATGGGGAATGAGAATGTTGCAAAAGAACTCGCA	Os11g0549600	AK060533	Maf-like protein family protein.
284	4	29	Os04g0459700|mRNA|AK109192|5'UTR+CDS	AGCTATGGATGAGGTGGCAGATGTCATCAAGGAAGATCTGTGGCCTAATCCTTTGAAGTA	Os04g0459700	AK109192	Nucleosome assembly protein (NAP) family protein.
285	4	30	Os01g0804400|mRNA|AK070931|CDS+3'UTR	TCATTGCTCTCGCTTGTTTGGAGAAATAAAATAGAACTGGTGTCGTGCTCCGGTTTTTTA	Os01g0804400	AK070931	Cytochrome P450 family protein.
286	4	31	Os02g0164800|mRNA|AK062817|CDS+3'UTR	GGATATGGTATAGAACTGTATTACAACATTTGTTACAGGGTAATTTAATAATGCCAGTTT	Os02g0164800	AK062817	Conserved hypothetical protein.
287	4	32	Os12g0569200|COMBINER_EST|CI551303|0	GTGTTTTGTCTTGTCGTGTTGTTGATTAATCCTCGATAATTTGATGTGCATGCATTGTTT	Os12g0569200	CI551303	Hypothetical protein.
288	4	33	Os07g0573300|mRNA|AK071682|CDS+3'UTR	AATACTGCTGAAATTGAAACATGCTTGGATGTCTCTGGAGAATATCAAAGAAACATTCGT	Os07g0573300	AK071682	Similar to FYVE finger-containing phosphoinositide kinase (EC 2.7.1.68) (1- phosphatidylinositol-4-phosphate 5-kinase) (PIP5K) (PtdIns(4)P-5- kinase) (PIKfyve) (p235).
289	4	34	Os03g0214200|mRNA|AK100623|CDS+3'UTR	TATTATGCTAAGGAGACAGCGGGAGATTTGCTCCTGCTGACATAAAAAGTGGTTAACATG	Os03g0214200	AK100623	Protein of unknown function DUF1675 family protein.
290	4	35	Os01g0106900|mRNA|AK099702|CDS+3'UTR	TCCGTGCGTTGTGTATTCATGTAAATTTTGACGGATGGTCAAGTAAAAATAACAATGGCA	Os01g0106900	AK099702	Similar to 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Fragment).
291	4	36	Os03g0644200|COMBINER_EST|CI375353|0	TGTGCAAGATCAGAAGACATGTAGCACAAAAAGGTAACTCAAGGAGTGCATACGTGTATA	Os03g0644200	CI375353	TPR-like domain containing protein.
292	4	37	Os06g0543200|mRNA|AK073606|CDS+3'UTR	GACTGTTAATTTTGTTTAACCATGCTTCCAGACCATATATAATACATATATATCTTATGT	Os06g0543200	AK073606	Similar to CDPK substrate protein 1.
293	4	38	Os07g0275300|mRNA|AK067254|CDS+3'UTR	TAGTGTAGCTGCATAACACTTCTAAAGCAACTGTAAATAAAATCTGCAGGTGAAGTTCAT	Os07g0275300	AK067254	Zinc finger, RING-type domain containing protein.
294	4	39	Os10g0343400|mRNA|AK110467|CDS+3'UTR	TCTCTATGGTGTTACAAGATGTTACGAGCAAGTTTAATAGTATAGCAAACTACTAGCTTC	Os10g0343400	AK110467	Cellulose synthase family protein.
295	4	40	Os06g0202700|mRNA|AK107741|CDS+3'UTR	TAATGGCTTGTGGATTTGATGGACTCGTGTTGTGGTATAGCGCACACTATGTTGCAGTAG	Os06g0202700	AK107741	Conserved hypothetical protein.
296	4	41	Os10g0522700|mRNA|AK068326|CDS+3'UTR	TCAGAACTTGCTGAAAGTTGTATATATTGGTGTTATGAGAGAGATAAAATTTCAGGCTGC	Os10g0522700	AK068326	Conserved hypothetical protein.
297	4	42	Os02g0653300|mRNA|AK099958|CDS+3'UTR	TGCAACAGTCGTAGTCATACATAACAATAATGTGTACTCGCTCCATCCCATAAAAACCAA	Os02g0653300	AK099958	Conserved hypothetical protein.
298	4	43	Os07g0618600|mRNA|AK121137|CDS+3'UTR	CATATGTTCATGTATATGTAATCATATGTCCTGGTTTATTATTAGCATTGGTCTGAAGAA	Os07g0618600	AK121137	Zinc finger, FYVE-type domain containing protein.
299	4	44	Os10g0127900|mRNA|AK121817|CDS+3'UTR	TGGTCTCCGGTGAAACGTATTGTATTTGTCTCTCTCCTAATATAATCCCATGTTATAGTG	Os10g0127900	AK121817	Conserved hypothetical protein.
300	4	45	Os01g0118000|mRNA|AK099387|CDS+3'UTR	TTGATAGCACGCTTTTACTGTAAGCATATGCCTTTCGGCCATGAGACTGTGAGAGAGATG	Os01g0118000	AK099387	Similar to Fructose-bisphosphate aldolase (EC 4.1.2.13) (Fragment).
301	4	46	Os01g0872400|COMBINER|CI554899|x	TGTCAGCGATCGACTGGGTGACAAGGGGAGAAGGAGAGAGCTGGTTCTCCGATAACCTCA	Os01g0872400	CI554899	(No Hit)
302	4	47	Os02g0742200|mRNA|AK069345|CDS+3'UTR	AGTATCGTCATTAGAACATTTTATGATTCGATGGTAGAACTGAAAGCAGCAACTACAAAG	Os02g0742200	AK069345	Small GTP-binding protein OsRac3.
303	4	48	Os08g0135500|mRNA|AK109912|CDS+3'UTR	TTGCATAGCACTATATGGTCCTGTGCTGCTGTGAACGAACAGTGGCCCAACTATAATAAA	Os08g0135500	AK109912	X8 domain containing protein.
304	4	49	Os01g0218900|mRNA|AK065476|CDS+3'UTR	TATTTGAAATGCTTATGCTGTTGTATGTTTAGCCACCGAAGTAATGTAGTTTGACAGTTC	Os01g0218900	AK065476	PWWP domain containing protein.
305	4	50	Os06g0328800|mRNA|AK065974|CDS+3'UTR	GGCATTGTAAAGTTTGTCTCATTGTCTGCTAACTTAATGGAAGGTTGGATCTTATATAGT	Os06g0328800	AK065974	Protein of unknown function DUF23 family protein.
306	4	51	Os09g0568000|mRNA|AK120601|CDS+3'UTR	GCATGTGTTTTCCTTTGCGAGGTACTCCAGTACATGTCCTGTTAACTGGGTAGGAGTAAT	Os09g0568000	AK120601	Conserved hypothetical protein.
307	4	52	Os02g0110200|mRNA|AK105694|CDS+3'UTR	AGCGTACAAGTAAAAATTGTTTTCACTGTTTTATGTGGATATATATATGTACAGGGATCC	Os02g0110200	AK105694	Similar to Hydroperoxide lyase.
308	4	53	Os07g0658400|mRNA|AK068130|CDS+3'UTR	GGGGCATGCGAGTCGCATGTGCATACAGCTATAGTGAATAAAGTGTACTGTCAAGTAGTT	Os07g0658400	AK068130	Similar to Ferredoxin-dependent glutamate synthase, chloroplast precursor (EC 1.4.7.1) (Fd-GOGAT).
309	4	54	Os06g0550000|COMBINER_EST|AU083369|7	AGGTCCAGTCACTGCTTGTTATGAGCGCAGACAAGTTTTTATTTCACCTAATGCAATGCC	Os06g0550000	AU083369	Similar to 60S ribosomal protein L11-2 (L16). Splice isoform 2.
310	4	55	RC1		
311	4	56	Os01g0215100|COMBINER_EST|Os01g0215100|8	GCGCGGCGATGCACGGGGACGTGATGAAGAGCGTGAAGCCGGGGGTGGAGGCGCTGCTGC	Os01g0215100		Peptidase S10, serine carboxypeptidase family protein.
312	4	57	Os03g0323100|mRNA|AK062803|CDS+3'UTR	TTTCTTCAAATCAAAGAGGCCCTAACAATGTGTAAGTTACTGTTTGGCTGTTTGCATGCT	Os03g0323100	AK062803	Hypothetical protein.
313	4	58	Os02g0792900|mRNA|AK104731|CDS+3'UTR	CGTGTGATACCAGGCATTGTGCCTGTATTTTAACAGTAAAAATTGGGTACGTTGTTTGTG	Os02g0792900	AK104731	TMS membrane protein/tumour differentially expressed protein family protein.
314	4	59	Os01g0206800|mRNA|AK100525|CDS+3'UTR	ATTTGTATGAATATTTATAAGTTTGATCAGTGTAAAAATCAAGCAAGTTCGCTGCTGTTA	Os01g0206800	AK100525	Protein kinase-like domain containing protein.
315	4	60	Os03g0390600|mRNA|AF467728|CDS+3'UTR	TTTTGTGGAACAATATGTTTCTCATGATGGTGCTGTATTCGTCTTATTGGTGGATCTGTC	Os03g0390600	AF467728	Similar to Histone H3.3.
316	4	61	Os08g0271600|COMBINER_EST|Os08g0271600|8	GCCAGAATGCAATTGCAGATAGCTGATCTACATAAGCAATTAGAGGACCAGAAAGAGGTA	Os08g0271600		Conserved hypothetical protein.
317	4	62	Os03g0239400|mRNA|AY072930|CDS+3'UTR	CCTGAATTGATGTGTGTCACAGTTATAGTTTGTGACTTATCATTCAGATAATTAGAGGCA	Os03g0239400	AY072930	Similar to Transcription factor HBP-1a(C14).
318	4	63	Os03g0329500|mRNA|AK102748|CDS+3'UTR	GTTGTATACTTGTATAATCCCCATGTTATGTAACACTATTGCTGTTCTGGTATGAACCTA	Os03g0329500	AK102748	Similar to Endo-1,4-beta-glucanase (EC 3.2.1.4).
319	4	64	Os06g0363900|COMBINER|CI138399|6	CTAAACCGCCCATCTGCCTGTAATCGGAACCCCACCATATTGAGTTTGATAGTGAAACTT	Os06g0363900	CI138399	(No Hit)
320	4	65	Os06g0308200|mRNA|AK058998|CDS+3'UTR	ATTAGTTATGATGTGCTCCCTCCATTTTTTAATATGTGCCGTATATTGAAAACGGAGGGA	Os06g0308200	AK058998	Similar to 60S ribosomal protein L15.
321	4	66	Os01g0917400|mRNA|AK111958|CDS+3'UTR	AATTGAGTTGCTACCGGAGATGTACAGTTTATTTTTTGTTAATGCAGATCTTTGGGAAGC	Os01g0917400	AK111958	Zinc finger, CCCH-type domain containing protein.
322	4	67	Os09g0406500|COMBINER|CI343198|1	GCCCCAGCTGACAAGTTTAAGTTGATGGATGAATCCTTCAAAGTGGCTGTTATGCAGGTA	Os09g0406500	CI343198	(No Hit)
323	4	68	Os10g0487400|mRNA|AK064407|CDS+3'UTR	AGGCAGGAAACGTGCGTTGGGAGTTTGAGACTTTTATGTGTAGATTTGTTAATTAAATTC	Os10g0487400	AK064407	Zinc finger, RING-type domain containing protein.
324	4	69	Os03g0231600|mRNA|AK105963|CDS+3'UTR	TCTGTGTGGCCAATAAAATCTTGTCATTGCCAAATCTTTGAGATAACTGAATAGTACGCT	Os03g0231600	AK105963	Similar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC 2.6.1.42) (Atbcat-3).
325	4	70	Os04g0367000|COMBINER|CI413726|x	TAGTGTCTACAATTGTAGCTCTTCTATCAAAAGATTCTCCAGTTTTAGAGTAGTTGATGG	Os04g0367000	CI413726	(No Hit)
326	4	71	Os03g0612400|COMBINER|CI418969|x	GCATTTGTTCCTTTGCTATATTTGCTCTAGTATATTTTTGTGTACAAAGAAATAAAAGCC	Os03g0612400	CI418969	Similar to LATERAL ORGAN BOUNDARIES protein.
327	4	72	Os08g0161500|mRNA|AK060630|CDS+3'UTR	AAGTTTAATTCTGTAGAAACTAGACCTTGGTTCTCTTAGCTAAACAAACCATAGCAAGAT	Os08g0161500	AK060630	Esterase/lipase/thioesterase domain containing protein.
328	4	73	Os06g0173100|mRNA|AK065612|CDS+3'UTR	TATGTGATGGAAAGTTGGAAACTGGAAAGCTTCTTATGTGATGGAAACTGGAAAGTTTTT	Os06g0173100	AK065612	Similar to 26S protease regulatory subunit 6A homolog (TAT-binding protein homolog 1) (TBP-1) (Mg(2+)-dependent ATPase 1) (LEMA-1).
329	4	74	Os02g0777100|mRNA|AK100528|CDS+3'UTR	AGAAAATACCAGAACTCATTTAATATCGCTTGTCAGGCTCAATGATCTATCACACATTGA	Os02g0777100	AK100528	uDENN domain containing protein.
330	4	75	Os04g0168000|mRNA|AK109174|CDS+3'UTR	TCCGGTGATCTCGTTATCAATGAGAAGAGAGGAAAGAAGGGAAGATTATTGCTCACCCGT	Os04g0168000	AK109174	Conserved hypothetical protein.
331	4	76	Os09g0483600|mRNA|AK101709|CDS+3'UTR	GAATGATTGAATTGAAATTTTTGCGGTAATTCTGGATCTATGCAGAATATAACTTGATTC	Os09g0483600	AK101709	Transcription factor jumonji/aspartyl beta-hydroxylase domain containing protein.
332	4	77	DarkCorner		
333	4	78	DarkCorner		
334	4	79	DarkCorner		
335	4	80	DarkCorner		
336	4	81	DarkCorner		
337	4	82	DarkCorner		
338	4	83	DarkCorner		
339	4	84	DarkCorner		
340	4	85	DarkCorner		
341	5	1	DarkCorner		
342	5	2	DarkCorner		
343	5	3	DarkCorner		
344	5	4	DarkCorner		
345	5	5	DarkCorner		
346	5	6	DarkCorner		
347	5	7	DarkCorner		
348	5	8	DarkCorner		
349	5	9	DarkCorner		
350	5	10	Os11g0689500|COMBINER|CI138407|6	CTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGG	Os11g0689500	CI138407	Hypothetical protein.
351	5	11	Os02g0213000|COMBINER|CI396876|6	AAAGTCCTCTTGATCCTGAGGCTTTTATATTGGCATGAACTAGGTGCTGATTTTTGCGAA	Os02g0213000	CI396876	(No Hit)
352	5	12	Os06g0176900|COMBINER|CI276595|6	GGTGACCAACTGCACCATGATATGGTCTTAATCAATTGATATTTATAGAAGGTTTCTTTG	Os06g0176900	CI276595	(No Hit)
353	5	13	Os06g0483500|mRNA|AK066173|CDS+3'UTR	CTCTAACACTGGAATAAGTCAGGTATGCAACCTTTTGATTAGTAAGTTTGTTAATGCACA	Os06g0483500	AK066173	Hypothetical protein.
354	5	14	Os03g0629800|mRNA|AK071513|CDS+3'UTR	AATGTACTGGGATTTATTCCAGTGAACTCTGTCGTTTTATATTAATGGAGGTTTAAGTTT	Os03g0629800	AK071513	Conserved hypothetical protein.
355	5	15	Os07g0635200|COMBINER_EST|CI392738|6	TTTAGCACCGCTTTGTTGTACACGAGTTGCTTCCTGATAATGTTATCGTGTAATGTATTG	Os07g0635200	CI392738	Cytochrome P450 family protein.
356	5	16	Os05g0239900|mRNA|AK121499|UTR	AACAATTGGCCTTCCCAGTTTGATTGATTGGTGGTCCAAGGATGAAAGGCAATTACAATT	Os05g0239900	AK121499	Conserved hypothetical protein.
357	5	17	Os12g0631800|mRNA|AK063915|CDS+3'UTR	ACCCTATTTCCCAGTATGAAGATATTTTGCATTTGTTCTCTTCTATTTGCAGCCTGTCTG	Os12g0631800	AK063915	Similar to Phytoene dehydrogenase-like.
358	5	18	Os05g0378800|mRNA|AK058210|CDS+3'UTR	CACATGTGGTACTACTACGACTGAACGGCATGAAGGCTAAATTTACAGTGGACTTTGAGG	Os05g0378800	AK058210	Protein of unknown function DUF248, methyltransferase putative family protein.
359	5	19	Os07g0573800|mRNA|AK072835|CDS+3'UTR	GCAGATGCAGCTACCATCATCTCTCATAAATGCTAGCGAAATGTGTTTTTGGGATAGCAT	Os07g0573800	AK072835	Pyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein.
360	5	20	Os02g0639800|mRNA|AK062859|UTR	GTGTAACTGACAGCCTTAACCCTATTGGAAAATTAGAAGGAATAATTAAGATGTTGCTTC	Os02g0639800	AK062859	Zinc finger, RING-type domain containing protein.
361	5	21	Os07g0586500|mRNA|AK072668|CDS+3'UTR	GCACCTGTGTTTGTCTAGACTGGAGCAATGGTGATGTTCTTGTCTACTTTCTCGTTTCTG	Os07g0586500	AK072668	Similar to SUMO activating enzyme 2.
362	5	22	Os02g0215400|mRNA|AK102434|CDS+3'UTR	GTTTGCAAATTCGCAGTCTGCCCGGCGGCTTGGACTCGTTTTAAAAACTTATCTTGAAGA	Os02g0215400	AK102434	Conserved hypothetical protein.
363	5	23	Os02g0552200|COMBINER_EST|Os02g0552200|8	TGATCGACGACCTATTCGACGAGGTCGCCGAGGGGAGGAAGAAGCTCCTCGACCTCTGCA	Os02g0552200		UvrB, C-terminal UvrC-binding domain containing protein.
364	5	24	Os10g0578100|mRNA|AK070183|CDS+3'UTR	AGTATCAGCGGTGTTATTTTAGACTAATCAAAACTCCACAAACAATTACACAACTGCAAG	Os10g0578100	AK070183	Conserved hypothetical protein.
365	5	25	Os03g0127600|mRNA|AK103695|CDS+3'UTR	TTCCCCACATTCCTTTTTGTCGATAAATACAAGTGTATCTTAACGAACCGGGGTACTCAA	Os03g0127600	AK103695	SMAD/FHA domain containing protein.
366	5	26	Os12g0168900|mRNA|AK104011|CDS+3'UTR	AGTGATGTAATCTGGTGAATAAGCAAATAATTCGTAATGCAATGGGAGCATGAGACTCTT	Os12g0168900	AK104011	Similar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment).
367	5	27	Os03g0301800|mRNA|AK106465|CDS+3'UTR	TGATTGTCTCAGTGTGGTGAGTTGTGATCTCAACAACTGGTGTGTGAGGCCATTAACCTT	Os03g0301800	AK106465	Similar to Kinesin-like polypeptides 9 (Fragment).
368	5	28	Os10g0540100|mRNA|AK074016|CDS+3'UTR	GTGGGATTTAGTGTGTCCAGTGTAATCATACAGGGTTCATCTCACTGTCTGCCAACCTTT	Os10g0540100	AK074016	Tetratricopeptide-like helical domain containing protein.
369	5	29	Os10g0522800|mRNA|AK072776|CDS+3'UTR	GCTAGCTCCAGTAATCTGAGATGTACATGAACTTACTGCATTTTTCATCTTGTGTACCAT	Os10g0522800	AK072776	Conserved hypothetical protein.
370	5	30	osa-miR164c|Os05|5'seq	AGGTTCTTGTTGGAGAAGCAGGGTACGTGCAAAATGCACACCGGTTGGTCGAGCTAATTA			miRNA
371	5	31	Os08g0344700|COMBINER_EST|Os08g0344700|8	CTTGGAGTTGCCAAAGGAGAGCCAGATTCACCCAGTTGTATATGTTTCTCTCCTCAAGAA	Os08g0344700		Retrotransposon gag protein family protein.
372	5	32	Os08g0296700|mRNA|AF456244|5'UTR+CDS	AATGTGTATTTGGACATGAGAACTATAAAGGAGAACCAAGACTGGAAAAAATTGGGCAGC	Os08g0296700	AF456244	Disease resistance protein family protein.
373	5	33	Os01g0798200|mRNA|AK109272|CDS+3'UTR	AGCATGGAATACATGGTGTAATAATTTTAAAATGGCATGGTGAATAATAGAAATCATTAG	Os01g0798200	AK109272	Conserved hypothetical protein.
374	5	34	Os01g0173600|COMBINER_EST|Os01g0173600|8	ATGGCTGTTCAACTACGGCATCGGCATCCACCTGCTGCAGGCAGAGGACCCGGAGAGCAT	Os01g0173600		Glyoxalase/bleomycin resistance protein/dioxygenase domain containing protein.
375	5	35	Os08g0119800|mRNA|AK060602|CDS+3'UTR	CCTGTTCCTAATCCTCTCTTCCCTTGAACAAAAATTCAGTACAGCTCTTCTTCTTATTTG	Os08g0119800	AK060602	Similar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)].
376	5	36	Os07g0564200|mRNA|AK072771|CDS+3'UTR	AGTATGTTGTACATATGCTGGAGATGAAGAGAGGAAGTTGATTAAATTTTTGTTACCGGT	Os07g0564200	AK072771	Conserved hypothetical protein.
377	5	37	Os01g0918300|mRNA|AB016030|CDS+3'UTR	GACATTAGAAGAGCTTTGTTTGGCAAAAATATTTTGGTACTTCGGCTGTTATGACTCGTT	Os01g0918300	AB016030	Ubiquitin-like protein SMT3.
378	5	38	Os01g0379600|COMBINER|CI018213|6	CAAGGAGGGAACAATAGTGAGGAGAAAGTACGTGCCGTAATTATTGTGTACACGATGTAA	Os01g0379600	CI018213	(No Hit)
379	5	39	Os09g0484300|mRNA|AK100330|CDS+3'UTR	TAAGGCTTAAACCATGTCATAAAGGTAATTGCAACGTGTAGTAGCCATGTGGCTTGGTGT	Os09g0484300	AK100330	Ubiquitin domain containing protein.
380	5	40	Os01g0179700|mRNA|AK059888|CDS+3'UTR	CTTGCTTTGTTGCTCTTTGCTCACGAATCGAGAGGAGCAAGCAGAACCAGTGTATTTGAT	Os01g0179700	AK059888	Similar to GTP-binding protein YPTM2.
381	5	41	Os07g0467200|mRNA|AK070358|CDS+3'UTR	GGCCTCATGTTGAGTCAAACAATATTTGCATGTCATAGTTTGTATGATCATTTTTGTCAC	Os07g0467200	AK070358	Similar to Clone ZZD536 mRNA sequence.
382	5	42	Os02g0701900|mRNA|AK060640|CDS+3'UTR	TGAGAAATTGTAGAAGTTACAATGCAACAATAAATTAACTTGTTAGTTCCAGCTGAACTG	Os02g0701900	AK060640	Glucose/ribitol dehydrogenase family protein.
383	5	43	Os12g0563600|mRNA|AK060891|CDS+3'UTR	CTTTTCTTGCTGCTGTTAAACAGAGAGAAAATGATATATATATATGGAGAGATCGACGAC	Os12g0563600	AK060891	Protein of unknown function DUF538 family protein.
384	5	44	Os01g0736900|mRNA|AK065226|CDS+3'UTR	CCCCTTTCATGTTCAACTTTAAGCATAGTTACTATATCTGGATGCTAGAAGTATTATGGT	Os01g0736900	AK065226	Reticulon family protein.
385	5	45	Os01g0873200|mRNA|AK109463|CDS+3'UTR	GTATCTTTGGGCCTCGTATTTCCCAGTTCATCCCAGCGAAAAGAAATGGAATCGTTTAAT	Os01g0873200	AK109463	Similar to Amidophosphoribosyltransferase, chloroplast precursor (EC 2.4.2.14) (Glutamine phosphoribosylpyrophosphate amidotransferase) (ATASE) (GPAT) (Fragment).
386	5	46	Os03g0760900|COMBINER|CI265000|6	GCCCATGTTTGGCGATTGCTATTTTTTAGCTAGTGAGATAGCTATGTTATTGGAGTACAT	Os03g0760900	CI265000	Conserved hypothetical protein.
387	5	47	Os03g0272400|mRNA|AK070454|CDS+3'UTR	TCACTGCTATGTATATATGTCTTCTGAGTTCTGAACGGACTAATGTACTCCTCTGAAGTC	Os03g0272400	AK070454	Hypothetical protein.
388	5	48	Os09g0386500|mRNA|AK099307|CDS+3'UTR	TGCCTGGTACAGGAAAACGTTCCCAGCGTGGATGATGTTGATGATAGCTTAACTGTAGTT	Os09g0386500	AK099307	Bromo adjacent region domain containing protein.
389	5	49	Os02g0130200|mRNA|AK106802|CDS+3'UTR	CACTCCGTTTCACAATGTAAGGTATTCTAGTATTTCTAATATATTGATGTTAATGAATCT	Os02g0130200	AK106802	Virulence factor, pectin lyase fold family protein.
390	5	50	Os01g0256300|COMBINER_EST|Os01g0256300|8	AGAAAGCCGAGCGGGAATTTGGATCATGGTGAGTGCCTTAACAAGAAGAGGCGGCCAATG	Os01g0256300		Protein kinase-like domain containing protein.
391	5	51	Os01g0550700|COMBINER_EST|Os01g0550700|8	GCTGAAGGGTTTCCAACTTATCCTGAGAAGATACAAGTTGTTAAAGAATGGCCAACTCAT	Os01g0550700		Hypothetical protein.
392	5	52	Os01g0840700|COMBINER_EST|CI562569|1	TCGATACATCGGTTTTGTCACAATTTCTCAGGGTTCTATTGCCCTTGATTCTGTGGAGTT	Os01g0840700	CI562569	Similar to 60S ribosomal protein L36.
393	5	53	Os04g0194500|mRNA|AK121164|CDS+3'UTR	ATTCTTTCATTATTTTGTACAGTTGTAAATCAGTTTTGATACTACAGATGAAATATAGAG	Os04g0194500	AK121164	Similar to ABC transporter-like protein.
394	5	54	Os05g0149600|mRNA|AK073947|CDS+3'UTR	CACTCCTGAGTTAACCTGGATGCTAAATGGGTATTTATTTGCTCTATGAAATAGTAGTAT	Os05g0149600	AK073947	Similar to Cullin-1.
395	5	55	Os01g0571900|COMBINER|CI137437|6	GCGATGTGGAAGCTGTTGTGTCGCTTTTGTGTTTAGCTTTGTGGCGACGTCCTGCGATTG	Os01g0571900	CI137437	(No Hit)
396	5	56	Os05g0563400|mRNA|AB071290|CDS+3'UTR	TGGCAGGGTGATTGATATTTCAACTATGGATATGATGATCTGATTTATGAGCTGGATTTG	Os05g0563400	AB071290	Similar to Auxin response factor 5.
397	5	57	Os12g0573800|mRNA|AK106961|CDS+3'UTR	TTACTCCTAACTCTTTAGACTTCGATCTGCCCTAGTGTTATGGGCAATCCTGCCAGATTA	Os12g0573800	AK106961	Similar to Piccolo protein (Aczonin).
398	5	58	Os11g0696900|COMBINER_EST|CI424604|0	TGCAACACAAGTGTCCATGCCTAAGTGTTGATTGCAACACAATGCAACATGCAAGCGGAA	Os11g0696900	CI424604	Cupredoxin domain containing protein.
399	5	59	Os04g0371600|COMBINER_EST|CI419570|3	AGCATAAGAGTGTCTTTTGGAAGGCATCCTTCCCATGAATGAAAATTCTCAATGACAACC	Os04g0371600	CI419570	Leucine-rich repeat, cysteine-containing containing protein.
401	5	61	Os09g0511600|mRNA|AK121679|CDS+3'UTR	CAAATTGTGTGATTTAGATCAATGGGTCAAAGTGTATGATGTGATTGTGTAATTGTGTCG	Os09g0511600	AK121679	Glycoside hydrolase, family 1 protein.
402	5	62	Os03g0757000|COMBINER_EST|Os03g0757000|8	ATTGCCCGACGACCTTAACCACAGCGACATTGCCGGGTACATGCCCTCGGAGCTTGGGCT	Os03g0757000		UDP-glucuronosyl/UDP-glucosyltransferase family protein.
403	5	63	Os01g0136200|mRNA|AK121025|CDS+3'UTR	TTGTACTCTGTTGTGAGCGCGTTTGCACGAAGCAATAAATAAAAATAAAATCAGCTTGTT	Os01g0136200	AK121025	16.9 kDa class I heat shock protein.
404	5	64	Os05g0190500|mRNA|AK109335|CDS+3'UTR	ATGCATTGTGTTGAGCAAGCTGGTTGTATTTATTGATCGATGGATTATACAGTTCCTTAC	Os05g0190500	AK109335	Similar to Acid phosphatase.
405	5	65	Os05g0387300|mRNA|AK059416|CDS+3'UTR	ACTTGTTGCTGTATTTCGATTTACGCATGAAAAACTTTGGGTAGAAATAGAATGTTACCG	Os05g0387300	AK059416	Conserved hypothetical protein.
406	5	66	Os03g0745000|mRNA|AK069579|CDS+3'UTR	CAGCTACTGCTGCCCTTTTAAAATTTGAAAGTTACGGAGTAATTTCAGCTGATTTTTAAG	Os03g0745000	AK069579	Winged helix repressor DNA-binding domain containing protein.
407	5	67	Os07g0529600|mRNA|AB110170|CDS+3'UTR	AGGGCAAGAAAACTTCCATGGATCCGTCTCTCTGGGAGGAATGAATAAAAAGGATGAGGA	Os07g0529600	AB110170	Similar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor.
408	5	68	Os01g0384800|mRNA|AK120910|CDS+3'UTR	ATTACGCGTATACGGTAGGGATCCCTTTGGTATGTACAATACAAGTCTAAAGTAAATTCT	Os01g0384800	AK120910	Conserved hypothetical protein.
409	5	69	Os06g0692700|mRNA|AK101257|CDS+3'UTR	AGGAGCTTTTGCTAGGCTTTGCATTTGGGCCAACTCTGAACAATGAAGGAATGGGTGAAA	Os06g0692700	AK101257	Leucine rich repeat, N-terminal domain containing protein.
410	5	70	Os07g0666900|mRNA|AK064004|CDS+3'UTR	GTTGCCACCCTGCATGTAAAATGAAATTCTCCGCCAAAATAGATTTGTGTGTATAATAAT	Os07g0666900	AK064004	Similar to Na+/H+ antiporter NHX6.
411	5	71	Os03g0225900|mRNA|AK066138|CDS+3'UTR	TGACAGTGTCTTTAAACACCTCTAATATGTATCGGATCAATCTGCCCTAGTCATGTCTAA	Os03g0225900	AK066138	Allene oxide synthase.
412	5	72	Os07g0249800|mRNA|AK110647|CDS+3'UTR	GTTTGGGCATTTTATATTGAATAAATTTTGCTGGCATAAATTAATTAATTTGCAACCGAG	Os07g0249800	AK110647	Similar to IAA-amino acid hydrolase 1 (EC 3.5.1.-).
413	5	73	Os03g0857500|mRNA|AK062332|CDS+3'UTR	AAGAGACTACGCACCTTATGTTCTACTTTTCTTATTTAGTTTCATGGACCACTCATTCTT	Os03g0857500	AK062332	Protein of unknown function DUF303, acetylesterase putative domain containing protein.
414	5	74	Os06g0187200|mRNA|AK106963|CDS+3'UTR	TGTTGTTGGGGGGTTTGTGGGGATGGAAGGAGGAATTGATTCTTTTGTTAATTTTTTTTC	Os06g0187200	AK106963	Similar to Nucleotide sugar epimerase-like protein (UDP-D-glucuronate 4- epimerase) (EC 5.1.3.6).
415	5	75	Os02g0751100|mRNA|AK120012|CDS+3'UTR	TTACTACTTGTATGGTGCTACAGAATGGGCCAAAGTTTAGATGAAAACTTCCTCTGAATT	Os02g0751100	AK120012	Peptidase A1, pepsin family protein.
416	5	76	Os03g0791800|mRNA|AK120251|CDS+3'UTR	CCTACTTGTTTTCCCAATGTAGTGGCTACCTATTTGATGAATTTATAAGGTATTGATGCT	Os03g0791800	AK120251	Rad6 (Ubiquitin carrier protein).
417	5	77	Os08g0201100|COMBINER|CI557177|x	GTCAAAGTCTTGGTCAATGCCATTTGTAATACTTAGTAATTAACAGCACTACACATGACA	Os08g0201100	CI557177	Conserved hypothetical protein.
418	5	78	DarkCorner		
419	5	79	DarkCorner		
420	5	80	DarkCorner		
421	5	81	DarkCorner		
422	5	82	DarkCorner		
423	5	83	DarkCorner		
424	5	84	DarkCorner		
425	5	85	DarkCorner		
426	6	1	DarkCorner		
427	6	2	DarkCorner		
428	6	3	DarkCorner		
429	6	4	DarkCorner		
430	6	5	DarkCorner		
431	6	6	DarkCorner		
432	6	7	DarkCorner		
433	6	8	DarkCorner		
434	6	9	Os01g0113000|COMBINER_EST|CI273081|6	GAACCTGTGATGGCTTATATACTTATTATTATCATCGCTGTTGGTTCTTATATACCTGAC	Os01g0113000	CI273081	Peptidase C48, SUMO/Sentrin/Ubl1 family protein.
435	6	10	Os10g0189600|mRNA|AK103411|CDS+3'UTR	AGGTACATAATTTGTATGTTCATCGATCTGGCGCAATTCATTGTCATATTTACCAAGAAT	Os10g0189600	AK103411	Aminotransferase, class I and II domain containing protein.
436	6	11	Os06g0335500|mRNA|AK063854|CDS+3'UTR	AATTGTTGTGCTGTATGATGCAAACTATTTTTGGTATTTTACTTGGTGCTTGCAAGTTGC	Os06g0335500	AK063854	AUX/IAA protein family protein.
437	6	12	Os11g0294300|mRNA|AK108665|CDS+3'UTR	TTTTTCTTTTTGGAAGGAGCAGTTCTTTAATTTCGGAACCATGGGACCTGGCTGCACCAT	Os11g0294300	AK108665	Conserved hypothetical protein.
438	6	13	Os05g0170000|mRNA|AK100216|CDS+3'UTR	GCCAATTCAATGATTCTCATCATTGTTGTTCCTCCAATTGATGTGTTACTTCTTGTACTC	Os05g0170000	AK100216	Protein of unknown function DUF266, plant family protein.
439	6	14	Os04g0210700|COMBINER_EST|Os04g0210700|8	ACGCTCAGCGAGCAGAGCAAGGAACTCGAAATGCTGGGCAAGGAGAAGGACGTTGTGATT	Os04g0210700		Conserved hypothetical protein.
440	6	15	Os02g0122300|mRNA|AK106553|CDS+3'UTR	TTTTTTGCCAACTGTAGTATAATGTGTATCTGGTTTATATTGGAGTCCTGCAAGTGAATC	Os02g0122300	AK106553	Conserved hypothetical protein.
441	6	16	Os04g0174200|COMBINER_EST|AU091794|7	GTACCAACCATCGAGGGCTGGACTGGAACAATCTTAATAAAATAACATCAATTAGCACGA	Os04g0174200	AU091794	Conserved hypothetical protein.
442	6	17	Os11g0490100|mRNA|AK108872|CDS+3'UTR	GAGAGTGATTTGAGTCTCTCGAGATCACTAAAGTTGGTGTGAACAACAACACGGTGTGTA	Os11g0490100	AK108872	Protein of unknown function DUF579, plant family protein.
443	6	18	Os03g0616300|mRNA|AK102930|CDS+3'UTR	CACTGGTCCGGGATTGAAGGATCCCAACGCTCTATGAATATGAGCTATTTCATGTGTCAA	Os03g0616300	AK102930	Similar to DNA polymerase kappa (EC 2.7.7.7) (DINB protein) (DINP). Splice isoform 4.
444	6	19	Os03g0174600|mRNA|AK059155|CDS+3'UTR	TTCTGATCATATGTTTTATCACTTTCTCGTCTCGGTTCGGTTGGTTGGTTCTGTGCCAAA	Os03g0174600	AK059155	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase family protein.
445	6	20	Os10g0546400|mRNA|AK069919|CDS+3'UTR	GCCTGTGAAGTAATGACAAGTTGTATGATCCGTGTATACATCCATCAATGTATCAGTGAA	Os10g0546400	AK069919	Conserved hypothetical protein.
446	6	21	Os08g0191800|COMBINER_EST|Os08g0191800|8	CCGTGAGCACTTTGAAAACAACAAGGAAGCCAAATTCTTGCGTGATACAGTTAAGGGCTA	Os08g0191800		Aminoacyl-tRNA synthetase, class Ib domain containing protein.
447	6	22	Os12g0152800|mRNA|AK072885|CDS+3'UTR	AAACATGCATAGAAAGGGACAAAATCCATATCTAGCCCTTATTTTGTACACCTTCACATC	Os12g0152800	AK072885	Conserved hypothetical protein.
448	6	23	Os02g0150200|mRNA|AK121324|UTR	TATGATTATTCTGTGATGATTTAATTAAGGAGGGAGATGATAGAGGAGGATGATGTACTC	Os02g0150200	AK121324	Hypothetical protein.
449	6	24	Os02g0259100|mRNA|AK068099|CDS+3'UTR	ATGCACTTTCTCAGGGAGATCGACCTTCAAACACTGAAACAAGCAGGTGCAGCATTTTCT	Os02g0259100	AK068099	Conserved hypothetical protein.
450	6	25	POsControl0044|art		
451	6	26	Os10g0468500|mRNA|AK120876|CDS+3'UTR	ATTTTCCCCCATAGGCTAAACAATAAACTTGTAAATGTAAGACAGAGAAGAGAAATGGAG	Os10g0468500	AK120876	Tyrosine protein kinase domain containing protein.
452	6	27	Os08g0522400|mRNA|AK065893|CDS+3'UTR	AGGAATGTAAGAATTGGAACTTTCATGTTAAAGGCAGCGTTCTTTTCTGAAACTTCAAAC	Os08g0522400	AK065893	Haem peroxidase family protein.
453	6	28	Os01g0162500|COMBINER|CI528626|x	TAGCTGTAATTGTAGCTAGCATGTATATAATACTATGTGCATGGACAACACTTTTCCATC	Os01g0162500	CI528626	Leucine-rich repeat, typical subtype containing protein.
454	6	29	Os05g0326100|COMBINER|CI259794|6	CGCCTGTGAAGATGGAGCCGTATGCCCGCTAGTCCGCTGCTGTTTATTTTTGATTGTCAG	Os05g0326100	CI259794	(No Hit)
455	6	30	Os03g0577200|mRNA|AK104547|CDS+3'UTR	ATTGCAAAGAACGATCTATTAATCCAATCGTGAGTTGCAATTGTTGCTTCCTTTTCCCAG	Os03g0577200	AK104547	Similar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A).
456	6	31	Os05g0412900|mRNA|AK061020|CDS+3'UTR	ATTGAAACCAGTATCGATGCGTCGTCACTCAAGATCGCCACCCTACGTGCCACGTACATG	Os05g0412900	AK061020	Conserved hypothetical protein.
457	6	32	Os01g0253900|mRNA|AK072113|CDS+3'UTR	CTCAGATAGATGAAGATCAAATGTCAATTAATTAGACTCTAAACTATATTAGAAATTTAT	Os01g0253900	AK072113	Lipase, class 3 family protein.
458	6	33	Os12g0257800|COMBINER_EST|Os12g0257800|8	TACATGCATTGCCACTTTGAAGCTCATATTGAGTTCGGTTTGGCCATGGTGTTCGAGGTT	Os12g0257800		Similar to Laccase (EC 1.10.3.2) (Fragment).
459	6	34	Os03g0425100|mRNA|AK070206|CDS+3'UTR	TGGCGATAGCATGGAGCAACAGGCAGAAATGCCATTCTTTGTTCATTTTATTTTTCCTTT	Os03g0425100	AK070206	Hypothetical protein.
460	6	35	Os03g0114100|mRNA|AK108265|CDS+3'UTR	AGATTTCACATCATCTTCTCAAAGAGTGTGTACATATGATCGATCAACGAAATTGCCTTC	Os03g0114100	AK108265	Conserved hypothetical protein.
461	6	36	Os10g0580100|COMBINER|CI405191|6	TTAAGACCAAGCGAGCCAATTTTTGGGATGACCAAAATTGATTCGAACTTAAATAAAATC	Os10g0580100	CI405191	(No Hit)
462	6	37	Os04g0602000|COMBINER_EST|CI207644|6	GGCGCTGAGTTGTTTGTAAACGGAGAAATTGTTCAAAGATCACCAGAAAGGCAGAGAAGG	Os04g0602000	CI207644	Conserved hypothetical protein.
463	6	38	Os01g0825700|mRNA|AK070492|CDS+3'UTR	TGAGTTGCGCATTGCCTTGTTTTTACTTCGCGACTCATATTTTGATATGTTTGGCTTCTC	Os01g0825700	AK070492	Similar to VHS2 protein (Fragment).
464	6	39	Os03g0729200|mRNA|AK059020|CDS+3'UTR	CTTTCTCATGCCATAAGCTCAGCAGTTCTTTTCCTTTTCCTCATAGAAATGTACTAATTA	Os03g0729200	AK059020	Thioredoxin-like fold domain containing protein.
465	6	40	Os04g0482700|mRNA|AK111072|CDS+3'UTR	AGTTGGACAAAGTATAATAAGCTCCTAGAAAAGACTTGTGCCATGGGTTACTTCTTCATG	Os04g0482700	AK111072	Conserved hypothetical protein.
466	6	41	Os12g0170600|mRNA|AK067033|CDS+3'UTR	ATCGCTAATATTATACGGTCTTTATGACCATCTGTCATACTGATGTCTTGAAGAAATGTG	Os12g0170600	AK067033	Similar to Alpha-1,4-fucosyltransferase.
467	6	42	Os01g0567300|COMBINER_EST|Os01g0567300|8	GCACCCATGGAGCTCGCCGGCAAAAGACCAACTAGGGACAAACCCTAACTACAGGAGACA	Os01g0567300		Conserved hypothetical protein.
468	6	43	Os03g0119000|mRNA|AK104225|CDS+3'UTR	GTACTAAAGCATGTAACTGATCCAACATGAACTTGGAAGGTGATGACATCAAATTTGTGT	Os03g0119000	AK104225	Prolyl 4-hydroxylase, alpha subunit domain containing protein.
469	6	44	Os08g0159900|mRNA|AK071070|CDS+3'UTR	TTGTACTGGAATTATCAGAGACGTGGGTGAGCAGGAGAGATGTGTTAACGATCCATTAGG	Os08g0159900	AK071070	DEAD/DEAH box helicase, N-terminal domain containing protein.
470	6	45	Os03g0702700|mRNA|AK103495|CDS+3'UTR	CTCTCCTATGTTACCCGGACACAAACTGGCAGCTTCAATAGCAGATGACCATCATTTTCT	Os03g0702700	AK103495	Protein of unknown function DUF250 domain containing protein.
471	6	46	Os04g0549500|COMBINER_EST|Os04g0549500|8	CGTCAAGCACGGGGCCTTTGACGACCTCCCGCCGAACATGTTCGACGACGCTGTTGATCA	Os04g0549500		Similar to Transcription factor MYB86 (Myb-related protein 86) (AtMYB86) (Myb homolog 4) (AtMyb4).
472	6	47	Os05g0556600|COMBINER_EST|AU082976|6	AGGAAGATAGGTCAAAGATGGATGGCGATGCAAGCATGAGCCTTCTTTTGGTTTAGGAGA	Os05g0556600	AU082976	Conserved hypothetical protein.
473	6	48	Os09g0266300|mRNA|AK121026|CDS+3'UTR	TACTCGGATGCAGCTGTTATGGTGGAAGGGGATTGATGATGGGAAGGACAGCCACAGGGA	Os09g0266300	AK121026	Hypothetical protein.
474	6	49	Os04g0284600|mRNA|AK071386|CDS+3'UTR	ATTTGAGGCTCATAGTAGGAAGCTAATCAGAAAAGGCAACAATTGTTTTTGATAACCTTG	Os04g0284600	AK071386	Similar to TAT-binding protein 1 (Fragment).
475	6	50	Os05g0189300|mRNA|AK067327|CDS+3'UTR	ATGTACTGTGTTGAGCAAGCTTGTTGTATTTTTACAGAATTAATAATGGAACTGATGGGC	Os05g0189300	AK067327	Virulence factor, pectin lyase fold family protein.
476	6	51	Os12g0464200|mRNA|AK109841|CDS+3'UTR	TCCATCTCGATCTGATGATCTCTGTCTATCGGCGGATGCACGTAAGATGAATAGTACTCT	Os12g0464200	AK109841	Cyclin-like F-box domain containing protein.
477	6	52	Os09g0365900|COMBINER_EST|CI557753|0	GTTAGGTCCGTATTATTCCACACTATGGTGTGTAATTTGCAATGGTGAAAATGGTGATTT	Os09g0365900	CI557753	Cupredoxin domain containing protein.
478	6	53	Os07g0658300|mRNA|AK064580|CDS+3'UTR	TGGTGTGCTTAAGGTGTAAAATGCCCCAATTATTTTTTGTGCTATATTTCCAACCTTTCC	Os07g0658300	AK064580	Pleckstrin homology-type domain containing protein.
479	6	54	Os03g0802800|mRNA|AK059670|CDS+3'UTR	ATTGTTGTTTCACCCCGGCTACATATGCTTGCGAAATCGCGAGGCCTAAATGAGTAACAT	Os03g0802800	AK059670	Hypothetical protein.
480	6	55	Os01g0167100|mRNA|AK063153|CDS+3'UTR	TGTGTGCATCCTACTGGCTTGTGTAACTCTAAAGTAAATAAATATAACACCATTATCACC	Os01g0167100	AK063153	Conserved hypothetical protein.
481	6	56	Os03g0828600|COMBINER|CI143867|6	TAGGGTTCACAGGTTTATTTAGAGAAAGTTTAATAGTATAGCCAACTATGGCTCCAAATC	Os03g0828600	CI143867	Sodium/hydrogen exchanger family protein.
482	6	57	Os07g0281000|mRNA|AK111689|CDS+3'UTR	CCGGTTTTTGTATGTTCTAATTTGTGATTAGCAGTAAAACTACCCAGTATTGCTTATCTG	Os07g0281000	AK111689	Zinc finger, CCCH-type domain containing protein.
483	6	58	Os08g0165200|COMBINER_EST|Os08g0165200|8	AATGGAGGAGGGCTCCGCATGCTGAAGCACAGGTCTGAGATGTACAAGCTCACCAGCGAA	Os08g0165200		Protein of unknown function DUF1677, Oryza sativa family protein.
484	6	59	POsControl0001|genome		
485	6	60	Os10g0502600|mRNA|AK069511|CDS+3'UTR	TGGGAGTATTAGACATGAGATCACCTGGGGTTTATTCCCCTTTTGTTAAGTCTCTGTTAA	Os10g0502600	AK069511	Cytochrome b5 domain containing protein.
486	6	61	Os01g0920000|mRNA|AK060073|CDS+3'UTR	TACTATGGCAGACTCAGGCTTGTGCTTTGGTACGGTGGAATGATAGTCTACTCATTCGTA	Os01g0920000	AK060073	CBS domain containing protein.
487	6	62	Os05g0191700|COMBINER_EST|CI467183|1	GCTAGGTTGCTAAGTAACAAGCTTGGCCGAGGAGGCCCGGACTCCATGTCACATGCGTTT	Os05g0191700	CI467183	Acid phosphatase (Class B) family protein.
488	6	63	Os09g0345000|mRNA|AK059121|CDS+3'UTR	TGCTGCTGGTGCTACCTTAAACATGGTCTGCTTAGAAATCTTTTATATGAGTTAAAAATC	Os09g0345000	AK059121	Conserved hypothetical protein.
489	6	64	Os01g0106600|mRNA|AK061314|CDS+3'UTR	TTGTACTGATCTGATTGCCTTCGCCTCATCATAATGATAATCGAATTAAATTTGCGGTGT	Os01g0106600	AK061314	Similar to Chitin-binding lectin 1 precursor (PL-I).
490	6	65	Os03g0360700|mRNA|AK068764|CDS+3'UTR	TGTAAACTTGTAACTTAACATTGCTGGGAATGGTAAATGAATGAATAAATGAATCTGGTT	Os03g0360700	AK068764	Similar to Protein-methionine-S-oxide reductase, PilB family.
491	6	66	Os01g0301700|mRNA|AK064223|CDS+3'UTR	TTCCTCATAAATCTGACATGTTATCATGCCTATATCCTGAAATGGACTACATTAGCAATG	Os01g0301700	AK064223	Protein prenyltransferase domain containing protein.
492	6	67	Os03g0106300|mRNA|AB158462|CDS+3'UTR	AAGCCAAACAAAGGAAAGAGATAAAGATTACGACAAGACGAAATTAAAAGGTAAATCAAC	Os03g0106300	AB158462	PAIR1 protein (HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS 1 protein).
493	6	68	Os10g0124000|mRNA|AK121991|CDS+3'UTR	AGTCAGCTCCCAGTATTATGTCTGAGAATTTTCTGCCATTAATCTTAAAGAGCAGTGATT	Os10g0124000	AK121991	High mobility group-like nuclear protein family protein.
494	6	69	Os04g0412300|mRNA|AK121151|CDS+3'UTR	TATGCAAACTGTATATTGTATATATCAGTGGGACAATCATCGGTACATAAGTTCAGAGAG	Os04g0412300	AK121151	Glycoside hydrolase, family 17 protein.
495	6	70	Os02g0305200|COMBINER|CI155889|6	TCTTGTGGTGCCTTTTTCCTGCTTTTCAGCTTTCTAGGACAGCATCTCTACTTTCAGTTT	Os02g0305200	CI155889	Reverse transcriptase, RNA-dependent DNA polymerase family protein.
496	6	71	Os05g0472300|mRNA|AK103712|CDS+3'UTR	TGTTGTTACTGAAGTTTAATGGTAATCTCCCTCTTCACACCTTAAGCAAGTATCACTTGA	Os05g0472300	AK103712	Ribonuclease P subunit family protein.
497	6	72	Os04g0630900|mRNA|AK067744|CDS+3'UTR	TGATGGCGCTCGCACGTTTCGCGGCAGCAAAATACCCTCAGTACAACGTCCAAACCGACT	Os04g0630900	AK067744	Similar to Anthocyanidin reductase.
498	6	73	Os06g0542200|mRNA|AK058589|CDS+3'UTR	GCATTCAATGTTTCTCTTAGGTGTTAGCTAAATATGCAAGGAATAAGATGTAACCATGTC	Os06g0542200	AK058589	NADP oxidoreductase, coenzyme F420-dependent family protein.
499	6	74	Os08g0410900|mRNA|AK106713|UTR	GCGTTAGCGCTATCGCGATAGCGATCTCGTTGTAGTCTCGTCCATATATGACATTTCTTA	Os08g0410900	AK106713	Non-protein coding transcript, uncharacterized transcript.
500	6	75	Os07g0490100|mRNA|AK072018|CDS+3'UTR	TGAATAAATGATCATGCTATCATATGATAAAAGACAATAAAAGGAAGTCCACTTAATTTT	Os07g0490100	AK072018	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
501	6	76	Os01g0616100|mRNA|AK058983|CDS+3'UTR	CAGACGGCTGTAGATTGTAGAGTTCATGAATACAGTCAACATGTTTGTTGGGATGTTTTG	Os01g0616100	AK058983	Protein kinase-like domain containing protein.
502	6	77	Os05g0556700|mRNA|AK059663|CDS+3'UTR	GGATTCTTATTTGCAGCTTTACTCATGTGCGCTTGGCTCAAAATATGTTGGGTTTCGGTC	Os05g0556700	AK059663	Similar to Cct2-prov protein.
503	6	78	DarkCorner		
504	6	79	DarkCorner		
505	6	80	DarkCorner		
506	6	81	DarkCorner		
507	6	82	DarkCorner		
508	6	83	DarkCorner		
509	6	84	DarkCorner		
510	6	85	DarkCorner		
511	7	1	DarkCorner		
512	7	2	DarkCorner		
513	7	3	DarkCorner		
514	7	4	DarkCorner		
515	7	5	DarkCorner		
516	7	6	DarkCorner		
517	7	7	DarkCorner		
518	7	8	DarkCorner		
519	7	9	Os09g0246100|COMBINER|CI403079|x	TGAGCCCTTTTAGGATGATGTGTGACTTATGTGAGTTGAATGGTTAAGTGATGTGAACTT	Os09g0246100	CI403079	(No Hit)
520	7	10	Os07g0229200|mRNA|AK058412|CDS+3'UTR	TATACTTGGGTATTGTTGACTGCACGCACTAACAACTTGGGCCCCAACGTGTGTTTACAT	Os07g0229200	AK058412	Cyclin-like F-box domain containing protein.
521	7	11	Os03g0248600|mRNA|AK073611|CDS+3'UTR	GCAAGCGTGATTTGAAGGAACACAAATGATTATATTAAACGTTATAAGCAAAGTTCAACA	Os03g0248600	AK073611	Similar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
522	7	12	Os01g0848400|mRNA|AK060936|CDS+3'UTR	TGCTGTCAAATATTTGACACCTTGCGGGCTATAGAGAGATTGACAATACCTTCCCAAGGC	Os01g0848400	AK060936	Acid phosphatase/vanadium-dependent haloperoxidase family protein.
523	7	13	Os08g0476700|COMBINER|CI172808|6	GGTCAGGCCCCATGGGCTTGTGTGATGTTTAGTTTCATTACTTGCTCTGAACCTTTTGTA	Os08g0476700	CI172808	Non-protein coding transcript, unclassifiable transcript.
524	7	14	Os05g0481900|mRNA|AK119626|CDS+3'UTR	GTGTCAGCACCTCTTGTACATTTGATCGTAAAATACAGGATATCTCCAACTAATAGAGAG	Os05g0481900	AK119626	Auxin Efflux Carrier family protein.
525	7	15	PZmControl0003|mRNA|X12539|3'UTR		
526	7	16	Os05g0106100|mRNA|AK063178|CDS+3'UTR	TTGTGGGTTGTTGTATTTATTATTTGAATTTTTGAAGTAATAATCGGTACCAGGCCGTCC	Os05g0106100	AK063178	Similar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment).
527	7	17	Os05g0426200|mRNA|AK065065|CDS+3'UTR	GTTATGACTGCACTTAAACCTTATGTAAGTTTGCATGGTTTGGCCTACTATTTACTTGCT	Os05g0426200	AK065065	No apical meristem (NAM) protein domain containing protein.
528	7	18	Os02g0197900|mRNA|AK059082|CDS+3'UTR	TTGAATGCTGTAAATTACAATGCTGTAGTGCAAGAGTGCGACTGCAGCTTGTTGGTGAGA	Os02g0197900	AK059082	Conserved hypothetical protein.
529	7	19	Os10g0507000|mRNA|AK069829|CDS+3'UTR	TGCCAGCAAAAGCACAATGCCAGAATGGGAACCAAAATGACCCAGTATGACATGGTATCT	Os10g0507000	AK069829	Disease resistance protein family protein.
530	7	20	Os04g0379300|mRNA|AK059313|CDS+3'UTR	TAGAGCTACAATAGGCGAGAAGATGTCTGTCAGTTTTGGTCTCCATTGCTGAGAGCCTTT	Os04g0379300	AK059313	Methyltransferase type 11 domain containing protein.
531	7	21	Os05g0427300|mRNA|AK073321|CDS+3'UTR	TTCTTCTCGTCAAAGTTGGTTTGTATTATGTTGGGCATCACAAAAGATAATGTCATTGTC	Os05g0427300	AK073321	Similar to RNA binding protein (Fragment).
532	7	22	Os02g0317700|mRNA|AK068024|CDS+3'UTR	TAAAATTGGGGGTTCTTTTGGTGTTCGGAGAGCGATTTGGGTGGGAATCGGAGTCGGAAA	Os02g0317700	AK068024	Conserved hypothetical protein.
533	7	23	Os03g0431800|COMBINER_EST|AU094106|7	TTGGTGTATATACGTCAATTGATTGGAGTAATCACAGCTGTCCTGTAATAATAGAACTAC	Os03g0431800	AU094106	Hypothetical protein.
534	7	24	Os04g0653200|mRNA|AK073795|CDS+3'UTR	ATGCAATGCAATGTCGCCCATGTAAAAAGTCTCCTTGCATAGTTGCATTCAATTAATTCA	Os04g0653200	AK073795	Similar to Low affinity calcium transporter CAX2 (Fragment).
535	7	25	Os08g0387500|mRNA|AK105106|CDS+3'UTR	ACAATTTAATGGTCCATTTTGACATCTAATGGGCAGAAGCAAAAGAAAAAGGAAACAAAC	Os08g0387500	AK105106	Similar to Sulfated surface glycoprotein 185 precursor (SSG 185).
536	7	26	Os02g0616100|mRNA|AK106204|CDS+3'UTR	TGTCACGTCTAGATCTCACCTCCTGTACTCTTGTGTACTGTACTATGTGAAAATCATTGG	Os02g0616100	AK106204	Conserved hypothetical protein.
537	7	27	Os05g0132700|COMBINER_EST|CI562776|3	AGAACAGAAGTTGCCAGATGAAGAAGGGAACTTTTAGTTAACTAATTAAAGTTGATATAT	Os05g0132700	CI562776	Myb, DNA-binding domain containing protein.
538	7	28	Os06g0523900|COMBINER_EST|CI270521|6	AAGGTGCTGTACATACCAGTCCGATGGATTCTGTGAAAACTTATGTCACACTGGTGATAT	Os06g0523900	CI270521	Hypothetical protein.
539	7	29	Os09g0322000|mRNA|AK102510|CDS+3'UTR	TTTAGTTTCATGTTCTTCAGAATTCGATTCAGTGTAGTGGTGGGCTGATTAATGGATCTT	Os09g0322000	AK102510	Similar to PaMst-1.
540	7	30	Os01g0191800|mRNA|AK061360|CDS+3'UTR	ATGGGGTTGTGATATGTTTTCTGTGCAACGCCCTGTACTTAATGTACTAATCGTATTTCT	Os01g0191800	AK061360	Similar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment).
541	7	31	Os02g0833400|mRNA|AK073112|CDS+3'UTR	GGGACCTGATGCTGTAGTTTTGCAACCTGACTATTGTTGGTAAAATACAATCAAGGCAAC	Os02g0833400	AK073112	Conserved hypothetical protein.
542	7	32	PZmControl0001|mRNA|X12538|3'UTR		
543	7	33	Os04g0262800|COMBINER_EST|Os04g0262800|8	AAGCTGCGTCCTCGCTACTATGGACCATACAAGATCATCGCCGTTGTCAACGAGGTGGCC	Os04g0262800		Retrotransposon gag protein family protein.
544	7	34	Os06g0257200|mRNA|AK068347|CDS+3'UTR	AAAGAACTGAGTACCTTATTACACTGTGGCCTGATCAGAAAAACAATCAAATCTTCAACC	Os06g0257200	AK068347	Signal recognition particle 9 kDa family protein.
545	7	35	Os03g0138400|COMBINER|CI469206|x	TCAAGCCATCTCTGTTCAGGAGGTACTGCAAATGTAGCTAACCTTGCAATGGAGGAAGAA	Os03g0138400	CI469206	Conserved hypothetical protein.
546	7	36	Os02g0700600|mRNA|AK100966|CDS+3'UTR	GCGGTCAAGTCTTTGTCGGGTCCTTGGCAAATGATACAATGCATAGTCTGGTTTTGACTT	Os02g0700600	AK100966	Similar to GAMYB-binding protein.
547	7	37	Os05g0135200|COMBINER_EST|CI551260|0	CTTCACACAATGATCATGTGTACTTGATGACATTGTTGTAAGTTGTAACATAAGAGAGGG	Os05g0135200	CI551260	Haem peroxidase family protein.
548	7	38	POsControl0021|genome		
549	7	39	Os02g0726400|mRNA|AK107913|5'UTR+CDS	ACACATCCCTCTATGAGAACAAATATTTTGAGGAGCTGAAAGTAAAAGCAGAGGAGGAAA	Os02g0726400	AK107913	BSD domain containing protein.
550	7	40	Os03g0841100|mRNA|AK120279|CDS+3'UTR	TTTTTCGCTTATTTTTGTAGACTGTACAAAATGAATGGCACAGACCAATCGATTTCTCTG	Os03g0841100	AK120279	EGF domain containing protein.
551	7	41	Os03g0568800|mRNA|AK099276|CDS+3'UTR	GGGGTGGCAGAATTGGTGTATATATAAAAAGGCTTTGAATAGCAATCCTGTTGATTTGGG	Os03g0568800	AK099276	Protein kinase-like domain containing protein.
552	7	42	Os10g0150400|mRNA|AK061529|CDS+3'UTR	TAATATAATCAGGGATGTGCATAATATATGTGCAACTTGTTTGATCTCAATTGTAAGGTA	Os10g0150400	AK061529	Protein of unknown function DUF1210 family protein.
553	7	43	Os05g0129300|mRNA|X57325|CDS+3'UTR	TGTGTGCTGGTTTGTGATGTGATGAACTGATGATTGTAATATTTTGACATTGAACCTATG	Os05g0129300	X57325	Basic/leucine zipper protein.
554	7	44	Os08g0305300|mRNA|AK105754|CDS+3'UTR	AACGTATTGACTTGTAATATGTTGTACAGAACGTCTTGCTTGTTTTAATACCGAATGTCG	Os08g0305300	AK105754	Protein prenyltransferase domain containing protein.
555	7	45	Os04g0457500|COMBINER_EST|CI372510|4	TTTGTACACGTCGTTCTGTTCTATGATTCTATCGAATAAATAATACTCCCTCAGCTTATA	Os04g0457500	CI372510	Similar to Gamma-glutamyltranspeptidase 1 precursor (EC 2.3.2.2) (Gamma- glutamyltransferase 1) (CD224 antigen) [Contains: Gamma- glutamyltranspeptidase 1 heavy chain; Gamma-glutamyltranspeptidase 1 light chain]. Splice isoform 3.
556	7	46	(-)3xSLv1		
557	7	47	Os05g0280700|mRNA|AK100616|CDS+3'UTR	GTACGTAACATGGGAGATCAGGATATGTGTACATGTGTTGCATTATTCTTGATTTATTAT	Os05g0280700	AK100616	Similar to Resistance protein candidate (Fragment).
558	7	48	Os11g0524300|mRNA|AK106093|CDS+3'UTR	TATAGCCCCGTGTACTGAATTTTGTTGCTAAGAAATGCAATAAAAAGTAGCGTTGCATGT	Os11g0524300	AK106093	Protein of unknown function DUF1001 family protein.
559	7	49	Os03g0120900|mRNA|AK106367|CDS+3'UTR	TCAGTGCAGTGTGAGGGGGAACAGTTTAAGAAAAAAGAACGAAGCAGCAACGTACCCAAA	Os03g0120900	AK106367	Similar to AP2 domain containing protein RAP2.8 (Fragment).
560	7	50	Os02g0736400|mRNA|AK065229|CDS+3'UTR	GCCCAAAACAGCAGAAACTTTTGCATCATCTCGTTCAAATAAAAAGCATACCAAATTACT	Os02g0736400	AK065229	Dihydroorotate dehydrogenase family protein.
561	7	51	Os07g0649300|COMBINER_EST|Os07g0649300|8	AAATTCGTAAAGAGGCTTGTCGATGTGCTTAATGCACATATGAGACCCAGTGCCCATTGT	Os07g0649300		Armadillo-like helical domain containing protein.
562	7	52	Os06g0183900|mRNA|AK109370|CDS+3'UTR	CCATTGTCAAGGAAGCAAAGTGTCGGAGTATTTGAAAGATGTGTGAAATATGTAATAGTT	Os06g0183900	AK109370	Protein of unknown function DUF602 family protein.
563	7	53	Os03g0250200|mRNA|AK068940|CDS+3'UTR	AAGCTAAGGAGGCGTACTGCTTCTGAGGATCCTGCAGGAAATTAACAGCAATCCATTCTT	Os03g0250200	AK068940	TB2/DP1 and HVA22 related protein family protein.
564	7	54	Os02g0236000|mRNA|D67042|CDS+3'UTR	TTATGCCTGTGGCAGCCTGGCAGGTCACCTCAGAAACAGAGATATGTGAAAGAGAATAAA	Os02g0236000	D67042	Similar to Aspartate aminotransferase (EC 2.6.1.1) (Fragment).
565	7	55	Os02g0250700|mRNA|AK065073|UTR	GTATGCTACTATGCTAGTGCATATCACTTGTCAAATCCATGGAATTTCTTTCCAGTGGAG	Os02g0250700	AK065073	Non-protein coding transcript, uncharacterized transcript.
566	7	56	Os08g0509100|mRNA|AF095896|CDS+3'UTR	ATAAGAAGTGGTTGTTGTTGATGTTATTTATTGAAAATCTTATGAATAATGTATTCTTTT	Os08g0509100	AF095896	Similar to Lipoxygenase, chloroplast precursor (EC 1.13.11.12).
567	7	57	Os09g0248000|mRNA|AK100378|CDS+3'UTR	CACAATTGAACATAATAGGGGATTCATCATTTATGTTTCTATCGATACAATCTCTCTGCC	Os09g0248000	AK100378	Protein of unknown function DUF516 family protein.
568	7	58	Os03g0786100|mRNA|AF022740|CDS+3'UTR	TTTGGCATCTGTATATCTCGCCTTAAGATATTTACGGAACCGGTTTATATACTCCTTTAA	Os03g0786100	AF022740	Similar to Glycolate oxidase (EC 1.1.3.15) (Fragment).
569	7	59	Os11g0429200|mRNA|AK073173|UTR	GTGAGACATGGGTTAAAGTTCCAGTGATATGAAATCGTTCATCCCTGTCTTGATTCCTGG	Os11g0429200	AK073173	Non-protein coding transcript, putative npRNA.
570	7	60	Os03g0260100|mRNA|AK066143|CDS+3'UTR	GCTTTGTACAATTACTCGATGTTTCAGTTAATAAAGTGTCAATTTCATTTCATGGACGGC	Os03g0260100	AK066143	Conserved hypothetical protein.
571	7	61	Os01g0726000|mRNA|AK063360|CDS+3'UTR	GGATTCCGGGAAATTTCAATCTTGTTTATTCCCTTTTGCTTAACAGTGGGGAATTTCAAT	Os01g0726000	AK063360	Conserved hypothetical protein.
572	7	62	Os02g0738800|COMBINER_EST|CI161162|6	ACCCCCCAAGGTTGGTTGCCGGGCGAAAGCCTAGTCTTTGGCTCCTTTGAGCTCCGACGA	Os02g0738800	CI161162	Hypothetical protein.
573	7	63	Os07g0421000|mRNA|AK071522|CDS+3'UTR	CTGTTGGGCAATGTAGGTATGAGCAATTCGAGTCATCATGTTCGAATATGGTCATCGTAT	Os07g0421000	AK071522	Cyclin-like F-box domain containing protein.
574	7	64	Os02g0272800|mRNA|AK111345|CDS+3'UTR	CGATGTCACGATACATGACAGCAGAACTTGCAACTGAGTTTTCTACTATTTCTTCAGTGG	Os02g0272800	AK111345	Hypothetical protein.
575	7	65	Os04g0611500|mRNA|AK064469|CDS+3'UTR	TGAAGTGATGCCACAAATCAGGCGTTCAAGATTCAAAGTTATTAGGAAGATTGTTGATCT	Os04g0611500	AK064469	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
576	7	66	Os01g0730100|mRNA|AK064757|CDS+3'UTR	TTTTCATTTTTGGAGATACTATTTATGAATGAATAAGTGAGTGAATAATTATAGGAGGTT	Os01g0730100	AK064757	Cyclin-like F-box domain containing protein.
577	7	67	Os01g0503400|mRNA|AK122122|CDS+3'UTR	TGTTTATGACATACTCTATCTGTTTGGTTATACTAGTCATTTTGGACACGATCATAGTCC	Os01g0503400	AK122122	Similar to OsNramp1 (Integral membrane protein).
578	7	68	Os03g0266300|mRNA|AK119239|CDS+3'UTR	CCGATCAGCGTCTGTACCGGTCTTTTGCAACTAGTTAAGTGATGAATACTATAATCTGTT	Os03g0266300	AK119239	Class I low-molecular-weight heat shock protein 17.9.
579	7	69	Os02g0793500|COMBINER_EST|CI440025|6	GTTCAGGCAGTTCGTTCCTTTGATATCTCTGTACTTATTAGCAGGAGAAAAATGACCTTT	Os02g0793500	CI440025	Cyclin-like F-box domain containing protein.
580	7	70	Os04g0323500|mRNA|AK061480|CDS+3'UTR	TACAGTACAATGTAGACATTCACAACACATGCACACTCACCCCTATAAACATACTAGTTA	Os04g0323500	AK061480	Conserved hypothetical protein.
581	7	71	Os04g0519000|COMBINER|CI138407|6	CTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGG	Os04g0519000	CI138407	(No Hit)
582	7	72	Os07g0260900|COMBINER|CI340059|6	CGAGCCCTATGTATTTTTAACACACACGTTCAATACAATTTCGGCGCATCGCCACCTTTT	Os07g0260900	CI340059	(No Hit)
583	7	73	Os05g0125000|mRNA|AK105290|CDS+3'UTR	GGTATTTGATGGAGAATAAATTATTCCTGGAAGTGGCGGCCAATAAACAGAGTCGTTGGG	Os05g0125000	AK105290	DNA-binding SAP domain containing protein.
584	7	74	Os02g0806400|mRNA|AK107867|5'UTR+CDS	GTACTCGTCCACCTCGTCGCACTCGGATCCCGAGAGCATTGCCGAGTCCAACCCGCACCC	Os02g0806400	AK107867	Conserved hypothetical protein.
585	7	75	Os07g0298100|mRNA|AK071774|CDS+3'UTR	TATACATGCTGACATTAGTACAAGGATAAAATTCCTGGTTCAAAAGGAACATCGGAAACC	Os07g0298100	AK071774	Conserved hypothetical protein.
586	7	76	Os05g0541100|mRNA|AK107193|CDS+3'UTR	TTTTTTGTATGCACAACTGAGATTAGTCATTAGTTAAATGTCTGAACCTCTTTTTATCCC	Os05g0541100	AK107193	IQ calmodulin-binding region domain containing protein.
587	7	77	Os01g0494400|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os01g0494400	CI274096	(No Hit)
588	7	78	Os07g0632600|mRNA|AK058943|CDS+3'UTR	AACTGCTTGGAAGCGGACAAGCATGATATAGACCTCTCACGCAGTAATATACTGTATGAC	Os07g0632600	AK058943	Heat shock protein DnaJ, N-terminal domain containing protein.
589	7	79	DarkCorner		
590	7	80	DarkCorner		
591	7	81	DarkCorner		
592	7	82	DarkCorner		
593	7	83	DarkCorner		
594	7	84	DarkCorner		
595	7	85	DarkCorner		
596	8	1	DarkCorner		
597	8	2	DarkCorner		
598	8	3	DarkCorner		
599	8	4	DarkCorner		
600	8	5	DarkCorner		
601	8	6	DarkCorner		
602	8	7	DarkCorner		
603	8	8	Os03g0725000|mRNA|AK059294|CDS+3'UTR	CTCTGCTATCCTAGACATTGAGCTCAGTGTAAAACTGGATCTGTGCATTCCAGGAGTAAT	Os03g0725000	AK059294	Similar to Mitochondrial 60S ribosomal protein L6.
604	8	9	Os02g0720700|mRNA|AK101764|CDS+3'UTR	GTGTGCAGCAGAAAATTTTGTCAAGAAGCCGATGTTGTAGGTTGTAGCGTCACATTGTAT	Os02g0720700	AK101764	Similar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2.
605	8	10	Os12g0133800|mRNA|AK059577|CDS+3'UTR	GACAATGTAGTAAGACATTGAACAGTGCTTATTTAGCATTCCAATAACTGATGGTAATGC	Os12g0133800	AK059577	Similar to Auxin efflux carrier protein.
606	8	11	Os10g0481000|COMBINER_EST|Os10g0481000|8	GCTCCTCCTCTGCCGGGAGCGCGCCGCCGCGTCCTTCTCCGTCCGCGAGGGCGCCGGCCG	Os10g0481000		Similar to Formin homology protein A.
607	8	12	Os01g0124200|mRNA|AK067257|CDS+3'UTR	TGCTTTGTTAGTTTGTGTGCTCCATGTGTGTGGGTGTGTTTAATTTGTCCCTGTTCGCTT	Os01g0124200	AK067257	Bowman Birk trypsin inhibitor.
608	8	13	Os03g0673100|COMBINER_EST|Os03g0673100|8	GCAGGAGCTGACAAGACCAATTCAAGAGGCCGACCAGTTCTTCAGAAACATGGAGGCACA	Os03g0673100		Hypothetical protein.
609	8	14	Os07g0549600|COMBINER|CI515529|6	GATGACATAGAAGGGGGAAAAAAGGACTAAATTTTGTGTTGAAATTGAGCACAGTGGCAC	Os07g0549600	CI515529	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
610	8	15	Os05g0387200|mRNA|AK061359|CDS+3'UTR	TAAACTTTTATCCAGCTCTTGATCAGCAAATGGGTATCCAGGATGCAGGGGGGTATTTGA	Os05g0387200	AK061359	Similar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1).
611	8	16	Os11g0157100|mRNA|AK120409|CDS+3'UTR	GTATGGCCCAACGAGAAATTGTTGTAATTCGGATTGCTGACTCGAGGTAATATGGAAGAA	Os11g0157100	AK120409	Similar to Cyclin T1 (Fragment).
612	8	17	Os07g0655300|mRNA|AK073258|CDS+3'UTR	TCTTGTGACTTCTATACCTCCCCCTATCGTTGCTACTCTGGAGCTGAGTTGTTGCTAATA	Os07g0655300	AK073258	TRAF-like domain containing protein.
613	8	18	Os08g0545500|COMBINER_EST|CI261507|6	TCCTATGTACGGTTTCCTCATTTCGGCATGTTTTGAGTGATTGAGAGTGAAATTATAAAA	Os08g0545500	CI261507	Similar to DRE-binding protein 1A.
614	8	19	RC2		
615	8	20	Os07g0546700|mRNA|U86017|CDS+3'UTR	AGTCGTACTGTCCCTAAACACACTGAATTTTGCTCCATTTCTCTCTAATTGCTGGAGTGT	Os07g0546700	U86017	Similar to 60S ribosomal protein L38.
616	8	21	Os02g0481700|mRNA|AK120085|CDS+3'UTR	GACAAGCCAGTTTCATCTTCATTTGTAATTCTTTATTGATGCTAAGGTTTCCTATTGTCC	Os02g0481700	AK120085	Conserved hypothetical protein.
617	8	22	Os01g0680600|mRNA|AK060930|CDS+3'UTR	CATTCAGAATGGATTGATTCATCGTCAGTTCGTCAGACTCTTATCACAATTTCCTTCTCC	Os01g0680600	AK060930	Conserved hypothetical protein.
618	8	23	osa-miR395g|Os04|3'seq	CTTCACGTGGCACTATTTCAATGCCTATTGTGAAGTGTTTGGGGGAACTCTCGATGTCAT			miRNA
619	8	24	Os06g0546000|mRNA|AK064215|CDS+3'UTR	CATGAATTCTACAGAAATTTCTCAAGATTTAGTGAAAAAATTATGATCTTCAAACTGATC	Os06g0546000	AK064215	Conserved hypothetical protein.
620	8	25	Os03g0627300|mRNA|AK106686|CDS+3'UTR	ATCCTGGTATAGGATCATATACTCATGTACCATTTTAGAGAAGTAAGGAATTTTCACTGC	Os03g0627300	AK106686	Similar to ATP binding protein-like.
621	8	26	Os03g0323200|mRNA|AK062262|CDS+3'UTR	TAGAGTTGAGACTTGTACACTTTGTATAATTTATAAAAAGTTGTAACATGACATACACGA	Os03g0323200	AK062262	Similar to Protoporphyrin IX Mg-chelatase subunit precursor.
622	8	27	Os05g0140000|mRNA|AK111588|CDS+3'UTR	TCGTTCTTGGGCACAAGTCAGAATTGTACAGTTGCAGCTCACAGGACAGCAGATGAATAT	Os05g0140000	AK111588	Conserved hypothetical protein.
623	8	28	Os10g0569500|COMBINER_EST|CI558172|0	TTTGCTTGTTCGCCTTCTCCGTGATGGCATCATTCGACCCTGGTCTTGAATTTGAAGTTT	Os10g0569500	CI558172	Conserved hypothetical protein.
624	8	29	Os01g0937300|mRNA|AK106251|CDS	GGTAGCCTCCAAAAACTTTGTTATTTGGACCTATCAAGGAATAGTAACCTTAATAAACTG	Os01g0937300	AK106251	Disease resistance protein family protein.
625	8	30	Os01g0769100|COMBINER_EST|CI275950|6	TTTGATGCCATACACGGAAGCAATTGTAAGAATAGGTGTCAGAATGAAGCTATATATCCC	Os01g0769100	CI275950	Similar to Lipoic acid synthase-like protein.
626	8	31	Os11g0598200|COMBINER|CI395394|x	ATGAGGGCATCAAAACATCGATTTGCTTGATACACAGAGGCTGGGCCAATCTTCCTTGAA	Os11g0598200	CI395394	(No Hit)
627	8	32	Os12g0624000|mRNA|AK067757|CDS+3'UTR	TGTAAACTGAGTGGAAATCAGCAGTGTTTCATCTACATCTGAGTTGTTGCGGATCAAATT	Os12g0624000	AK067757	Similar to Methionine synthase protein.
628	8	33	Os05g0389500|mRNA|AK104776|CDS+3'UTR	TTGTTTGGATTTATTGTAGAAACAGTAGCAAATTTATTAATATCAACCAGAATTTTTGTT	Os05g0389500	AK104776	Endonuclease/exonuclease/phosphatase domain containing protein.
629	8	34	Os07g0670100|COMBINER|CI211665|6	TTGTGGCCATTCTCCAAAGAATTGTATGATACTGCATTTGCTGTTAAACCACATGAATTT	Os07g0670100	CI211665	Conserved hypothetical protein.
630	8	35	Os01g0681600|mRNA|AK067869|CDS+3'UTR	TGATGATAAACTTTTGTCTTGACGCTGAAAATTAATGAGCTATGACGTGCCAGTATGCAC	Os01g0681600	AK067869	Similar to Splicing factor 3A subunit 3 (Spliceosome associated protein 61) (SAP 61) (SF3a60).
631	8	36	Os01g0948900|mRNA|AK100894|CDS+3'UTR	ACTATCTCCTTGTAAGCTTAGAACTAATTAATTACATGTTATTTATATCCACATTACAGG	Os01g0948900	AK100894	Ankyrin repeat containing protein.
632	8	37	Os01g0592900|mRNA|AK102072|CDS+3'UTR	GGAATTGCCCACGCGTCTCTATATATAGGTCCGTGTAAATTACTAAATCAATAACTTGAA	Os01g0592900	AK102072	ATP-dependent helicase, DEAH-box family protein.
633	8	38	Os09g0511000|mRNA|AK061724|CDS+3'UTR	CATTTAATTGTAGGCAAAATTTGGGTACCTGAGGAAAGCAAAACAGAAGAATAGTTTCCT	Os09g0511000	AK061724	Conserved hypothetical protein.
634	8	39	Os03g0168500|COMBINER_EST|CI476814|6	GCCAGTGTGTCTCTAGTTTTGTAACATTGAAGCATTTTAAGCTTCTTGTATTCCGCTTAC	Os03g0168500	CI476814	Thioredoxin fold domain containing protein.
635	8	40	Os12g0143800|mRNA|AB046620|CDS+3'UTR	CCACTGTCGAGGAAATATGCAACCTCATTTATCCAGACGATTATACCTTAAAATGGGTAT	Os12g0143800	AB046620	Similar to Disrupted meiotic cDNA 1 protein (Fragment).
636	8	41	Os05g0382900|mRNA|AK061728|CDS+3'UTR	TGCGAGTAGGATCGATGTTGTTTTCGTTGGGTGGATTAATAATGGAGCATGTTTTATCGC	Os05g0382900	AK061728	Annexin family protein.
637	8	42	osa-miR167c|Os03|5'seq	TGTCCAAGGGAACGAGTGAAGCTGCCAGCATGATCTAGCTCTGAATGATCAACAAGATGT			miRNA
638	8	43	Os11g0528500|mRNA|AK058434|CDS+3'UTR	AATTGACTTCTCATTGTGCCGCATCGTCGGCAAATTAAAGCCTGTTTGATCATCCTACGA	Os11g0528500	AK058434	Similar to Rubredoxin 1 (Rd-1).
639	8	44	Os05g0489600|mRNA|D17760|CDS+3'UTR	CATAGCGTATTGTTACGTAATCCTGTTCTGTGCAGCCACCCCCAATATCCTTACCAGTTT	Os05g0489600	D17760	Similar to ADP-ribosylation factor 1.
640	8	45	Os03g0579200|COMBINER|CI425537|x	CAGGTTCAGTAATGTATTATCACGGACTGTCCTCAATTACAGGAATGGATTGAGTGGCAA	Os03g0579200	CI425537	Conserved hypothetical protein.
641	8	46	Os11g0659500|mRNA|AK068543|CDS+3'UTR	ACAAACAAACCGACGAAAATCTGTGGGAGGGAGAATATCAAACTTCCCTTGCCTCTGTTG	Os11g0659500	AK068543	Similar to Acyl-ACP thioesterase (Fragment).
642	8	47	Os02g0719700|mRNA|AK119930|CDS+3'UTR	GGTGTGTACCTATAAAGTATTAAAGTGGTGTAGTATAATGCTATGAACAATCACGTAACA	Os02g0719700	AK119930	IQ calmodulin-binding region domain containing protein.
643	8	48	Os12g0136200|mRNA|AK059978|CDS+3'UTR	AATCTGATGGTGCACTGGTACAGTATAAGCCAGTTTCAGGTCTCTTTGTAAGCCTGTTTT	Os12g0136200	AK059978	WD40-like domain containing protein.
644	8	49	Os01g0783400|COMBINER_EST|Os01g0783400|8	AAAGGCAAAATGGTTCAAAGACTCCGAAAGATAGGAAGATCAGGATCGTGTATGGAAGCC	Os01g0783400		Conserved hypothetical protein.
645	8	50	Os06g0104200|mRNA|AK069423|CDS+3'UTR	AATCGTGGTTTGTAATAGATAAACCTCTTCTGCTATGTGATTGTAAACTTCTGGTGTTTC	Os06g0104200	AK069423	Similar to OsNAC7 protein.
646	8	51	Os12g0454800|mRNA|AY572461|CDS+3'UTR	TCCAGCGACCGTCTATCGTGCAAGCTATGGATGTTCTGTGATCTGCAGACGCAGAGTTGC	Os12g0454800	AY572461	Similar to Histidine kinase.
647	8	52	POsControl0039|art		
648	8	53	Os08g0460600|mRNA|AK103510|CDS+3'UTR	TCGGCTCTGCAGCAGGAGTTGCAAAAGGGAAAACGAAAGATGTAAACGTTTTCCTGCTTT	Os08g0460600	AK103510	Conserved hypothetical protein.
649	8	54	Os12g0284000|mRNA|AK065992|CDS+3'UTR	AATTTACCTTAACTCTACATCTGCACCATTTATATTTCTTCTAAACAGGGGTGTGTGTGT	Os12g0284000	AK065992	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
650	8	55	Os09g0543100|mRNA|AK058661|CDS+3'UTR	CAGTACGATAGACTACAGTGTTGTCTCATTTCCATTGCAATCATACACGCACAACTGTTT	Os09g0543100	AK058661	Similar to Phospholipase D nu-2 (Fragment).
651	8	56	Os12g0526600|COMBINER_EST|CI387909|4	TTTTCCATGTTTCTGAACACTGCTTTTGGTTGCTGTCTGTCGCTCCGTTATACTAGCTTG	Os12g0526600	CI387909	Cyclin-like F-box domain containing protein.
652	8	57	Os02g0173100|mRNA|AK066680|CDS+3'UTR	TGGTCAGCAAATTCGCTGTCGGCCAAGCTGTATGAATAGTATGGATGATCCAGTCCATTT	Os02g0173100	AK066680	Similar to Cytochrome P450 97B3 (EC 1.14.-.-).
653	8	58	Os09g0478100|mRNA|AK102766|CDS+3'UTR	TACCAATAGTTTGAGGTCCCTAAAATGGGATTTGATGCCTTATAAAACATTGGGTGTTTC	Os09g0478100	AK102766	Cellulose synthase family protein.
654	8	59	Os12g0572400|mRNA|AB110200|CDS+3'UTR	GTTTGGTGGTCATTTGCTTTTTGCTGAACATTAACTTGAAACAATGTGACATTGGTGTTG	Os12g0572400	AB110200	Similar to SC35-like splicing factor SCL30, 30 kD.
655	8	60	Os01g0706200|COMBINER|CI443961|x	TGCATGCTGTGATACTGATACTGACACGCATTGTAATTATTCTCGTGGCGAGATGTGCTT	Os01g0706200	CI443961	Conserved hypothetical protein.
656	8	61	Os04g0661600|mRNA|AK058715|CDS+3'UTR	ACCCGAACCTTACGAACACCAGTGTGACAAATAAAGTGGTTACAGTATATTTGATCTTGT	Os04g0661600	AK058715	Similar to Molybdopterin biosynthesis CNX1 protein (Molybdenum cofactor biosynthesis enzyme CNX1).
657	8	62	Os01g0214500|mRNA|AK062484|CDS+3'UTR	TCTCTACTCGTTGGTTGGTTCTGAATTTGTGGAGAGATTGTCAGCGATTAATTGCATGCC	Os01g0214500	AK062484	Conserved hypothetical protein.
658	8	63	Os07g0520400|COMBINER_EST|CI270136|6	GTGTTGTACGGGGAAATATGATGTTGATATTGTTTACCTCATAACCTGTGTTGGCTTTCC	Os07g0520400	CI270136	Conserved hypothetical protein.
659	8	64	Os05g0160300|COMBINER_EST|CI561152|0	ATCCTGTGTTTCGTCTGAGTAAACTGTTAAATATAATAAGAATATACAAAAGCTTGCTTG	Os05g0160300	CI561152	Plant lipid transfer protein/Par allergen family protein.
660	8	65	Os02g0175000|mRNA|AJ491818|CDS+3'UTR	TGAAGGGTGGAAGAGCCTGGAAGCTTAGATAACATCTAACCAATTTCAGAATAAAAGTAG	Os02g0175000	AJ491818	Cation transporter family protein.
661	8	66	Os03g0276500|mRNA|AK099275|CDS+3'UTR	TTTGCTTTACTTGTTAAAGTTTGGATTATTATGGTTTTATTAATATAGTATTGAGTAGCA	Os03g0276500	AK099275	Similar to Heat shock protein 70.
662	8	67	Os12g0586600|mRNA|AK100436|5'UTR+CDS	CAGAACAGGGAAATTTATCACAAATGTTATGTGGAGGAACATTCTGGGGCAGTCTTTCTA	Os12g0586600	AK100436	Similar to Plasma membrane Ca2+-ATPase.
663	8	68	Os07g0676900|mRNA|AK072862|CDS+3'UTR	AGTGGCGTGTTTGCAAGAATTTGATCGTGTACACTGAATTCTGAAGAGCCCTCATGCAAA	Os07g0676900	AK072862	Similar to Peroxidase (EC 1.11.1.7).
664	8	69	Os03g0758400|mRNA|AK111573|CDS+3'UTR	ATCCTGTCTTTTTTAAGTATGAACCATTCTGATCTAGAATCAGATTTGATCAACTGGACC	Os03g0758400	AK111573	Ankyrin repeat containing protein.
665	8	70	Os02g0105100|mRNA|AK106550|CDS+3'UTR	ATGTGTCTGGATATTCTAGTGTAAGAAAGAAGAAAGCTTTTGACTGCGTAGAGTGTTGTT	Os02g0105100	AK106550	Conserved hypothetical protein.
666	8	71	osa-miR440|Os11|3'seq	TAAACTTATGTATTAGTGTCTCCTGATGATCGGGACAAGGCTAACACCGATGAGAGCGAT			miRNA
667	8	72	Os07g0601100|mRNA|AK062499|CDS+3'UTR	CACCGACGAGGCATACATTATGTAGGTTATCATCCATCACGAATAAAGGATTTTATTGTA	Os07g0601100	AK062499	Similar to NADPH HC toxin reductase (Fragment).
668	8	73	Os03g0762400|mRNA|AK071181|CDS+3'UTR	TTTTGTGCATCTGATAGTGGTGAATCAATTAAATTACCTAGCTAGGCCAAATGTATTGTG	Os03g0762400	AK071181	Similar to Peroxidase2 precursor (EC 1.11.1.7).
669	8	74	Os10g0136200|mRNA|AK106351|CDS+3'UTR	GAGCCTGTTTGGTTCTATGCCAGTATTAGCCTTACCAATTATTCTGGCTATGAAAATATT	Os10g0136200	AK106351	Cyclin-like F-box domain containing protein.
670	8	75	Os12g0277500|mRNA|AK119223|CDS+3'UTR	CTGATCTGAACTCATATGTCCATCAAAGAAATAATTTGCATCATTATCGTCATCTTCGGT	Os12g0277500	AK119223	Similar to RuBisCO subunit binding-protein alpha subunit, chloroplast precursor (60 kDa chaperonin alpha subunit) (CPN-60 alpha) (Fragment).
671	8	76	Os02g0469600|mRNA|AK098908|CDS+3'UTR	GCAATGCTACACGCTATTTGGAGGTAGCTTTAAGTATTATCGCCATTCACGAACTTGTAT	Os02g0469600	AK098908	Similar to Cysteine proteinase 1 precursor (EC 3.4.22.-).
672	8	77	Os05g0215000|mRNA|AK104171|CDS+3'UTR	ACCTGCCGGCTATCATGTTATCATAAATTTACGCGTGTGCGCGCGACGATCCGACATGCC	Os05g0215000	AK104171	BURP domain containing protein.
673	8	78	Os05g0108600|mRNA|AY335487|CDS+3'UTR	AGTTTCTCTCTTCTCCTCTTGTTTTATTAGCCTTTAATTCCACTGTTTTTTCTTCTTTCC	Os05g0108600	AY335487	Similar to Xylem cysteine proteinase 2 precursor (EC 3.4.22.-) (AtXCP2).
674	8	79	DarkCorner		
675	8	80	DarkCorner		
676	8	81	DarkCorner		
677	8	82	DarkCorner		
678	8	83	DarkCorner		
679	8	84	DarkCorner		
680	8	85	DarkCorner		
681	9	1	DarkCorner		
682	9	2	DarkCorner		
683	9	3	DarkCorner		
684	9	4	DarkCorner		
685	9	5	DarkCorner		
686	9	6	DarkCorner		
687	9	7	DarkCorner		
688	9	8	Os09g0570900|mRNA|AK071292|CDS+3'UTR	ATCTAACAGGAGGAAATGCTTACTCCTAATTACTAAAGTGGTAGTGCCCGCAATTAGTAA	Os09g0570900	AK071292	Amino acid-binding ACT domain containing protein.
689	9	9	Os09g0555500|mRNA|AY078162|CDS+3'UTR	CAGATCACTCATGCTCCCCTCTTCAGTGAGGCACTGCTCTAGCCTAACATCATCATGATC	Os09g0555500	AY078162	Similar to Phytoene synthase 1, chloroplast precursor (EC 2.5.1.-) (Fruit ripening specific protein pTOM5).
690	9	10	(+)E1A_r60_3		
691	9	11	Os02g0246600|mRNA|AK121483|CDS+3'UTR	GTCACCTCAGAGTAATCTGTTTATCCATCGTTTGTTGAATCACTATGTTTTCCATTATTC	Os02g0246600	AK121483	Conserved hypothetical protein.
692	9	12	Os06g0542300|COMBINER_EST|CI551130|0	CTAGTATTGTAGCCTGAAACTTCTAAATCCAAGAGCAAAGTTTTGCTTTGCTTCCGGTTT	Os06g0542300	CI551130	Heavy metal transport/detoxification protein domain containing protein.
693	9	13	Os10g0371400|COMBINER|CI396069|6	CTTCATGGTTAATTATACTCTCTGGAACTTTCTCGGATTTTTCGGAGCTCAATTCCTAAT	Os10g0371400	CI396069	(No Hit)
694	9	14	Os02g0611200|mRNA|AJ251899|CDS+3'UTR	CTGCTTTGTCTGCCACAGTGAGCAAAATGTATCCGAATATCAAACTTTAATGTTGGGAAT	Os02g0611200	AJ251899	Similar to S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) (Induced stolen tip protein TUB13) [Contains: S- adenosylmethionine decarboxylase alpha chain; S-adenosylmethionine decarboxylase beta chain].
695	9	15	Os08g0435900|mRNA|AK060222|CDS+3'UTR	GGGAGGAGAGAGAGAGAGATGGATGCATGGGTGAGGGGGTGAGTTGAGTGGTGAATTTCT	Os08g0435900	AK060222	Similar to LHC I type IV chlorophyll binding protein (Fragment).
696	9	16	Os08g0112900|mRNA|AK069672|CDS+3'UTR	AGCTAATTAAGCCACTGAGCTGATGCTACAAGTATATTTGATCAGCTATTTATTTTTGTT	Os08g0112900	AK069672	Lipolytic enzyme, G-D-S-L family protein.
697	9	17	Os12g0502200|mRNA|AK064923|CDS+3'UTR	ACTACTTCTAGTTATGTTATGTTGAGATGACAATGGAGGTGTTTTAAATGTCTGTTTTTA	Os12g0502200	AK064923	Similar to Low temperature-responsive RNA-binding protein.
698	9	18	Os11g0312400|mRNA|D10335|CDS+3'UTR	CACAGTGCTTTGCGTTGTTTTAGTTCTAATAATCTCTATGGCATTGATGGAAGGAACATT	Os11g0312400	D10335	Adenylate kinase B (EC 2.7.4.3) (ATP-AMP transphosphorylase).
699	9	19	Os11g0673100|mRNA|AK104131|CDS+3'UTR	GTTTATGTAACAGATAAACTGATGAAGGAACTTGTGATAGAAACTTTGCAATAATTTGGA	Os11g0673100	AK104131	Conserved hypothetical protein.
700	9	20	Os02g0226300|COMBINER_EST|CI511260|1	ATTGAATACAGCTAGTAGCTTGTATCTAACTGAAAGCTTAGTAAATTCACAATCCAGAGC	Os02g0226300	CI511260	Mitochondrial carrier protein family protein.
701	9	21	Os06g0702600|mRNA|AB071296|CDS	CCATGGGAGGAATTTGTCGGTTGCGTGAAATGCATTAGGATCCTTTCACCTCAAGAAGTT	Os06g0702600	AB071296	Similar to Auxin response factor 7a (Fragment).
702	9	22	Os11g0210200|COMBINER_EST|Os11g0210200|8	AGGATGTTATGCACTTGTACTTCAATGCTTTCGTTGATGTCGATGAGCTAAAGTTTTTAT	Os11g0210200		Hypothetical protein.
703	9	23	Os09g0508900|mRNA|AK066022|CDS+3'UTR	TATCGATTATTTACAAGATAGGAAACCCAAAATGTCTCCAAATACTAATGCTTCTCTTCT	Os09g0508900	AK066022	Mitochondrial substrate carrier family protein.
704	9	24	Os02g0115900|mRNA|AK066006|CDS+3'UTR	AGCTCTTCCTTTTGCTACTTCCTTCTGATTTCCATGTGAACTGTGAAGAAGAAGAAGAAA	Os02g0115900	AK066006	Endosperm lumenal binding protein.
705	9	25	Os03g0214400|mRNA|AK067931|CDS+3'UTR	AATGTAATTGGACTATTGGAGACTTTGGAGTACTAGTACTACTAACCTAGTGGCTTTATT	Os03g0214400	AK067931	Similar to Digalactosyldiacylglycerol synthase 2.
706	9	26	Os03g0146600|mRNA|AK062333|CDS+3'UTR	TTCTTTTATTGATTGAATTCGCTCAGCAGTAAGCATGTAAAAAGATACCTCAGTGTCTTG	Os03g0146600	AK062333	Hypothetical protein.
707	9	27	Os12g0463300|COMBINER|CI405888|6	CACCTGCAGGGCAGACTTCTAAGTCTGCTAATGTGACCATTGGCAACACTGGACATGGAA	Os12g0463300	CI405888	(No Hit)
708	9	28	Os12g0496000|COMBINER|CI550886|6	ATTACTAATAAATAATCTCTCACAACATGAAGGTGGCGTCGGGAGGAAAAGGAGAGGAAG	Os12g0496000	CI550886	(No Hit)
709	9	29	Os12g0561200|mRNA|AK110847|CDS+3'UTR	GCTGCTCAGCGGCGCAAGATGCAAGTCGAGAAGGCTACTAAAGAAAGCGAGGCTGAAGCT	Os12g0561200	AK110847	PAPA-1-like conserved region domain containing protein.
710	9	30	Os02g0227700|COMBINER_EST|CI551769|0	AAACCAAAGATTTTAAGATGAACTGACTACTCTGTGTGCAATTCAACAAGATGCATGGTT	Os02g0227700	CI551769	Protein kinase domain containing protein.
711	9	31	Os11g0513500|mRNA|AY224562|CDS	ATGATGCTTTCTCTGTGGTTGTTGATGGAGCATTCTGTAGATGGATGGAAGATCGTGATC	Os11g0513500	AY224562	Conserved hypothetical protein.
712	9	32	Os12g0256900|mRNA|AK064488|CDS+3'UTR	TGTGTAGATCTTCTATTCTCTGGACACAGTATTTGTATTCCATTTGCTACGGTTGTTTTT	Os12g0256900	AK064488	Protein prenyltransferase domain containing protein.
713	9	33	Os09g0567600|mRNA|AK106807|CDS+3'UTR	GCCTTCTTTTTGGGGGGTGGGGTTGGGGGGTCTAAAATTTGTAGTACAAATGTACTGAAA	Os09g0567600	AK106807	Conserved hypothetical protein.
714	9	34	Os06g0254300|mRNA|AK066241|CDS+3'UTR	GTTTATATGAATATTATGTATATACGGATGCACTCTTAATAAGATTTGAGAAAACCTATT	Os06g0254300	AK066241	Caleosin related family protein.
715	9	35	osa-miR160c|Os08|5'seq	GGAATGTGCCTGGCTCCCTGTATGCCACTCATCTAGAGCAACAAACTTCTGCGAGAGGTT			miRNA
716	9	36	Os05g0506800|COMBINER|CI434600|x	ACCACCATCACTGATTTGTTGAGAGCAAAAACCATGACATGATTAATCCTAGCAGCATGG	Os05g0506800	CI434600	Lipolytic enzyme, G-D-S-L family protein.
717	9	37	Os08g0537200|mRNA|AK108234|UTR	GAAACGATTTAGTACCGTGAGATGCCGGTAGCTTGAGATATTTTTGTTTTTTATCAGAGT	Os08g0537200	AK108234	Non-protein coding transcript, unclassifiable transcript.
718	9	38	Os12g0211400|COMBINER_EST|Os12g0211400|8	ATGGGATTGACATCAGGAATCCGGAAGGTGTACAACATGGTCAAGGTCTTCAAGGAGAAA	Os12g0211400		DNA glycosylase family protein.
719	9	39	Os06g0293500|mRNA|AK110449|CDS+3'UTR	GGTGTGCCAATAAGTTTGGTCAGCTACTTTAAGCTATATAATGAAATGGATTTGCTAAAC	Os06g0293500	AK110449	Conserved hypothetical protein.
720	9	40	Os03g0144300|mRNA|AK073950|CDS+3'UTR	GCTGTACATGTACGGACCGAATACGATCGGTTGGAAAACACGTGCCTTAGCACAATAAAT	Os03g0144300	AK073950	Similar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein).
721	9	41	Os02g0145600|mRNA|AK100547|CDS+3'UTR	CTTGTGGGCAGTCATTGACAGGCATGGTGTGTACTTAACTGCTTATTGAAATGGTCAGGT	Os02g0145600	AK100547	Conserved hypothetical protein.
722	9	42	Os06g0343100|mRNA|AK100422|CDS+3'UTR	TGAGGTTGACAATTTTGACTGTTTCTATATTAGTTGATCCTGAAACATTACTATCTTTCG	Os06g0343100	AK100422	Similar to ATP-dependent helicase DHX8 (RNA helicase HRH1) (DEAH-box protein 8).
723	9	43	Os01g0764900|mRNA|AK066328|CDS+3'UTR	CTACCAAGCACCAACTCGTGTTATCTGAGTTGTGCAAGCAACTAAATTTCCTTATTGTCC	Os01g0764900	AK066328	Tetratricopeptide-like helical domain containing protein.
724	9	44	Os10g0136100|mRNA|AK073424|CDS+3'UTR	TATTTCCTTAGGAACTCTGTTAATGTTTTAGTGTAGTCTGTAGAGCCATTTACAGTTTGC	Os10g0136100	AK073424	Similar to Hv1LRR2.
725	9	45	Os08g0433400|mRNA|AJ495796|CDS+3'UTR	GCATTTGTGAAATATTAGGGTACCGTGGGCCTGTGGGGATGTAGTAAATAAACCAGATTG	Os08g0433400	AJ495796	Similar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4).
726	9	46	Os02g0152000|COMBINER_EST|CB656445|7	GGCAGGAAGAGGTCCCCAATAGATCTTGAAAGGCACATGCCACCTGTCTAGCACCGGAGA	Os02g0152000	CB656445	Hypothetical protein.
727	9	47	Os01g0576100|COMBINER_EST|Os01g0576100|8	GGCGCATGGATGAATCGTGCCGCTGGTAGCAGCATCAAGAACCATGTCATGTCCGAGAGA	Os01g0576100		Similar to Oryza longistaminata transcriptional activator Rb homolog (Fragment).
728	9	48	Os03g0270000|mRNA|AK106069|CDS+3'UTR	ATTTTGCATACTTTGGACTACTCGATCACTACAAAATATTTCTTGAGTTTTACTCCCTGC	Os03g0270000	AK106069	Protein of unknown function DUF296 domain containing protein.
729	9	49	Os07g0668900|mRNA|AK067054|CDS+3'UTR	CGGACAATGACATACTGTATAGACCATAGAGTGTATGATCATATAATGTGAAAGACTCCT	Os07g0668900	AK067054	Similar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
730	9	50	Os04g0616400|mRNA|AK099657|CDS+3'UTR	CCAAAGAGAGAGAAACACATATTTAACTTGCATGCGAGAAACACATCACCATATTTAACT	Os04g0616400	AK099657	Similar to Receptor-like serine/threonine kinase.
731	9	51	Os04g0565200|mRNA|AK111866|CDS+3'UTR	TGTGTGTGAGGCTTTGTTTAGTTGCTTACAAAGTTGGAAATTTAGTTTGAAATTGGTACG	Os04g0565200	AK111866	Similar to Cis-zeatin O-glucosyltransferase 1 (EC 2.4.1.215) (cisZOG1).
732	9	52	Os02g0697500|mRNA|AK105891|CDS+3'UTR	GTTGTGCAATGAAAACAAGACTGATGAGTTATATAAATGATGGTAAATATGCATTTCGAG	Os02g0697500	AK105891	Similar to Selenium-binding protein-like.
733	9	53	Os01g0922800|mRNA|AB003327|CDS+3'UTR	TGTTTCAACCTATTGGTATGAATCTGTTTGATTCTGTAGGAACTGTGGTTTGCTGTTTGC	Os01g0922800	AB003327	Similar to MADS-box protein PTM5.
734	9	54	Os05g0445100|mRNA|AK105264|CDS+3'UTR	AGGAGCGTAACTAAAGTCTCTCTGCATGTGTGAGTATATAATCATTTCGGCCCGGCGTAT	Os05g0445100	AK105264	Cytochrome P450 family protein.
735	9	55	Os05g0183300|COMBINER_EST|CI341631|6	TGATCAATGTATTGTTATAACTTTGTACAATTAAGATATAATCGCAGTGTCACAGTTTTA	Os05g0183300	CI341631	Similar to Seven transmembrane protein Mlo6.
736	9	56	Os02g0137200|mRNA|AK099849|CDS+3'UTR	GTTCTTTGCCCATGTCCAGGTTTTGTATACGCGTAACTTTGAATTTCGTAAAGCTAATTT	Os02g0137200	AK099849	Similar to 50S ribosomal protein L3-1, chloroplast precursor.
737	9	57	Os03g0293000|mRNA|AK063376|CDS+3'UTR	TTTTGTTGTGTCATGAACTGGAATACCCTGACATGGGAGAGATCACTCCCCCTGTAACAT	Os03g0293000	AK063376	Thioredoxin fold domain containing protein.
738	9	58	Os05g0422300|mRNA|AK111886|CDS+3'UTR	CTGCACAATAGGGTAAGGTTTTTTGTAACAGTAGTATCATATAGAAACCATCGAAGTCGT	Os05g0422300	AK111886	WD40-like domain containing protein.
739	9	59	Os01g0743500|mRNA|AY444338|CDS+3'UTR	CGTACGGCAGTAGCATTTTATCCCTGAACTGTGCTTGTACATATTTGCCCTGTCATCATG	Os01g0743500	AY444338	Cytosolic NADP malic enzyme.
740	9	60	Os05g0402700|mRNA|AK061050|CDS+3'UTR	ACCTTTTTGTGTAACACATTACCAAATATCAATTGCCTGGATTGAAATATCGTTTTTATC	Os05g0402700	AK061050	Similar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13).
741	9	61	Os05g0296800|mRNA|AK108441|CDS+3'UTR	CTTTGTTGACATGAGAGTAACTGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGA	Os05g0296800	AK108441	Hypothetical protein.
742	9	62	Os01g0952200|mRNA|AK122134|CDS+3'UTR	TTTCCTTCAATATTGAGGCCCTTCAATTCTTTTGATATAGAAATGAGTCCTTTTGTTTCC	Os01g0952200	AK122134	Cyclin-like F-box domain containing protein.
743	9	63	Os06g0690700|mRNA|AK058451|CDS+3'UTR	CCAAATTTTTGTAGGATGTACATGTACTCGTATCACTATCGTGTAAAGAATTTTTTTTCA	Os06g0690700	AK058451	Similar to Potential cadmium/zinc-transporting ATPase HMA1 (EC 3.6.3.3) (EC 3.6.3.5).
744	9	64	Os08g0132100|COMBINER_EST|Os08g0132100|8	AGAAATGTCCATGAACAGCCGATTCTTGCTCTGTTCCCAGAACGATCTCCATCTTGGATT	Os08g0132100		Conserved hypothetical protein.
745	9	65	Os09g0305300|mRNA|AK105016|CDS+3'UTR	TGCCCCTGTATGCCTACCGATTTTACGTTCATTATCGAAGTACCAATCATTCTCCGCTGC	Os09g0305300	AK105016	Protein of unknown function DUF247, plant family protein.
746	9	66	Os01g0788800|mRNA|AK121338|CDS+3'UTR	ATGCAGTTTGCTTCGCAGAGACGCGGATACATTTGCTATCGTATGGATGCTCCTTTAGAA	Os01g0788800	AK121338	Homeodomain-like containing protein.
747	9	67	Os02g0135600|mRNA|AK069843|CDS+3'UTR	CGCCGTTGCTGTTTGTGTAGAATCCATTTACTTGAAACTTTCTAACTTGGGAGCTGTTTC	Os02g0135600	AK069843	Conserved hypothetical protein.
748	9	68	Os01g0115300|mRNA|AK107581|UTR	CGCGGCAAAATCAGTTTTATGTGTTTCTCTTTTTCAGGCACAATAGAACTAGATTGATGG	Os01g0115300	AK107581	Non-protein coding transcript, uncharacterized transcript.
749	9	69	Os05g0529900|COMBINER_EST|AU075410|7	GTTTGTAGAGAGCAGGATGAGGAGGGGGTAAATGAAGGGGAATATAATAAACGTTTGGCC	Os05g0529900	AU075410	Protein of unknown function DUF284, transmembrane eukaryotic family protein.
750	9	70	Os01g0377000|COMBINER_EST|CI545010|0	AAATTACTGGGTTTTGTCATCATGTAACATATTTAACCTAGCATTGAATTTGTGGAGGGG	Os01g0377000	CI545010	E-class P450, group I family protein.
751	9	71	Os04g0283900|mRNA|AK065012|CDS+3'UTR	GCTCCTCGCACCAATGTGTAGCCCTACGTATTCTTTACAACATTTTGCGTTGTAATTGCA	Os04g0283900	AK065012	Conserved hypothetical protein.
752	9	72	Os02g0534400|mRNA|AY342319|CDS	GGAGGCGGATATTAAGATTTCACATCTGAAAGCGTGGGAAATGAAGAAGCCGCTTATGAA	Os02g0534400	AY342319	Cell wall invertase (EC 3.2.1.26).
753	9	73	Os06g0167200|mRNA|AK100240|CDS+3'UTR	TTCTGCTCATCTTTTTAACACCGTATTAATCAATCTGTTCATAGCCAATTCGTTCCATTC	Os06g0167200	AK100240	Similar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8).
754	9	74	Os02g0184100|mRNA|AK073734|CDS+3'UTR	TTGTTGTACCCTCCAGACATTAGACATGAATGGATGTACGTAATAATGCAGCAATGCAAG	Os02g0184100	AK073734	Conserved hypothetical protein.
755	9	75	Os10g0571900|COMBINER_EST|Os10g0571900|8	GTTTGCATTAGGTATGAGAAGTACACAATTGAGTGAGAGTCTAAATAGTGAACTGAAGAG	Os10g0571900		RmlC-like cupin family protein.
756	9	76	Os01g0706000|mRNA|AK059936|CDS+3'UTR	CTGGAAGTTGCAATACTGATATGTTTTGGGCAGGTGATCTGAGCCCTTTATCATTGTTTC	Os01g0706000	AK059936	Similar to RNA polymerase II transcriptional coactivator KELP.
757	9	77	Os06g0121800|COMBINER_EST|CI141089|6	ATTTGGTACCGCACGTATTAGTATTTGGGATCGATCAACCTGCTTAATTTACATCCCTAT	Os06g0121800	CI141089	Peptidase A1, pepsin family protein.
758	9	78	(+)eQC-40		
759	9	79	osa-miR531|Os11|3'seq	CCGGGGCTGCGTGCCGCCATAGCTGGCGCGCATCCCCGTCGAGCGTTGCTCGACGGTGCC			miRNA
760	9	80	DarkCorner		
761	9	81	DarkCorner		
762	9	82	DarkCorner		
763	9	83	DarkCorner		
764	9	84	DarkCorner		
765	9	85	DarkCorner		
766	10	1	DarkCorner		
767	10	2	DarkCorner		
768	10	3	DarkCorner		
769	10	4	DarkCorner		
770	10	5	DarkCorner		
771	10	6	DarkCorner		
772	10	7	Os02g0125800|mRNA|AK121932|CDS+3'UTR	AACAGGTCAAGCTAGTAGATGGCAAATCATTTTTCTTGTCATGGTGACACAGGTTGCGCT	Os02g0125800	AK121932	Transcription factor Tfb4 family protein.
773	10	8	Os01g0363300|mRNA|AK059622|CDS+3'UTR	TTTGATGATTATATTGCGATTATTAGTCAATTAGAGGCAACAGTGGTCGTTTACCTCTGT	Os01g0363300	AK059622	Protein of unknown function DUF588 family protein.
774	10	9	Os04g0588800|COMBINER|CI155889|6	TCTTGTGGTGCCTTTTTCCTGCTTTTCAGCTTTCTAGGACAGCATCTCTACTTTCAGTTT	Os04g0588800	CI155889	(No Hit)
775	10	10	(-)3xSLv1		
776	10	11	Os07g0249200|mRNA|AK102619|CDS+3'UTR	TTCAAACCGTGTGACCAACATTACATAAAGTAGTAATAGTACGGTTGCTTGTCGATTGAT	Os07g0249200	AK102619	Similar to Vesicle-associated membrane protein 724 (AtVAMP724) (SYBL1-like protein).
777	10	12	Os08g0519100|mRNA|AK063287|CDS+3'UTR	ACGAATGTACTGCTACATGACTGCAATTTCTAGTTTTCAAATAAAACATGTTTGCTCAGA	Os08g0519100	AK063287	Plant-specific FAD-dependent oxidoreductase family protein.
778	10	13	Os01g0189700|mRNA|AK071329|CDS+3'UTR	TTGATGGAATAATTTCTCATGCAAAGGTCAACCATACAAAGCCAACGACTCGTGGACCAA	Os01g0189700	AK071329	Ankyrin repeat containing protein.
779	10	14	Os03g0142800|mRNA|AK064325|CDS+3'UTR	CATAGTGGAAAAAGGGAAGGCAATGTTCATGGGTAATAAAGGGGTAACAAGTTTCATTTT	Os03g0142800	AK064325	Similar to MRP-like ABC transporter.
780	10	15	Os11g0591200|mRNA|AK120567|CDS+3'UTR	GGCAACCTGTAAACATTATTTAAATTTGATGATGGTTTAAACTAAGGTGACTTGGTTTGG	Os11g0591200	AK120567	Similar to Beta-ketoacyl-CoA-synthase.
781	10	16	Os03g0822200|mRNA|AK104151|CDS+3'UTR	CATCGTTTCCTGAAAACTCCTATTGAAATCAGTGAATTGTTCAGACAAGACACAAATTGA	Os03g0822200	AK104151	NAD-dependent epimerase/dehydratase family protein.
782	10	17	Os01g0120400|mRNA|AK067022|CDS+3'UTR	TGTACCACCATGGACTATATGTGTCTTTTTCCTGAATTATATCCAGGAAATTGTACTAGA	Os01g0120400	AK067022	Alanyl-tRNA synthetase, class IIc family protein.
783	10	18	Os08g0235600|COMBINER_EST|Os08g0235600|8	CATCAGATGTTGCGAATTGAGATTAAAAGGAAAAAACAACCTTAAACTCCGGAAGGTTGA	Os08g0235600		Disease resistance protein family protein.
784	10	19	Os02g0265900|mRNA|AK072628|CDS+3'UTR	GGTGTGCAACTCTGCAATGTTAATATACAAGATCTTGCTGCAAGCCTGCAACCATATATG	Os02g0265900	AK072628	Reticulon family protein.
785	10	20	Os06g0289900|COMBINER_EST|CI000741|0	CAAAGCTCCTCCTTGTTCCCGGTTAGGAACAAATTTGGTTGTTTCTTTTTCCAGTTTGTT	Os06g0289900	CI000741	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
786	10	21	Os04g0652600|mRNA|AK107489|CDS+3'UTR	TTGACTTGTATGGAGATCTGTTGTTGCTATTCATCCCGTTGTCACATAGCGTGTTGGTGT	Os04g0652600	AK107489	Conserved hypothetical protein.
787	10	22	Os04g0455900|mRNA|AK063763|CDS+3'UTR	ATAAAGTAACCATGTGACGGTGTGGATGGTATCCCATAATGAATGCACCATGTCTTTTGC	Os04g0455900	AK063763	Protein of unknown function DUF1692 domain containing protein.
788	10	23	Os12g0632700|mRNA|AK065955|CDS+3'UTR	TGGACTTGCAAATTATAGAGGAAAAAGAAAAGCGGAACTAAATTTTACTTCCTCCGTTTC	Os12g0632700	AK065955	Similar to Malate dehydrogenase, glyoxysomal precursor (EC 1.1.1.37).
789	10	24	Os05g0154800|mRNA|AK102716|CDS+3'UTR	CCATAGATTTTCATTGTTAGGTAGACTACACCATGACAACCATGTTAATGTACTACTGCT	Os05g0154800	AK102716	Similar to U1snRNP-specific protein, U1A.
790	10	25	Os04g0477500|mRNA|AK067372|CDS+3'UTR	TGTGCTCTGGTTGCCTCAAATCAACAAGAGGTTTGAGATGGATACTACTACTACTCGTGT	Os04g0477500	AK067372	Glycosyl transferase, family 17 protein.
791	10	26	Os06g0292100|COMBINER_EST|Os06g0292100|8	GAAGGTTCAAATTCCTTCTCAGGACCATCCTGAAAATGCTTCAAGAGCAGACACACCCAA	Os06g0292100		Similar to Embryogenesis transmembrane protein.
792	10	27	Os03g0122600|mRNA|AY332476|CDS+3'UTR	AAAGGAGATGATGCTAGGCATGCAATGACACCAAACCATCCTAAAAACAGACCACGCTGT	Os03g0122600	AY332476	Transcription factor, MADS-box domain containing protein.
793	10	28	Os04g0408600|mRNA|AK121434|CDS+3'UTR	ATTCTGTACAAAGTAATGTAATGCGACCAGCCAACCACCTCCATTGTTGTCCTAGCTGAA	Os04g0408600	AK121434	Protein of unknown function DUF662 family protein.
794	10	29	Os05g0530400|mRNA|AB050098|CDS+3'UTR	TTTAGTAGACCATATCCATTTTTGTACTCCATTGCCCTTCTAAGATTCCTCGTTAAAATC	Os05g0530400	AB050098	Heat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10).
795	10	30	Os03g0815100|mRNA|AK067690|CDS+3'UTR	TTCTCTCTATAGAACCCCAACAAATTTTGTTGTTGATGTTGTTTATCTTCATATGCTTTG	Os03g0815100	AK067690	Similar to OsNAC6 protein.
796	10	31	Os07g0502000|COMBINER_EST|CI479716|6	TGGCTACATGCCTCTTTGAGTACTGCGGCTGTGCGGCCCCTTGTGTCTCATTCCAGTACT	Os07g0502000	CI479716	Hypothetical protein.
797	10	32	Os04g0309100|mRNA|AK069240|CDS+3'UTR	GTAATGTCTTCTGGTAGTGTAAGTTGGAAAAATTAGTGGCATATATGAGAATGGACATTC	Os04g0309100	AK069240	Similar to NAD(P)H-quinone oxidoreductase chain 3, chloroplast (EC 1.6.5.-) (NAD(P)H dehydrogenase, chain 3) (NADH-plastoquinone oxidoreductase chain 3).
798	10	33	Os02g0223200|mRNA|AK100220|CDS+3'UTR	GTGTCTCATTGAAAAAGGTTGCCTTCACATTGATTTAGATCGTCAAGACCTCAGCGCCAA	Os02g0223200	AK100220	Similar to GTP cyclohydrolase II/3,4-dihydroxy-2-butanone-4-phosphate synthase- like protein (Fragment).
799	10	34	Os03g0440900|mRNA|AK061730|CDS+3'UTR	CATATTGTACATTCTCCCAGTCCCACCAACGGTTGAAATACCAGCATTGCATGTTAAAAG	Os03g0440900	AK061730	Similar to LRR protein.
800	10	35	Os02g0742900|mRNA|AK064545|5'UTR+CDS	ACAGGAGCTGACGGATTACGGCTTAAAGAAGGAATACACATAAATAGAGGCCTTCTAGCC	Os02g0742900	AK064545	Similar to Kinesin-like protein.
801	10	36	Os05g0589700|mRNA|AK068031|CDS+3'UTR	TGGGAGGGATTGTTTTGCTTGTTTGGAATCTCATGTGTTGGGAACAAGATAGACAAGATT	Os05g0589700	AK068031	Similar to Dual-specific kinase DSK1.
802	10	37	Os09g0467400|mRNA|AK061667|CDS+3'UTR	TCGGCGAAAACAAGCTACTTCACTGTATCTGTAATGACTGAGTACGGTGCAATGTTTGTT	Os09g0467400	AK061667	Protein of unknown function DUF6, transmembrane domain containing protein.
803	10	38	Os04g0677100|COMBINER_EST|CI201966|6	CTTGTCAAATGGCCAAGTACTGTAATATGTACTGCAACTGTGCAATGCATGCAAGTTGGA	Os04g0677100	CI201966	Peptidase A1, pepsin family protein.
804	10	39	Os07g0568000|mRNA|AK073639|CDS+3'UTR	CCTATATACTTGCAGAAAAATTGATAATCCATATTTACTGTCCTCATTTTCTTTTCCGTG	Os07g0568000	AK073639	Apolipophorin III-like domain containing protein.
805	10	40	Os09g0503400|mRNA|AK099796|CDS+3'UTR	TGAAGCTGCTCGTGCTAAAGCTGGCGTGCATGCCTCTATGCTGGACAAGACCCGCCTTCT	Os09g0503400	AK099796	Leucyl-tRNA synthetase archae/euk cytosolic, class Ia family protein.
806	10	41	Os04g0692600|mRNA|AK105888|CDS+3'UTR	TAGTATGTACCCACTCCACGATCAACAAAATGAGAAACGATTGCCTTTCCAAGCATTCCT	Os04g0692600	AK105888	Conserved hypothetical protein.
807	10	42	Os01g0204000|mRNA|AK101572|CDS+3'UTR	CATCCATGACATACCAGGTCAACCTCATGTAGAAAGTTAAAAACAAACAGTCATCTGTTA	Os01g0204000	AK101572	Conserved hypothetical protein.
808	10	43	Os01g0835900|COMBINER_EST|C98314|6	GCTAGTATAAAACTGCTAGTTTTGTCTTGTGCAAATCTCACATTAGGAATTTCTATTCGC	Os01g0835900	C98314	Histone H4 family protein.
809	10	44	Os10g0363700|COMBINER_EST|CI514936|6	AGGGTGTTTTCAGCAATAGACTTGTTGTACAGACCTTGTTTTGCTGTTGTTAATTTAATG	Os10g0363700	CI514936	Hypothetical protein.
810	10	45	Os05g0405900|mRNA|AK061891|CDS+3'UTR	TTGACTGCTTCCTGCCAAGGCCTGTTAATGTTCCTTGTTTATTTGTACAGTCTTTTCTGT	Os05g0405900	AK061891	WD40-like domain containing protein.
811	10	46	Os10g0407000|mRNA|AK101494|CDS+3'UTR	AGTGTAACATTTGGTCAACTTGTGCCCACGCAATTGTATTGAGGAGAGATATTTGTTGTT	Os10g0407000	AK101494	Virulence factor, pectin lyase fold family protein.
812	10	47	Os03g0178200|mRNA|AK106024|CDS+3'UTR	AACAACCTGCTTGACTAGTTTGACATGTTCCAGTCTTTTGGATGAGTTTGTTACTTTGTT	Os03g0178200	AK106024	Protein of unknown function YGGT family protein.
813	10	48	Os07g0194800|mRNA|AK101244|CDS+3'UTR	CTATTTAAGATGGAAGATGTAAACATGGGCATGTGGGTCGAGAAGTTCAACAACACGCTT	Os07g0194800	AK101244	Conserved hypothetical protein.
814	10	49	Os03g0833900|mRNA|AK104068|CDS+3'UTR	AAAGAATAATGTAACCTTCGGCATTCTGCCATTAGTGGACCATAAGCTATCAATTTAAAT	Os03g0833900	AK104068	Similar to Cytosine deaminase (EC 3.5.4.1).
815	10	50	Os11g0460800|mRNA|AK066902|CDS+3'UTR	CCGTTCGGGCTGATAATACTTGTCGTTTTGGACAAGAGTGAAGTTAAACTCTAGAATCTT	Os11g0460800	AK066902	Peptidase S10, serine carboxypeptidase family protein.
816	10	51	Os08g0425800|mRNA|AK061339|CDS+3'UTR	TTTGTATGATTTGGCACCGTAGTTGGTATATGGAATAAGCTGTGCTGCAAAGCACTTGTT	Os08g0425800	AK061339	Conserved hypothetical protein.
817	10	52	Os05g0268500|mRNA|AK064671|CDS+3'UTR	TTTTCTGCAGGCTAATACATGATACATGATAGACAATGTTAGTCATATACTTTTGCATTG	Os05g0268500	AK064671	Similar to Serine carboxypeptidase II chains A and B (EC 3.4.16.6) (Carboxypeptidase D) (CPDW-II) (CP-WII).
818	10	53	Os06g0221100|mRNA|AK102978|CDS+3'UTR	CTTGTAAAACAAGTTCATCAACGGAGTTATGGAGCTTAAAATGAGTAACTCTGAAACATG	Os06g0221100	AK102978	TLDc domain containing protein.
819	10	54	Os04g0429800|mRNA|AK099191|CDS+3'UTR	TCTGACTGTACATCCATGATCCATTGTACTATACGTCGTTATGGAATTGAACATCCTTTT	Os04g0429800	AK099191	Nicotinate phosphoribosyltransferase and related family protein.
820	10	55	Os12g0527900|mRNA|AK099985|CDS+3'UTR	GCACAATTCGCAACAAGTTACTGCTCTTTGTTTTTGAAAACAGATACAGATAACAAATCG	Os12g0527900	AK099985	TPR-like domain containing protein.
821	10	56	Os06g0168000|mRNA|AK059250|CDS+3'UTR	GTTAGCAATACACTGAGTTGGTCAGCAGCCGGCAGTTCCATAGTTTTGGTACTTCAAAAG	Os06g0168000	AK059250	Glutathione S-transferase, C-terminal-like domain containing protein.
822	10	57	Os11g0639300|mRNA|AK102044|CDS+3'UTR	CATTTTCTCTGTTCAGCCATCCACCATGGCCAGCAGCCGCAGGATATGCTTTGAGATTCG	Os11g0639300	AK102044	Protein of unknown function DUF594 family protein.
823	10	58	Os12g0135200|COMBINER|CI517270|5	GAGATTCGCGCTATTTGGTGGGTGGATAGGATAGATTGATGCTAATGTCAAGTAACATGG	Os12g0135200	CI517270	Cyclin-like F-box domain containing protein.
824	10	59	(-)3xSLv1		
825	10	60	Os08g0187900|COMBINER_EST|Os08g0187900|8	CCTCCGCACCGGCGTCCGCCCGCGCTCGTGGGACGAGCCGGACGCCGCCTGGACGGAGGA	Os08g0187900		Conserved hypothetical protein.
826	10	61	Os03g0192700|mRNA|AB012107|CDS+3'UTR	ATCGGGCTATGCAACTAGCAGCAGCCTTACTATGGTACTGGATGATGTTATGGAGAATGT	Os03g0192700	AB012107	Similar to Myo-inositol-1-phosphate synthase.
827	10	62	Os11g0682000|COMBINER|CI468703|x	GATCTCCCCATACTGTAAATGGTATATTTCATGGGTATGTATGTCAATAATGAAGAATCC	Os11g0682000	CI468703	Conserved hypothetical protein.
828	10	63	Os03g0441000|mRNA|AK120625|CDS+3'UTR	TCAGGCATGATATAATAAACAGCATCAAGCTCATTATGTAGAGCTGATACCTGATTGTGT	Os03g0441000	AK120625	Transcription initiation factor TFIID component TAF4 domain containing protein.
829	10	64	Os10g0540200|mRNA|AK106808|CDS+3'UTR	TACCCACTTGCATCTCTAAATTTGATTTAGTAAGGACATGCTTACAATCTGCTTGATCCC	Os10g0540200	AK106808	Similar to Selenium-binding protein-like.
830	10	65	Os03g0563300|mRNA|AK070720|CDS+3'UTR	GTCTTGTGCAAACATAAGGGTATAAGATAAAGGGTGCATCAGTCCATGGGAGCATATTTT	Os03g0563300	AK070720	Similar to Mg-chelatase subunit (Fragment).
831	10	66	Os10g0578800|mRNA|AK065615|CDS+3'UTR	AGCTTAGTCTTCATAGCTGGCGATGCCTCTGCCTCACAAACACAACACTTTTCTTACTAG	Os10g0578800	AK065615	LrgB-like protein family protein.
832	10	67	Os03g0183000|mRNA|AK060929|CDS+3'UTR	TGGATCGTGTAAGAATATCATAATTTGCTGGATTCAGTCCAGTCGTAATGTATTTTGGTT	Os03g0183000	AK060929	Similar to AP2 domain containing protein RAP2.6 (Fragment).
833	10	68	Os02g0104400|COMBINER_EST|CB645227|7	GAGAAGGAAGGAGAGAGAGCAATAAGCACTAAACTAGTTAATTAATGGCCGTCATGGCTC	Os02g0104400	CB645227	Hypothetical protein.
834	10	69	Os03g0424800|mRNA|D29730|5'UTR+CDS	TCTACCTGAGGCAGGGTATTGGTGTAGGTGGCTTCCAGAAGATCTATGGTGGCCGCCAGA	Os03g0424800	D29730	Similar to 40S ribosomal protein S19-3.
835	10	70	Os05g0380300|mRNA|AK120094|CDS+3'UTR	TTGTAAATGTTGTAGCCGTTTGTTGTTGTGTGTAATGCCAGTTGGCTTTATCAGGGTCAG	Os05g0380300	AK120094	Similar to NBS-LRR protein (Fragment).
836	10	71	(+)E1A_r60_a20		
837	10	72	Os11g0183700|mRNA|AK066941|CDS+3'UTR	TCACTTAGGTTCTCATTTTATGTATTTATGATCACTTGGGTTCTCATTTTATAGCCTCAA	Os11g0183700	AK066941	SWIRM domain containing protein.
838	10	73	Os09g0452700|COMBINER_EST|C97117|6	GAGAGATGCTTATGAGATTTTGCTTTCAAGTTTCTGTTACTGGATTTTGGACAAATCTCT	Os09g0452700	C97117	Ubiquitin.
839	10	74	Os06g0142400|COMBINER_EST|CI050172|0	ACTTTCTCTTCAGCTCCCATCCCATCATCGTCTTGATCGCGATGGCAACGGTGACCCGTG	Os06g0142400	CI050172	Early nodulin.
840	10	75	Os06g0107800|mRNA|AK062921|CDS+3'UTR	ATTAATTGGACGATGGAAGCAAGCAACAACACAAGGCTAAGGTACCTAGCTAGCTTTGCT	Os06g0107800	AK062921	Similar to RAV-like protein.
841	10	76	Os02g0298100|mRNA|AK099932|CDS+3'UTR	TGGACAATGTATTCTCTCATTAGCTTGTACTTACCAGAATGGTTTATATGAACATGAGCT	Os02g0298100	AK099932	Conserved hypothetical protein.
842	10	77	Os07g0616500|mRNA|AK071738|CDS+3'UTR	GTGGCTTCGCGGATCAGTCCAGTTACATCATATTCAGGTCTCAATGTGAGAGACTTTAGT	Os07g0616500	AK071738	Similar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase).
843	10	78	Os10g0504600|mRNA|AK064441|CDS+3'UTR	GCTTCTCATCTAGAGTGTTGTGTTGTATAATTCCTGATGCTTGGCTTTTGTTGTGAAGAA	Os10g0504600	AK064441	Chorion 2 family protein.
844	10	79	Os08g0558000|mRNA|AK061522|CDS+3'UTR	ATTCAGTGCACTTCGGATTTATGCAAATGAGGCTTGTGTTATTTATGAATAGTTTCGTTC	Os08g0558000	AK061522	Similar to 60S ribosomal protein L10a-3.
845	10	80	DarkCorner		
846	10	81	DarkCorner		
847	10	82	DarkCorner		
848	10	83	DarkCorner		
849	10	84	DarkCorner		
850	10	85	DarkCorner		
851	11	1	DarkCorner		
852	11	2	DarkCorner		
853	11	3	DarkCorner		
854	11	4	DarkCorner		
855	11	5	DarkCorner		
856	11	6	DarkCorner		
857	11	7	Os10g0459900|mRNA|AK110981|CDS+3'UTR	GAGAAAATCAAATGACGTGCTTAGCATATTGAGCAGAGACAGATTAAGACAGTTCAATAC	Os10g0459900	AK110981	Conserved hypothetical protein.
858	11	8	osa-miR528|Os03|Mature	TGGAAGGGGCATGCAGAGGAGTGGAAGGGGCATGCAGAGGAGTGGAAGGGGCATGCAGAG			miRNA
859	11	9	Os11g0209400|COMBINER|CI407110|6	ATCACCAGATTAATTGAAAAGAAAATGGAAATGCTGCATGACATTTCGTGGGAGTCGGAA	Os11g0209400	CI407110	Hypothetical protein.
860	11	10	Os03g0101800|mRNA|AK103196|CDS+3'UTR	ACTTCAAATATAATTAACTGGAGAGCAGGGGCTGCCTGAGTACATTGCTACGTTTCTGCA	Os03g0101800	AK103196	Protein of unknown function Cys-rich family protein.
861	11	11	Os08g0562200|mRNA|AK099629|CDS+3'UTR	CTGCAGAGTGCTGTAAATATTCCCCAAATCTGCAATGAATTGAACGAGGGTGCATTTGCC	Os08g0562200	AK099629	Similar to CUC2.
862	11	12	Os01g0844800|mRNA|AK102882|5'UTR+CDS	AGATGTATGGATGCCGAGTTATCCAAAAGGCAATAGAAGTGGTTGACCTGGACCAGAAGA	Os01g0844800	AK102882	Similar to Pumilio RBD (Fragment).
863	11	13	Os02g0794500|mRNA|AK112076|CDS+3'UTR	ATTCCTGTGCTCTGAAGGAACCCTGAGCAATTATCTCATCGAAAAAGAATATATCATGTA	Os02g0794500	AK112076	Similar to Serine carboxypeptidase II precursor (EC 3.4.16.6) (Carboxypeptidase D) (Bri1 suppressor 1) [Contains: Serine carboxypeptidase II chain A; Serine carboxypeptidase II chain B].
864	11	14	Os10g0400200|mRNA|X06149|CDS+3'UTR	TGGTATCCTCTTGGAGATTCATCAATATGAGAAAACAGAGAATGGACAACCCTCCCTTAT	Os10g0400200	X06149	Glutelin type II precursor.
865	11	15	Os02g0451900|mRNA|AK061194|CDS+3'UTR	CATTACCTGACCTTGTACTGAATATATATGTCTCTTTCAGAGCTGCAAATAGGGATAGCA	Os02g0451900	AK061194	Conserved hypothetical protein.
866	11	16	Os09g0375400|COMBINER_EST|CI549143|4	TTGGTTGATAATGTTCCCCCACAATTGTAGAGACCTGACAAATCATTACCAATTCAGGTT	Os09g0375400	CI549143	Appr>p cyclic nucleotide phosphodiesterase domain containing protein.
867	11	17	Os08g0465400|mRNA|AK068332|CDS+3'UTR	AAATCGCCGTAGGATCTAGTTTACACCGGTTTTATAAGTTGGGGGACGCGTTGTATCCGG	Os08g0465400	AK068332	Conserved hypothetical protein.
868	11	18	Os03g0289400|COMBINER_EST|CI428311|6	ATCAGGACATGCATCCGAGTATCCGACCAATGTTGCAGTGGGATATGCTGCCAAGTCCCA	Os03g0289400	CI428311	Similar to Rhodanese-like family protein.
869	11	19	POsControl0029|random		
870	11	20	Os11g0600600|mRNA|AK110531|UTR	CACCCTGTGTAACATGAAAGAGAGGATTTGGGAGTTAATTAACGACTGATAATCAGTCGC	Os11g0600600	AK110531	Non-protein coding transcript, unclassifiable transcript.
871	11	21	Os01g0740300|mRNA|AK121893|CDS+3'UTR	CAACCCATAACACTAAACATGGTTTCCATAAACTCCACATCATCAAGAAACTAGTACTAG	Os01g0740300	AK121893	Hypothetical protein.
872	11	22	Os05g0157300|mRNA|AK058852|CDS+3'UTR	ATCCATTTGTTGTTTGCATGTACACCTTGAATATTCTATATAGTTCAGTGGACAACGAAG	Os05g0157300	AK058852	4Fe-4S ferredoxin, iron-sulfur binding domain containing protein.
873	11	23	Os02g0800600|mRNA|AK065568|CDS+3'UTR	CACATCTGGTCCTCCCTTATTTTCGTTGGCTTGTGTAGAGAAGAAAAGGTGGAATTGTGG	Os02g0800600	AK065568	Conserved hypothetical protein.
874	11	24	Os03g0688300|mRNA|AK105102|CDS+3'UTR	TGTTTGAAATTGCGTCGGGTGTAATTATGTGGTAACGGTGGTAATCAAGCAAATTTACAG	Os03g0688300	AK105102	Similar to Calcium-dependent protein kinase.
875	11	25	Os12g0270200|COMBINER_EST|CI259123|6	CGTTTATCAGCAGCACTCACCATCCTATGTTAGGGAGGTGGTAAGCAGTTTATGTGCTTT	Os12g0270200	CI259123	Thiamine biosynthesis protein ThiC family protein.
876	11	26	Os05g0116100|mRNA|AK070895|CDS+3'UTR	CTGCAAACATTAGATTTGCTGGTGAAGTTGTTATGCAATAATGCAAAGTGGAGCAGTATA	Os05g0116100	AK070895	Dehydroascorbate reductase.
877	11	27	Os12g0172500|mRNA|AK101515|CDS+3'UTR	ATTTGTGTGGCTCAATGGAATAATGGGGTATTCTCCTGTACAGAGATACATATAGTCCAA	Os12g0172500	AK101515	WD40-like domain containing protein.
878	11	28	Os11g0287100|COMBINER_EST|Os11g0287100|8	CAGCGGCGCGGCGGACGCGGACGCGACCAGCGCGCCGACGGCGCGCCCCATCAGCACCGG	Os11g0287100		Hypothetical protein.
879	11	29	Os01g0362800|mRNA|AK071457|CDS+3'UTR	AGTGGATTTGAAGGTACCACAAGGTACCGTGTAAGTAGTTTTTAAAGGTAACGTAAAATA	Os01g0362800	AK071457	Conserved hypothetical protein.
880	11	30	Os03g0390200|mRNA|AB125302|CDS+3'UTR	GAGATTGCCATCGCTGTGGATAAATAAGATGAATTTAATTGCATACTTAGTTATATTCTT	Os03g0390200	AB125302	Serine/threonine-protein kinase SAPK1 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 1).
881	11	31	Os07g0258000|mRNA|AK109782|CDS+3'UTR	ACTTTTACTGCAAGCTGAAGCCATTTTATAGAAATGGGGAGCTAGTAGTGATAATTTGGC	Os07g0258000	AK109782	Conserved hypothetical protein.
882	11	32	Os01g0207700|COMBINER_EST|Os01g0207700|8	CTGCACCACCCGCTGCAGAGAGCAGCAGCAGCAGTGACAATGAGAGCAAACACCAGCAGG	Os01g0207700		Protein of unknown function DUF6, transmembrane domain containing protein.
883	11	33	Os04g0385600|COMBINER_EST|CI195643|6	CTGTACATGGGACCTTGAAACGAGCGAACGAACACTGAGGTAAAAAAGGTAAAGCAAGTC	Os04g0385600	CI195643	Zinc finger, MYND-type domain containing protein.
884	11	34	Os02g0218400|mRNA|AK068947|CDS+3'UTR	TGATGAGCAGCCTTTGGTTCTCAGATCATGTTTTGCGCATCTTTGTCATCGCCAGAGAAA	Os02g0218400	AK068947	UspA domain containing protein.
885	11	35	Os02g0524500|COMBINER_EST|CI250458|6	ATCTACTAGATTAATTGTCTTAAGACAGACCAGTAATACAAGCTGTTCATACTTACTCCC	Os02g0524500	CI250458	Zinc finger, RING-type domain containing protein.
886	11	36	Os07g0684100|mRNA|AK104552|CDS+3'UTR	CTGACGGACCTGTATGCGTGATGCACGTCTGCATCGAAAATTGAACATGCTAGATTCATT	Os07g0684100	AK104552	Similar to Thioredoxin-like 1.
887	11	37	Os04g0471300|mRNA|AK069769|CDS+3'UTR	TCGATACGGTTGACTAGCTGATTGCAGGTTGTGATGTACAGCTGAATTACGAAAACTCAT	Os04g0471300	AK069769	Conserved hypothetical protein.
888	11	38	Os06g0139700|mRNA|AK106116|CDS+3'UTR	TTATGAAAACTACCGTATGTGTTGGAACATCAATCAGAAAATAGGGTCCTGTCTTGTGGA	Os06g0139700	AK106116	Conserved hypothetical protein.
889	11	39	Os04g0435500|mRNA|AK060125|CDS+3'UTR	CATGTCTTGAGTACCTTGTATTCTGTTCTATTTTCTGCTATCAAAAGGGGTAATTTTCAC	Os04g0435500	AK060125	Glutathione S-transferase, N-terminal domain containing protein.
890	11	40	Os12g0501900|mRNA|AK108423|CDS+3'UTR	TTAGCACGTTTCAGACCAGACAATGTACAGTCTGAGAGTTAAATGAGTACAAAATGGATA	Os12g0501900	AK108423	Conserved hypothetical protein.
891	11	41	Os06g0195900|mRNA|AK101986|CDS+3'UTR	TGGCTAGTATTAATAGAGTGGTTTAATTTCGTCGAATGGTACTCACTACCATCAATATCT	Os06g0195900	AK101986	NOG, C-terminal domain containing protein.
892	11	42	Os01g0708100|mRNA|AK101457|CDS+3'UTR	CATTCAGCTTGTATGGTTAAAAGCATGTATGATGGCACTGGTTTACCAAGAAATTTTGAT	Os01g0708100	AK101457	Similar to N-myristoyl transferase (EC 2.3.1.97).
893	11	43	Os09g0555800|COMBINER_EST|CI218546|6	ATAGCGCTGCAATATGGTCATAGTGTATATTATCATCGTTGATAATAAATGAACTAGTGA	Os09g0555800	CI218546	Similar to AMP-binding protein (Adenosine monophosphate binding protein 6 AMPBP6).
894	11	44	Os10g0508500|COMBINER_EST|Os10g0508500|8	CCGAAGAGAGAAATGCTGCTTCAACTGACGAGAACAAATCTTACTCTTCTTTGGTTGATT	Os10g0508500		Similar to Tubulin folding cofactor D.
895	11	45	Os10g0464300|COMBINER_EST|CI469962|1	GCAAATTTGCTGCTTTTTAATAATGGAATAAATATCCCCACCGCTGCACTTTAAGGATGC	Os10g0464300	CI469962	AWPM-19-like family protein.
896	11	46	Os03g0429800|mRNA|AK073276|CDS+3'UTR	TTTCCTCTTCTTTTTTACCCCCCAGGAAGAAAACACTAGAAATAAAAGCAATGTTCACAT	Os03g0429800	AK073276	Similar to Xanthine dehydrogenase 1 (EC 1.1.1.204).
897	11	47	Os05g0376200|COMBINER_EST|CI227069|6	TCTGCCTGTTAATAACTCCCAAGGACTAATAAAGATCTCATCTTCCCCAAGGAAGATTGC	Os05g0376200	CI227069	Similar to Cell division control protein 48 homolog B (AtCDC48b).
898	11	48	Os06g0678700|mRNA|AK107560|CDS+3'UTR	AGTTGGATTCTTGACTGCTATTCAGATTTGGAAATGTCAACAATCTGCAATTTTTGTGCG	Os06g0678700	AK107560	Hypothetical protein.
899	11	49	Os06g0538900|mRNA|AK122046|CDS+3'UTR	GTCTCCAGTGTGTCTGTCCATGGATGATGCTGAAATAAATATATGTTCTTGTGGATTCCT	Os06g0538900	AK122046	Protein of unknown function DUF538 family protein.
900	11	50	Os07g0615400|mRNA|AK119233|CDS+3'UTR	ATATGTGTGTGAAGGATGTAAGCTGACAATTTTATATAATCTTAGTCTAATGTTATTGCT	Os07g0615400	AK119233	Similar to Oligouridylate binding protein.
901	11	51	Os04g0648200|mRNA|AK110734|CDS+3'UTR	CAAGCTTCCGAATGTAGAGCTTCAGATTTTTTAATACTTACTTTGTCCTATTTTAAGCGC	Os04g0648200	AK110734	Leucine-rich repeat, plant specific containing protein.
902	11	52	Os07g0471200|mRNA|AK111455|CDS+3'UTR	AAGCGGGCGCGCTTTCCTAAAGAGCGAAAAGACCTTCCAAGTTCCAAATAAGTTTCTTTC	Os07g0471200	AK111455	Conserved hypothetical protein.
903	11	53	Os09g0281800|mRNA|AK105291|CDS+3'UTR	AAATGTGTGTTTTACACATTGTGTAATAGAGAACTACTATTTACTTATATAGTTAGTACT	Os09g0281800	AK105291	Conserved hypothetical protein.
904	11	54	Os06g0133900|mRNA|AF413082|CDS+3'UTR	TAAGCACTTTCGTCAGGAACTGAACTGAGCTTTTAAAAGAGTGAGGTCTAGGTTCTGTTG	Os06g0133900	AF413082	Similar to 5-enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19) (Fragment).
905	11	55	Os02g0186300|COMBINER_EST|Os02g0186300|8	TGCCGCAAACTCAAACTTCTTCTGCACTTCTATTTTGTGAGAGAGCTCAAACTTCTTCTG	Os02g0186300		Cytochrome P450 family protein.
906	11	56	Os11g0163500|mRNA|AK101154|CDS+3'UTR	TATCTCCTGATTCTCTCTACTTGTAAAATTTCCATGTGATACTGGGCTCCATCTGTATTC	Os11g0163500	AK101154	Homeodomain-like containing protein.
907	11	57	osa-miR159a|Os01|5'seq	GTTGTGGACGTTGAGCTCCTTTCGGTCCAAAAAGGGGTGTTGCTGTGGGTCGATTGAGCT			miRNA
908	11	58	Os07g0536400|COMBINER|CI135251|6	GGTATTGAAAGTTGGAGGGGGTGAAATATCTGGTTTTAAAGTTTGGGTGTATTTTAGACA	Os07g0536400	CI135251	(No Hit)
909	11	59	Os04g0691600|mRNA|AK099298|CDS+3'UTR	TCCCCAGCAGCAATGCTATGTTCCCTTTTCATTTCATCTGCTCATATGCATGTTGTTACT	Os04g0691600	AK099298	Similar to 30S ribosomal protein S17.
910	11	60	Os10g0538500|COMBINER|CI273660|6	CGGACATTCCTCAAACAAATATATGAGCCTGTATATACCGTACTGTTTAATGGTCATCTC	Os10g0538500	CI273660	(No Hit)
911	11	61	Os01g0851400|COMBINER_EST|CI433650|0	GAAGCAGAACACTACCTCTTTAGAGGGAAAAGAATCTATAAAAGAAGATTAGGACGGCAT	Os01g0851400	CI433650	Machado-Joseph disease protein MJD family protein.
912	11	62	POsControl0031|random		
913	11	63	Os10g0329300|mRNA|AK070755|CDS+3'UTR	AACTGTTGTACGAGGGAAAGTGCTATGGTAGATGTGACTACTACCTCCAAATTTATCTAT	Os10g0329300	AK070755	Similar to Mevalonate kinase (EC 2.7.1.36) (MK).
914	11	64	Os10g0167900|COMBINER_EST|Os10g0167900|8	CAGGGATCACAATTGAGACAATTGTTATGCGCAACCCATTGGCACGTGGTCTTAAGCAAA	Os10g0167900		Similar to Chalcone synthase J (EC 2.3.1.74) (Naringenin-chalcone synthase J).
915	11	65	ETG05_66023		
916	11	66	Os04g0469800|mRNA|AK106528|CDS+3'UTR	CTTCACCCTGTAACATCCTCCACTGTTTCAACTTTCATCTGCTATTCTATAGAAGAAAAA	Os04g0469800	AK106528	Cytochrome P450 724B1 (EC 1.14.-.-) (OsDWARF11) (Dwarf protein 11).
917	11	67	Os07g0633300|COMBINER|CI005252|6	CTTATTTTGCTGTGGATTCTGTAGAAAACGTTTTGATATGGTTGCCCGGTGGATGGGGAT	Os07g0633300	CI005252	(No Hit)
918	11	68	Os03g0795400|COMBINER_EST|CI003019|6	CCAACGGATTGCAAGGCCTAAACGCCTTGTGTGTAATGCTCATGGAAGTTACTAGAGAAA	Os03g0795400	CI003019	Protein prenyltransferase domain containing protein.
919	11	69	Os11g0495200|COMBINER_EST|Os11g0495200|8	GCCTTGATCAAGCAGCACTTTGTAACAGACCTGAATTGAACCTCATCCAAAAACATGCAT	Os11g0495200		En/Spm-like transposon proteins family protein.
920	11	70	Os01g0386600|COMBINER|CI212549|6	TTCTCGCCTGCATCGGCATCGCCAACCTCGTCTTCTACGTGGTCGTCGCTAACAGATACT	Os01g0386600	CI212549	TGF-beta receptor, type I/II extracellular region family protein.
921	11	71	Os02g0612600|mRNA|AK062519|CDS+3'UTR	ACATGTGGGTCCCGTGGGTTTTATTATTTTTTCAGATTGAATTACCACGTAAGCGCCGCG	Os02g0612600	AK062519	Conserved hypothetical protein.
922	11	72	Os08g0122400|mRNA|AK071781|CDS+3'UTR	TTACCAATGTTACCAGAAACAATTGTTATCTTTATTTGATTAAATATATCCGGCTGTGCT	Os08g0122400	AK071781	Conserved hypothetical protein.
923	11	73	Os08g0216300|mRNA|AK064284|UTR	GGACCCTATTATGTACCAGATACTTGTTGTACTTAACCCCTTTTTATGCACTTGTGATGA	Os08g0216300	AK064284	Non-protein coding transcript, putative npRNA.
924	11	74	Os01g0769900|mRNA|AK065563|CDS+3'UTR	ATTAGCATGGTTAGACAGCAAATACTAAATCAGGTATTCAGTTATACTTGGAGTATCCTG	Os01g0769900	AK065563	Conserved hypothetical protein.
925	11	75	Os02g0780800|COMBINER_EST|CI081363|6	ATGAGTGATGACATCACTGTTGTACGTACTGCATACAACATCCTACCGGATGAATTTTTC	Os02g0780800	CI081363	ATP-dependent DNA helicase RecQ family protein.
926	11	76	Os12g0270900|mRNA|AK071840|CDS+3'UTR	CAGAAGCAAACTGATGACCTACTTGATGTATAAGCAAACATATTGGCAGAAAATATGTAC	Os12g0270900	AK071840	Sulfotransferase family protein.
927	11	77	Os09g0545400|mRNA|AK064274|CDS+3'UTR	TCAAGGCTGTATTTTGCTATTGCCTGACAATTTGCTTGGTCATCCAGGACAGGGTATCAC	Os09g0545400	AK064274	Similar to Auxin induced protein.
928	11	78	Os01g0880800|mRNA|AK120809|CDS+3'UTR	ATGGTGCTTTGATCTTGGAAATTTGGCGTTGATGTATTTTCTGGTATCATTAGTGAAGAT	Os01g0880800	AK120809	Similar to Acyl-[acyl-carrier-protein] desaturase, chloroplast precursor (EC 1.14.19.2) (Stearoyl-ACP desaturase).
929	11	79	osa-miR390|Os03|3'seq	ATAGCGCCTCGAAATCAAACTAGGCGCTATCTATCCTGAGCTCCATGGTTTGTTCTTACC			miRNA
930	11	80	DarkCorner		
931	11	81	DarkCorner		
932	11	82	DarkCorner		
933	11	83	DarkCorner		
934	11	84	DarkCorner		
935	11	85	DarkCorner		
936	12	1	DarkCorner		
937	12	2	DarkCorner		
938	12	3	DarkCorner		
939	12	4	DarkCorner		
940	12	5	DarkCorner		
941	12	6	Os12g0592500|mRNA|AK073068|CDS+3'UTR	GTTGAAGAAATGGCTTGGTGCTGACATGTGTGTTTTGATTTTATTTGATTGTGCACTGTC	Os12g0592500	AK073068	Cyclin-like F-box domain containing protein.
942	12	7	Os04g0451000|mRNA|AK110238|CDS+3'UTR	ACTGCTGTCACTTGTGTAATAAGTTGGAAACATTGGCAGTGAAGCTCTGGATGTTTTGAG	Os04g0451000	AK110238	Conserved hypothetical protein.
943	12	8	Os11g0701000|mRNA|AB027424|CDS+3'UTR	GCAGTAATCACGGTGTCATGGGTTTAATGTAGTAAACTACCCCCACTTAATTACATGTTG	Os11g0701000	AB027424	Class III chitinase homologue (OsChib3H-c).
944	12	9	Os07g0231700|COMBINER_EST|AU082505|7	AGGATGCGGGTGCGGATGTGGATGCACAGTTGCCGGCGCGTCGGGTGGCGGCGGCGGCGG	Os07g0231700	AU082505	Conserved hypothetical protein.
945	12	10	Os04g0468100|COMBINER_EST|Os04g0468100|8	CTCGCCGGCATCGCCGCCCGAGCTCCGTAGCACCCGCTCGTCGCCGGCCTCGCTCGGCGT	Os04g0468100		Atrophin family protein.
946	12	11	Os11g0264200|mRNA|AK100912|CDS+3'UTR	GATGAAATGTAAACAAAGAAAATCCTGAACTTGTTGACCAATCGAAGTTGTTGACGAATG	Os11g0264200	AK100912	Cyclin-like F-box domain containing protein.
947	12	12	Os01g0706500|COMBINER_EST|Os01g0706500|8	CACTTGCAAGGCTGAGCGCAGTCTACCGCAGCCTCCAGGTTGCCAAATCTGGTGTCAAAA	Os01g0706500		Ribosomal L28e protein family protein.
948	12	13	Os10g0459600|mRNA|AK110989|CDS+3'UTR	CCAATTAAATTTGACCTTCATGTTTGTGAAGTGATCTATCACAAATTAAATTATCTTGTT	Os10g0459600	AK110989	Similar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein).
949	12	14	Os04g0673300|mRNA|AK059734|CDS+3'UTR	AACTGTTTCAAGATCGGTCAGAGTTTTGACATTAATTTAAGTCTTGCCAATTAACCATGC	Os04g0673300	AK059734	Similar to ZmRR2 protein (Response regulator 2).
950	12	15	Os01g0955700|COMBINER_EST|AU075970|7	AGCGAGATGGTATGTTTACCTCTGTGAAAAAGTGTGACCGTCTGTTTTGTTGCTACCTGT	Os01g0955700	AU075970	Conserved hypothetical protein.
951	12	16	osa-miR413|Os12|5'seq	ACGGCTAGTTTCACTTGTTCTGCACATGTGGAAAACAGTTAGCACTCTATCTGAGTCGTA			miRNA
952	12	17	Os03g0305500|mRNA|AK070233|CDS+3'UTR	ATGCACTTGTATTGGGAACCATTGTTCTGCTGAAGTATTGATCTGAATAAAAGATGTGCT	Os03g0305500	AK070233	Argininosuccinate lyase domain containing protein.
953	12	18	Os05g0208000|mRNA|AK063666|5'UTR+CDS	CAAGGGTTTGTCAGCTGGTTTACTAAGGCAGGCGACATATACTACTGCTCGTCTTGGATC	Os05g0208000	AK063666	Similar to 2-oxoglutarate/malate translocator.
954	12	19	Os03g0811700|mRNA|AK059288|CDS+3'UTR	TAGGCCCCTTGAGTTGATATGCAATTATGTGCTCAGAATTAAGTTGTGGCTTTGCACCTC	Os03g0811700	AK059288	Similar to Pre-mRNA branch site protein p14 (SF3B 14 kDa subunit).
955	12	20	Os01g0810000|mRNA|AK102143|CDS+3'UTR	GATGATGTGAATGGCTTACAATGGAATCATTGAGAATATATGGAGTAACCAGTAGATCCT	Os01g0810000	AK102143	Utp11 family protein.
956	12	21	Os04g0601500|COMBINER_EST|CI240262|6	ATTTGTAAAGTAACGCAAGAGAGTAGTTTCGCAGGCCTGATCTGCAATTGAAATGCTGGC	Os04g0601500	CI240262	Conserved hypothetical protein.
957	12	22	Os04g0132300|mRNA|AK121974|CDS+3'UTR	TATTTACCGAGCCTTTTATCTTCTGCAGCGAACGGCAGTTTTCTCTATGGTTTGTTCTAG	Os04g0132300	AK121974	AAR2 family protein.
958	12	23	Os09g0125700|COMBINER|CI529264|x	TTCCCACCTATTTCAGATGTGCAAATGTCCAAGTGTGTACTCATAGAAAAATAGGAAGGC	Os09g0125700	CI529264	(No Hit)
959	12	24	Os03g0235000|mRNA|AK103019|CDS+3'UTR	GACAAACGCGCTGTGTCTATCAGAGTAAAAGAAAGAATATGCAACTGCCATATGGTTTTA	Os03g0235000	AK103019	Peroxidase (EC 1.11.1.7).
960	12	25	Os12g0189300|mRNA|AK068710|CDS+3'UTR	AATTCTCCTGCATTATTGGTGAATTTTGTGAGGTATGTGTTATTATTGCATGGTACGTAG	Os12g0189300	AK068710	Isocitrate lyase and phosphorylmutase family protein.
961	12	26	Os06g0229200|mRNA|AK070606|CDS+3'UTR	TGACAACTACTCATTGTACAATCCACTTCCTATCCACGGCATACCTGAACTTTTTCTTTG	Os06g0229200	AK070606	Glycosyl transferase, family 31 protein.
962	12	27	Os01g0733500|mRNA|AK065358|CDS+3'UTR	GGGCTTGCTGTTTGATGTATAGTTTTAGTATGCGGGTGCAATAAACAGACAAGTATTTAC	Os01g0733500	AK065358	Similar to Dehydration-induced protein RD22-like protein 1.
963	12	28	Os10g0495300|mRNA|AK103856|CDS+3'UTR	TAATGTTGAATATGATATATACAGGCCACGCGCCTGCAATCCCCATTAATATGTGCCATT	Os10g0495300	AK103856	BRO1 domain containing protein.
964	12	29	Os01g0109700|mRNA|AY224549|CDS	AGCAACTAAGCGTGTCGAAGAGTTGATAGAAAAGATGCAAGACAACTCCCTAAAACCAGA	Os01g0109700	AY224549	Similar to Paired amphipathic helix protein SIN3.
965	12	30	Os04g0462400|COMBINER_EST|CI191134|6	TGTGCACCAGATGTAATAGACCTTGCTGACACACGGTTTCGCAATCCTCATGCTGAATAA	Os04g0462400	CI191134	Amino acid/polyamine transporter II family protein.
966	12	31	Os07g0546000|mRNA|AK065871|CDS+3'UTR	AGAACAATAGCATGTTCCATGTTTATTTGCTACATATATGATGATGATGATGCCATTCCC	Os07g0546000	AK065871	Similar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment).
967	12	32	Os07g0112700|mRNA|AK073121|CDS+3'UTR	GTGTTGCAAAGATCTACCATTAGGTAGCAAGTGTGAATTAAGAAGAGTACATTTTTTACC	Os07g0112700	AK073121	Cupredoxin domain containing protein.
968	12	33	Os03g0698400|mRNA|AK058933|UTR	TGGTATACACCATTCTTTTTGGTTAACCATTTTGCTACCAGGCTTTTCATTTTGATTAGC	Os03g0698400	AK058933	Non-protein coding transcript, unclassifiable transcript.
969	12	34	Os01g0606400|mRNA|AK070799|CDS+3'UTR	AGGAAGAGCATGAAAATGGCGCTGCACTTCATGTTGTGTGGTTTGCGAAGTTTGTGGTAT	Os01g0606400	AK070799	Conserved hypothetical protein.
970	12	35	Os03g0245700|mRNA|AK111566|CDS+3'UTR	GAGGACATCACAACATGCCATACTACATATGACTAGAGAACAATATTGCCAAGTGTAAAT	Os03g0245700	AK111566	Very-long-chain 3-ketoacyl-CoA synthase family protein.
971	12	36	Os01g0646800|mRNA|AK101336|5'UTR+CDS	CCTTTGCAAACATGAGTTCGGGCGTGTACACTTTTCGGGCTCATGGTCAGATATATCATA	Os01g0646800	AK101336	Conserved hypothetical protein.
972	12	37	Os05g0337000|COMBINER|CI415840|6	GCCTATAAATAGAGAGATGGATGCAAGGGTGGAGGTTGCTTCTTTGGCAATCCTTTTGAG	Os05g0337000	CI415840	(No Hit)
973	12	38	Os04g0671100|COMBINER_EST|CI421822|6	TGCTTGTTGAAAGCAACACAAGGCAAGCCTTGTGATGACAGTAATATTTTCCTTGCAACT	Os04g0671100	CI421822	Hypothetical protein.
974	12	39	Os04g0521900|mRNA|AK105173|CDS+3'UTR	TCAGTTCCAGTTCGGTTTTTGTATGTTGGATGTTGTACAGTGATCATTGAGTAATACAGT	Os04g0521900	AK105173	Conserved hypothetical protein.
975	12	40	Os07g0563400|mRNA|AK106307|CDS+3'UTR	AGTGAAGAAAAGAACAACCCAATTTCTATTGGGGTCTTGTGTATTAAATATTAATTAGCC	Os07g0563400	AK106307	Protein of unknown function DUF761, plant family protein.
976	12	41	Os01g0858700|mRNA|AK119765|CDS+3'UTR	GTAATAGGTGGTAGGGGGTAGAGGTAGAGTCGGACTCTATAACCTAGCAACTCTCTTAAA	Os01g0858700	AK119765	Conserved hypothetical protein.
977	12	42	Os09g0462700|mRNA|AK060597|CDS+3'UTR	ACCTGGAGCTGCACCTTATTGAAGTAGAACAATAAACTATTCAAATACCTACTGTGCGCT	Os09g0462700	AK060597	Similar to RNA Binding Protein 47.
978	12	43	Os07g0224000|COMBINER_EST|C98364|6	TTGCACCATCAGTTGTCCTGAGTACCATACAAATGGAGAACTTAGTTTGAAGCATTTTTG	Os07g0224000	C98364	Ribosomal protein L24E family protein.
979	12	44	Os08g0533600|mRNA|AK098885|CDS+3'UTR	TCTGAAAACGCCATTGCTTCTTCAGCATCATACACTTAGGTTAAGGTTAACTTGCATTGT	Os08g0533600	AK098885	Similar to ACR4.
980	12	45	Os06g0477400|mRNA|AK071157|CDS+3'UTR	ACGATCCGGTGGTGGTGGGGGATTGGTTTTTTGTGGTGGCGGAGAATTCTCTCTCCGCTA	Os06g0477400	AK071157	Non-protein coding transcript, unclassifiable transcript.
981	12	46	Os10g0529500|COMBINER_EST|CI555732|0	ACGGAGGACAGCTGTGGATTAGATTGTTCAGTATTTTCACTCGCTGTGGTCGTTATCTGT	Os10g0529500	CI555732	Similar to Glutathione-S-transferase 2.
982	12	47	Os12g0629600|COMBINER_EST|Os12g0629600|8	AACGTACCCGCCGGGACAAGCTCCGGCAGGTGCACGCTCTCCGGGCAGCCGCCGCTGACG	Os12g0629600		Similar to Thaumatin-like protein precursor.
983	12	48	Os03g0126300|mRNA|AK100841|CDS+3'UTR	AATGATGATGCTCGATGGCATGATCTTGTTGTGCTAACTTGTTGGGTTACTTGATGGAAA	Os03g0126300	AK100841	SAM (and some other nucleotide) binding motif domain containing protein.
984	12	49	Os01g0652800|mRNA|AK058693|CDS+3'UTR	GTTTTGACAAGGATTTATTCGAACTTCCCCAATAGATTCTTTTTTTCTCTCTCTTTTCCC	Os01g0652800	AK058693	Protein of unknown function DUF231, plant domain containing protein.
985	12	50	Os06g0152000|COMBINER_EST|CI561643|0	TCGCAGGGGAAGGAATTCAGTTGCGTTGCCATCGTTCTAAATGTATATAGCTGCCCATAT	Os06g0152000	CI561643	Conserved hypothetical protein.
986	12	51	Os01g0191200|mRNA|AK060964|CDS+3'UTR	TTGGTGAGACGATTGAAATATCTTTGGGTTTATCTTTTATAATTGGTTTTACCGTGAATT	Os01g0191200	AK060964	Similar to Acid phosphatase.
987	12	52	Os09g0373800|COMBINER_EST|Os09g0373800|8	AAAGAAGAAAGAGTTTGGTAAAGAAATGCTAATCCTATCCCAGACCAACCACAAAAACAT	Os09g0373800		EGF-like calcium-binding domain containing protein.
988	12	53	Os01g0651500|COMBINER_EST|Os01g0651500|8	CGATGCTGCAGTTGATCATGGGCGTCTCGAGGCGTCTGCTCCGACCGTTTGGGGTGGTTT	Os01g0651500		Conserved hypothetical protein.
989	12	54	Os12g0595800|mRNA|AK072425|CDS+3'UTR	AACGTTTGCTGTATAGCTAAAGTTGGACTAGCACAGAAACAAAAATTTCAAGTTGATAGT	Os12g0595800	AK072425	Protein kinase-like domain containing protein.
990	12	55	Os07g0669600|mRNA|AK066595|CDS+3'UTR	CAAAACCTGTGAAATCCAGTGCTGCAAAACTGAATTATGGGTGCTGGCTTGCTGTTTCCT	Os07g0669600	AK066595	Conserved hypothetical protein.
991	12	56	Os09g0474000|mRNA|AK108319|CDS+3'UTR	ACTGCCCATTATTGACATCTTTTTGTCAAGGTGGCTAAGATAAATATGGATTGAGCCTAT	Os09g0474000	AK108319	Eukaryotic transcription factor, DNA-binding domain containing protein.
992	12	57	Os02g0773500|mRNA|AK062694|CDS+3'UTR	ACAGCACTTTGTTCGATTAAACCATGAAATACTCAGTAAAGTGGTTTAAGACTTGTAGTC	Os02g0773500	AK062694	Conserved hypothetical protein.
993	12	58	Os02g0829900|mRNA|AY224582|CDS	GCGGAAACTGGAGGTGCTTGAGGTTCAAGTGAGCAGCGCAACAACCAATCCATCCGTTTT	Os02g0829900	AY224582	Similar to BRICK1.
994	12	59	Os03g0329200|mRNA|AK064318|CDS+3'UTR	AACAACTACTCGTATATTATACTGATTCTGTGGTTAATCCTGGAGGCAAGTGCCTGCCAC	Os03g0329200	AK064318	Zinc finger, CCCH-type domain containing protein.
995	12	60	Os02g0709200|mRNA|AK099074|CDS+3'UTR	TGATTGTTCGAAGCAAGAATTTGTACTGCCGTGCCCTGATTGGAATAAATATGAGCGTAA	Os02g0709200	AK099074	Similar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase).
996	12	61	Os11g0629400|mRNA|AK099444|CDS+3'UTR	ATGCTCAGATGGTGTTAATTCTTCGAGTTAGTATGCTTGGAATGCAGTTGTAACTTGTAA	Os11g0629400	AK099444	Similar to Nitrilase associated protein-like.
997	12	62	Os01g0213800|mRNA|AB071805|CDS+3'UTR	GTTCAGGAGCAGTTGCTACTAGACCGATGTTGTTCTCAAAACTGATAAGTGGGATGGTGA	Os01g0213800	AB071805	Transcription factor PCF5.
998	12	63	Os07g0499500|mRNA|AK108797|CDS+3'UTR	TTGGCTTCTTGGTAATTTCCTCAAGAGAAAAAAAATGCTTGTGTTTTGGAGCTTAATCCA	Os07g0499500	AK108797	Similar to Peroxidase 7 precursor (EC 1.11.1.7) (Atperox P7) (ATP30).
999	12	64	Os05g0562800|mRNA|AK064046|CDS+3'UTR	GACACGAACGAACACACTGTAAAGCTGATCACGGCCCCAATGGGCTCGCAAGGAGTCGAT	Os05g0562800	AK064046	Protein of unknown function DUF679 family protein.
1000	12	65	Os03g0784900|mRNA|AK099097|CDS+3'UTR	AATCAGTTGTATCTGGTTTCGACCTGTTAAATAAGCTTCAGTCTATGCGAATCAGCTCAG	Os03g0784900	AK099097	Conserved hypothetical protein.
1001	12	66	Os07g0673400|mRNA|AK073356|CDS+3'UTR	GATGATTTGTATGTGTTAGTTTCATAGGTTTTATCAGTTTATGTATCGAAATGTTTGTGC	Os07g0673400	AK073356	Universal stress protein (Usp) family protein.
1002	12	67	Os08g0380100|mRNA|AK103679|CDS+3'UTR	ACCAAATGTAAACAGTATATCCCGGAAATTTGGGGGAGTTGTGCGTAATTTGATTGTCTT	Os08g0380100	AK103679	Similar to Polygalacturonase isoenzyme 1 beta subunit (Fragment).
1003	12	68	Os01g0275600|mRNA|AK061675|CDS+3'UTR	GGATAACTACTGAACCTGTCCATCTTAATCGCAGCTTGTTCCATGCTCTGCTTTGCTGCC	Os01g0275600	AK061675	Similar to Argonaute 4 protein.
1004	12	69	POsControl0003|genome		
1005	12	70	Os01g0652800|mRNA|AK103547|CDS+3'UTR	CAGGATTGCTCTTGCTGTTGTTTCAAAGCAGTTTTGACAAGGATTTATTCGAACTTCCCC	Os01g0652800	AK103547	Protein of unknown function DUF231, plant domain containing protein.
1006	12	71	Os04g0107500|mRNA|AK067010|CDS+3'UTR	TCTTGTTGTTGTAACACACATCAGAGTAAACTCAATCAATACTCCATTCTTGTGGAGTAT	Os04g0107500	AK067010	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein.
1007	12	72	Os04g0456700|mRNA|AK065178|CDS+3'UTR	GGGTAATAAGATGAAACCAGCGTTGGATCGGTCGGACGATCCGGTGCTCACTCCAGTTGG	Os04g0456700	AK065178	Similar to TMV induced protein 1-2.
1008	12	73	Os02g0586800|mRNA|AK069595|CDS+3'UTR	ACTGCGTACACACACGGTGCACGCATCTACTGATCTTCCTAAAATAACTCTGCCAAAGTT	Os02g0586800	AK069595	Tetratricopeptide region domain containing protein.
1009	12	74	Os02g0681700|mRNA|AK106773|CDS+3'UTR	ACTTGCAACTCAGTTGTGCAGAAACTGCATATAGAACTATAGAAGCATCAAGCATTTCTG	Os02g0681700	AK106773	Protein kinase domain containing protein.
1010	12	75	Os01g0666400|COMBINER_EST|CI495248|6	AAATTGCGTAAAAAAAATTAAGATTAGGATATCTCAAAAACAAATAAAGCGAGTTTGATC	Os01g0666400	CI495248	Conserved hypothetical protein.
1011	12	76	Os02g0445600|mRNA|AK063150|CDS+3'UTR	CAACTTCCATAGATCGATCGCTCAAGTAAAAATATTGTGTTCCAGCCCAACGAAAAATAA	Os02g0445600	AK063150	Similar to Auxin-induced SAUR-like protein (Fragment).
1012	12	77	Os08g0192900|mRNA|AK103422|CDS+3'UTR	GATTGTACTGGACATCTAGCGATTAGTGTAATGCAAGGATTTCCTATTACATTGTTATAC	Os08g0192900	AK103422	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
1013	12	78	Os05g0247900|mRNA|AK071717|CDS+3'UTR	GTCTGGCGTTGTGGCAATGTTGTAACAGAGAGTGCAGGCTGTTAATACATCCCTTGATTA	Os05g0247900	AK071717	DEAD/DEAH box helicase, N-terminal domain containing protein.
1014	12	79	Os04g0531500|mRNA|AK102285|CDS+3'UTR	GGTCACTGTTCACTGCTGATTACCACAGTATATCCCCATATTAGTTTACCAATCAAGCAG	Os04g0531500	AK102285	Concanavalin A-like lectin/glucanase domain containing protein.
1015	12	80	DarkCorner		
1016	12	81	DarkCorner		
1017	12	82	DarkCorner		
1018	12	83	DarkCorner		
1019	12	84	DarkCorner		
1020	12	85	DarkCorner		
1021	13	1	DarkCorner		
1022	13	2	DarkCorner		
1023	13	3	DarkCorner		
1024	13	4	DarkCorner		
1025	13	5	DarkCorner		
1026	13	6	(+)E1A_r60_a97		
1027	13	7	Os05g0275600|mRNA|AK108098|CDS+3'UTR	ACGCTGATGCTTATGACCTATGTACTTTTGGTGGATGATTTTTGCTATATTTATTACCTT	Os05g0275600	AK108098	Conserved hypothetical protein.
1028	13	8	Os05g0148300|mRNA|AK062421|CDS+3'UTR	TTTGCTTTCCTTCATCATAAAACCGATGTATTTGTGCTGCCGGCATGAATGCAAGACAAT	Os05g0148300	AK062421	Ribosomal protein S27, mitochondrial family protein.
1029	13	9	Os08g0160500|mRNA|AK109812|CDS+3'UTR	CCTAATTAATCTCACCTCCTCTCACCATTAACTAACCACCATTTCTTAATTACTGCTACA	Os08g0160500	AK109812	Cellulose synthase family protein.
1030	13	10	Os02g0201800|mRNA|AK105703|UTR	TAGGTTCAGAGTGTACCGTCCATAATTGTGCACAACATTGTATACACGTTGGTAAAAAGT	Os02g0201800	AK105703	Non-protein coding transcript, unclassifiable transcript.
1031	13	11	Os03g0565200|mRNA|AK065884|CDS+3'UTR	TATAGAGGAGTACATATATGAACATAATAGAATAAGAAATCGAAATATCTTTAATTGAAA	Os03g0565200	AK065884	Haloacid dehalogenase-like hydrolase domain containing protein.
1032	13	12	Os01g0734800|mRNA|AK061830|CDS+3'UTR	TTTAAGAACTACTTGTGTACCTTATTTGTTGTTAATAAAGCAACGTACTAGAATGGCCGC	Os01g0734800	AK061830	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
1033	13	13	Os03g0720300|mRNA|AK120961|CDS+3'UTR	TGTGTAGCAGTGAATTGATCAGTGATGCTCCATCTCTACTCTGAACGTGCTACCTCCATT	Os03g0720300	AK120961	Similar to Glutamate decarboxylase isozyme 1 (EC 4.1.1.15).
1034	13	14	Os02g0461600|mRNA|AK064251|CDS+3'UTR	GAATGCCCTTTTGCAAGTCAAAATGCATTGGTTTAAGGGATGTTTTGTTCGCCCTGGTTT	Os02g0461600	AK064251	Conserved hypothetical protein.
1035	13	15	Os03g0307300|mRNA|AK112069|CDS+3'UTR	AATCAATGAGGACCCTGTAAGCCAGTGTAAACGAGGAACATGCCATCTGTGTATGACAGT	Os03g0307300	AK112069	Nicotianamine synthase 1 (EC 2.5.1.43) (S-adenosyl-L-methionine:S- adenosyl-L-methionine:S-adenosyl-methionine 3-amino-3- carboxypropyltransferase 1) (OsNAS1).
1036	13	16	Os05g0461400|mRNA|AK099763|CDS+3'UTR	AGGGATGGGGGAACTGTGAATTGTTAGATGCTGCCTGTAATAATATTGTTAAGATTTGGA	Os05g0461400	AK099763	Similar to Histone H2A.2.1.
1037	13	17	Os10g0551900|mRNA|AK102086|CDS+3'UTR	GAATGAGTTAACGAGTTTTGTAAAACCGATTTGTGCTTCATCAATGAAATATCTGTGGTG	Os10g0551900	AK102086	Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
1038	13	18	Os03g0743900|mRNA|AK099593|CDS+3'UTR	AATGGTATATGTGTATACTACTGGTCGCAAGGCCTAAACATTTGGGTTTGATTGGAAGCG	Os03g0743900	AK099593	Similar to ATP sulfurylase.
1039	13	19	Os06g0687400|mRNA|AK072400|CDS+3'UTR	TGTATCTTCTACCCTACAATGCACCAACTGTTTTTACTCATTTTTCATTCTTAAAATCCA	Os06g0687400	AK072400	Conserved hypothetical protein.
1040	13	20	Os02g0278400|mRNA|AK065204|CDS+3'UTR	ATCGGTTAGAGTGGGAGGGGAAATGAAGGAGAAATCTTTTTTGGATGACCATCCATTTAG	Os02g0278400	AK065204	Cytochrome P450 family protein.
1041	13	21	Os11g0461000|mRNA|AK106123|CDS+3'UTR	GTAATATTTTGGAAAACCTTAAGAACTCTCACTAGTACATAGATATCTATGACGGAGACC	Os11g0461000	AK106123	Peptidase S10, serine carboxypeptidase family protein.
1042	13	22	Os04g0401100|mRNA|AK061279|CDS+3'UTR	CATGTATTTAGAGAATGCTTTTATGTGATAATGTTAAGGAAATAAATAATTGAGCTTAGT	Os04g0401100	AK061279	Heavy metal transport/detoxification protein domain containing protein.
1043	13	23	Os09g0448100|mRNA|AK070628|CDS+3'UTR	TCAATTTTTCTTTCTAGCGGTATTGACCATGAAACGCAATAAGTATCATGTGAATTGTCC	Os09g0448100	AK070628	Cyclin-like F-box domain containing protein.
1044	13	24	Os07g0160300|mRNA|AK065685|CDS+3'UTR	ATTGTCTGGTTGTTTTCATGCCTGGAGATTTTTCTGTTGCATGACTTTGTTAGGAAACAT	Os07g0160300	AK065685	Conserved hypothetical protein.
1045	13	25	Os07g0201300|COMBINER_EST|Os07g0201300|8	GAGAGGAGATCAGGAGCGCTGGCATGAGGTGGCTGGGGCGAGGAGAGGTGGAAATATCTT	Os07g0201300		UDP-glucuronosyl/UDP-glucosyltransferase family protein.
1046	13	26	Os11g0143300|mRNA|AK120926|CDS+3'UTR	CGTAAAAGGGATACTAACATCTAGTTTACAAAATAGAATGGAATCCGTTAACGGATACTG	Os11g0143300	AK120926	Similar to Type-A response regulator.
1047	13	27	Os10g0466500|mRNA|AK069224|CDS+3'UTR	ATTTAGGCCTTTAGCAATCTGAGGGTGTAAAGGAAAAGGATATATTTGCAAATGTTTGAC	Os10g0466500	AK069224	CCT domain containing protein.
1048	13	28	Os10g0475900|mRNA|AK101853|CDS+3'UTR	TACTTTTGCTGTAAAAACTTTTGCTTGAACTGAAGGGGAGACACAGAAAGAACTGTGCAT	Os10g0475900	AK101853	Ubiquitin domain containing protein.
1049	13	29	Os03g0237900|COMBINER_EST|CI366039|6	CAGCCCGTCTATGCCCGACGACCGACATTGACACATTGTTGAGACTAAAATGTTGAAAAT	Os03g0237900	CI366039	Cyclin-like domain containing protein.
1050	13	30	Os02g0639100|COMBINER_EST|Os02g0639100|8	TTTTTTAGGTGGGAATGGGGAAGAGCCGGATTTGGCTACCCTCAAGCTCGTGGCACCCGA	Os02g0639100		Protein kinase-like domain containing protein.
1051	13	31	Os01g0169800|mRNA|AK061054|CDS+3'UTR	GTGTTTTATGGTTAAGAATGGCCTGCAATGTAGATCAGTGCCTGCGTGATTTCACATACG	Os01g0169800	AK061054	Allinase, C-terminal domain containing protein.
1052	13	32	Os01g0543200|COMBINER|CI276250|6	ACACTTCCCTGACATGCCAACGGGGGACAACGTGTTGAACACACCAGCATGGGGACTTCA	Os01g0543200	CI276250	(No Hit)
1053	13	33	Os02g0725500|COMBINER_EST|AU101104|6	TTTTTGTTAATTAGGGTGTTCCAATGTTTTGTCTAGGGTACTTAATTAAACCCTTATGGC	Os02g0725500	AU101104	Cupredoxin domain containing protein.
1054	13	34	Os06g0183100|mRNA|AK102959|CDS+3'UTR	GGAAGTATGGTTAGATCAAGATAAGAAGAAAATATAATGCTGTAATGTCAGCGCCTTTTC	Os06g0183100	AK102959	Similar to Two-component response regulator ARR14.
1055	13	35	Os01g0771300|mRNA|AK062308|CDS+3'UTR	TGGTTAGCCTCATGGCGTTTGTGTTTTTCTTGGAATATATAGTTTGAGATTTATGTTGTC	Os01g0771300	AK062308	Conserved hypothetical protein.
1056	13	36	Os04g0511600|mRNA|AK073609|CDS+3'UTR	TCCATGTGTTTTATTCATCAACTGGCATAAAAGGTCATTATCGATTGATTGCTTATCAGC	Os04g0511600	AK073609	Similar to RING-H2 finger protein ATL3G.
1057	13	37	Os03g0765800|COMBINER_EST|CI376312|2	TTCTCCTGTAGTCCTGTTGAGCTCGACATTGTTGTCATCAGTCCCAACTTCTCTGTACTT	Os03g0765800	CI376312	Conserved hypothetical protein.
1058	13	38	Os02g0531300|mRNA|AK068180|UTR	GTGACCCCAATCAATTATGTGAACAAGGGTCAAGTTTATTTTGGGTCTCAAACTTTCACT	Os02g0531300	AK068180	Conserved hypothetical protein.
1059	13	39	Os02g0702500|mRNA|AK066639|CDS+3'UTR	CTTCTTTTCGTTTTTGGTTTATTTGTTATACATCGAGCGGAGGCTTCTGCCTGCTGCAAA	Os02g0702500	AK066639	Protein kinase domain containing protein.
1060	13	40	Os03g0369100|mRNA|AK111061|CDS+3'UTR	TTCTGTGATTTGTGTGGACTGCAAAATTGGGAAAAACTGAGAATTAATAAAAACAGAAAC	Os03g0369100	AK111061	Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
1061	13	41	Os08g0465800|mRNA|AY428025|CDS+3'UTR	AAGCCATCTACGTACCATGGACTTCAGCTATTTGGTGGTTTGTTTTCAACTTTTCCATGT	Os08g0465800	AY428025	Glutamate decarboxylase (EC 4.1.1.15).
1062	13	42	Os01g0214800|mRNA|AK060120|CDS+3'UTR	CGTTTTGGTTTGTGTATTTCGTTTGTTGGTCCTTGGTAGAGAAAGAGAGAGTAGATGTAA	Os01g0214800	AK060120	Lipolytic enzyme, G-D-S-L family protein.
1063	13	43	Os12g0176200|mRNA|AK071874|CDS+3'UTR	TCTGTAATGAAGTTTTGATCTGTTCCTCTTGAAAGAAAGATGGAAAAGTGTGTTTCTTGG	Os12g0176200	AK071874	Similar to Nitrogen fixation like protein.
1064	13	44	Os10g0405100|mRNA|AK102358|CDS+3'UTR	ACTCCGATGTGTGTGTAACAGGGAACGTGATTCCGGCATTCTGACGCGATCATTATTTTT	Os10g0405100	AK102358	Similar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-).
1065	13	45	Os04g0514900|COMBINER|CI138407|6	CTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGG	Os04g0514900	CI138407	(No Hit)
1066	13	46	Os01g0580100|mRNA|AK069131|CDS+3'UTR	TATGTACTTGTCACCTAGGAGAATATTTGGAGATTTGACATCGCCATGAACGATTGGAGG	Os01g0580100	AK069131	Alg9-like mannosyltransferase family protein.
1067	13	47	Os11g0145500|COMBINER_EST|Os11g0145500|8	GCGGCGTCGCTGCCGGCGCTTGGTACTTCGAGGTCAAGGTCCTTCACCTCGGCAGCACCG	Os11g0145500		SPla/RYanodine receptor SPRY domain containing protein.
1068	13	48	Os01g0897200|mRNA|AK100403|CDS+3'UTR	TAGTCATTGGTCAGGGTCATCTGCGACTGCAATCTGCTGAATTATAATGGACAGTGGCAA	Os01g0897200	AK100403	Similar to Ribonuclease 2 precursor (EC 3.1.27.1).
1069	13	49	Os02g0119000|COMBINER_EST|Os02g0119000|8	AGGGCCCTTTGAGCTCTTGCACCATGATAAAGAAGCTCGAGAAAGTGAAGACAGCAAAAA	Os02g0119000		Similar to NBS-LRR disease resistance protein homologue (Fragment).
1070	13	50	Os09g0295000|mRNA|AK106741|CDS+3'UTR	TAGCATTCAAATTTTGTACTGTACAATAGAGAATATAACAAGAGTGTTGTACTTCCCATC	Os09g0295000	AK106741	No apical meristem (NAM) protein domain containing protein.
1071	13	51	Os05g0119500|COMBINER_EST|Os05g0119500|8	CTTGGCACAGCAAATGCAGGAAATGTGAAGATTGAAGAAGGTTATAAGCATGAGAAATAG	Os05g0119500		Hypothetical protein.
1072	13	52	Os07g0445600|mRNA|AK074000|CDS+3'UTR	AGGTGGCTTGTAATAGCTGTAAACCTGTTTTTGTTCATGGCACATACTACTATATTGTGG	Os07g0445600	AK074000	Conserved hypothetical protein.
1073	13	53	Os01g0600200|COMBINER_EST|CI042997|3	TCTTCCGTTGTATTCATGTTGAAATTATGGTCTTGTAACTTCAGGACAGAGGCACTGAAG	Os01g0600200	CI042997	Conserved hypothetical protein.
1074	13	54	Os10g0415100|mRNA|AK119782|CDS+3'UTR	GACATGTGCTAAGTATTAAGTATATTTATGATTTGGAATAGCGGCAACAGTTGAGGGAAA	Os10g0415100	AK119782	Amino acid/polyamine transporter II family protein.
1075	13	55	Os03g0718800|COMBINER_EST|CI255934|6	TTTGCCGTGGATGCATTCCACGGCTTCCAGGGGGTCAATGGTCACTAATAATGAATAATA	Os03g0718800	CI255934	Similar to Physical impedance induced protein.
1076	13	56	Os01g0727600|COMBINER|CI550945|x	TCCGTGCTGTAAAATGCAGTTCAGATCAGCTATTTTTCCTGGTTTCTTTTGCAAATTCTT	Os01g0727600	CI550945	Conserved hypothetical protein.
1077	13	57	Os09g0525400|mRNA|AK066238|CDS+3'UTR	GAAGCAGACATATCATAAACCACAGTCAGAAACTTTCCAGCAAAAAGGAAAAGGCTTATG	Os09g0525400	AK066238	Similar to RING finger protein 13 (C-RZF).
1078	13	58	Os08g0162100|mRNA|AK111915|CDS+3'UTR	TGTAAAATATGGTTGGCATGTTGGATGGTGGTATTTGTTTGGCCTAATGCGACTGATTCA	Os08g0162100	AK111915	Similar to CTV.2.
1079	13	59	Os04g0272400|mRNA|AK121455|CDS+3'UTR	CCCGACTATCCTTAATTCTCCCAAATTTGCCTCAAAATGAATATACCTCAAAATGAATAT	Os04g0272400	AK121455	Protein of unknown function DUF266, plant family protein.
1080	13	60	Os12g0134200|mRNA|AK105296|CDS+3'UTR	ATGTAATAGGATGAGCGTTTCATTACTGGTTGCATCCGAAGGAAATTCTGAAGCTTTGCA	Os12g0134200	AK105296	Armadillo-like helical domain containing protein.
1081	13	61	Os05g0592100|mRNA|AK071333|CDS+3'UTR	TGCTGCCTTCCTGCCAAGGTTGTTGTATTTTTCAGATAGAATTCACTAGTGGAGATGGTA	Os05g0592100	AK071333	Peptidase S14, ClpP family protein.
1082	13	62	Os06g0253600|COMBINER_EST|CI348737|6	CAATGCATGGTTGGTGACTGGTGAGTGGTGCCAATGTACTCATGTATATCATCATTGTTG	Os06g0253600	CI348737	Protein of unknown function DUF26 domain containing protein.
1083	13	63	Os09g0541000|mRNA|AK067792|CDS+3'UTR	GTGCAGCTTAATTATCTAGCCATGTACAAATTTTCGTATGCGGAATAATATAATGCATGC	Os09g0541000	AK067792	Similar to Plasma membrane intrinsic protein (Aquaporin).
1084	13	64	Os02g0119400|mRNA|AK102774|CDS+3'UTR	GCGTATTGCCTTTCTGTCGTAATCTTTTCACAAATTCTTATTCTTGCGAGACTTGAATTT	Os02g0119400	AK102774	Similar to Syntaxin 52 (AtSYP52).
1085	13	65	Os09g0381800|COMBINER|CI435330|x	TAACCGAAGAACATCTATCACGATTTCTCCGTTAATTGTTTTAGTCGGCATTAATTGCTT	Os09g0381800	CI435330	(No Hit)
1086	13	66	Os10g0463300|mRNA|AK109194|CDS+3'UTR	CTTCATTAATGCAGAAACAACGAATCGAGAAAAGCAAAATAAAGTGTTGTTTTGTTTTTT	Os10g0463300	AK109194	UspA domain containing protein.
1087	13	67	POsControl0039|art		
1088	13	68	Os03g0265700|mRNA|AK070221|CDS+3'UTR	GGGGTTTTACCTTTCGTGTGCTATTCTGGCCCGTCTGTTATGATTGAAAGACGCAGTTTA	Os03g0265700	AK070221	Src homology-3 domain containing protein.
1089	13	69	Os02g0177800|mRNA|AK065684|5'UTR+CDS	TATGCCATTGAATATGATGGTAAAGCTCTCTTGAACTCTAAACCGAAGAAAAAGGCTGCA	Os02g0177800	AK065684	Similar to Calmodulin-binding protein 60-B (Fragment).
1090	13	70	Os03g0287800|COMBINER_EST|Os03g0287800|8	GGTATGGCATGTCAACACGACGCCGCTACCTTCTTCGCAACCGTCTCCTCAGAACAAGAG	Os03g0287800		Glycosyl transferase, family 43 protein.
1091	13	71	Os10g0542700|COMBINER|CI259878|6	ATGTCAAATTTCGCATCTTTCATCCCTTCTCTCTGCATTGCCTATTTGCCTCTGCAAGAT	Os10g0542700	CI259878	Protein of unknown function DUF241, plant family protein.
1092	13	72	Os10g0183900|mRNA|AK072957|CDS+3'UTR	TTCTTTCTTTCTTAGTACGTCTTGAAAGGTGTGAAGGCACTGCGAGAATTTTGTTCTAAC	Os10g0183900	AK072957	Ribosomal RNA adenine methylase transferase family protein.
1093	13	73	Os10g0558800|COMBINER_EST|Os10g0558800|8	TCCTGCCGCTGCGGCAGCGCGGGCAGGGCGCCAGCGTCGGCACCGCCATGAACCGCGTCA	Os10g0558800		Major facilitator superfamily protein.
1094	13	74	Os07g0113200|mRNA|AK108787|CDS+3'UTR	TGCGTTATGTAAGCACACTAAACTATTGTAAACTATTGCTGTCCTGTCTTCGGCTGGAAT	Os07g0113200	AK108787	Conserved hypothetical protein.
1095	13	75	Os03g0797900|COMBINER_EST|Os03g0797900|8	GCGCGGCAGCGGCGGGGGACGGCGACGGCGGCGGGTGAGCAGGCCTGGTGCATATATGGA	Os03g0797900		Conserved hypothetical protein.
1096	13	76	Os04g0611400|mRNA|AK069344|CDS+3'UTR	CGGTGCACCGCAAAGTGCAGACTAGACAAGTATAGCTGCTGTAATGCAGATTTGTTAGAA	Os04g0611400	AK069344	Similar to Vacuolar sorting receptor 7 precursor (AtVSR7) (Epidermal growth factor receptor-like protein 3) (AtELP3) (BP80-like protein f) (AtBP80f).
1097	13	77	Os07g0463400|mRNA|AK067630|CDS+3'UTR	TGTGGAATTGGAGCTTTGTTAACAGCACATGCTGTCTCCTTAATATGCAGTAGACGTACA	Os07g0463400	AK067630	Similar to RES protein.
1098	13	78	Os01g0177100|mRNA|AK122062|CDS+3'UTR	CATCTCTGCTATGAATATGAAGAATGTGATGAATGTGGCATTCTCGTAGGAATTTCAAGG	Os01g0177100	AK122062	Similar to STYLOSA protein.
1099	13	79	Os03g0837300|mRNA|AK121140|CDS+3'UTR	GATGGACCGGTGTATTCGGCCTTGCTAAAGAAGGCCTACATAAACACTTTAACCTAGTGA	Os03g0837300	AK121140	Nicotinate phosphoribosyltransferase and related family protein.
1100	13	80	Os12g0574900|mRNA|AK102088|CDS+3'UTR	ATCCATTGCAAGTTCTCAAACCTGTATCAGGGAGATCTGGTTATTAGTAGTGCATTGTGT	Os12g0574900	AK102088	Asparagine synthase domain containing protein.
1101	13	81	DarkCorner		
1102	13	82	DarkCorner		
1103	13	83	DarkCorner		
1104	13	84	DarkCorner		
1105	13	85	DarkCorner		
1106	14	1	DarkCorner		
1107	14	2	DarkCorner		
1108	14	3	DarkCorner		
1109	14	4	DarkCorner		
1110	14	5	DarkCorner		
1111	14	6	Os04g0689500|mRNA|AK060983|CDS+3'UTR	AATTCGTTGCAGATTGATGAGATCGATCGATCAGGTGGCAGAAAATGAAATACACAGAGC	Os04g0689500	AK060983	Conserved hypothetical protein.
1112	14	7	Os05g0397300|mRNA|AK062621|CDS+3'UTR	GCACAAGGCGGTACGGGGCCAAGCGGCGCCGGCGAAGAAACAATCCTCTCAAAAATGAAG	Os05g0397300	AK062621	Conserved hypothetical protein.
1113	14	8	Os03g0636600|mRNA|AK069223|CDS+3'UTR	TCATGTTCGCTGTTGTGATTCTCAATATAGCTACTCCTATCAAATCAATATACTGTTCTG	Os03g0636600	AK069223	Expressed protein.
1114	14	9	Os02g0138200|mRNA|AK062066|CDS+3'UTR	CTGTTAAGAATGATCTGTCTTTGTTTGTGAAGCACAATGCTATGTACGAGTTTTGTTCAA	Os02g0138200	AK062066	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
1115	14	10	Os03g0187100|COMBINER_EST|AU108624|6	GCGTTACAACACAATTTTGCAGGTAGATTGGCAATGTGACCAGGTGGTTCCCTTTGTAGA	Os03g0187100	AU108624	Hypothetical protein.
1116	14	11	Os03g0101600|mRNA|AK069374|CDS+3'UTR	ATGTGTGTCTGCGTGCGTTTCGTTGTGGTTTTCATGTTGACAGGACAGGACGTATACTAT	Os03g0101600	AK069374	Similar to Quinone oxidoreductase.
1117	14	12	Os09g0555700|mRNA|AK061264|CDS+3'UTR	ATGGATTGATTCGTTCACGATCTAAGTTAATTAATTCGAGTAATTGATCCATATCTTTGC	Os09g0555700	AK061264	Zinc finger, C2H2-type domain containing protein.
1118	14	13	Os06g0102300|mRNA|AK071958|CDS+3'UTR	GACAACTGACAACTAGCGGGGAGGCACACGCTAATTGTGCGGCTGGTGTCCTTGCAAAAG	Os06g0102300	AK071958	Similar to Phytochelatin synthase.
1119	14	14	Os08g0509600|mRNA|AK107191|CDS+3'UTR	TTGCTGTGCCGCATCCATCTATGTAACTCTCCATGAATTTTTAAGTATCAGTGTTAATGC	Os08g0509600	AK107191	Similar to Squamosa-promoter binding-like protein 8.
1120	14	15	Os01g0696900|mRNA|AK060038|CDS+3'UTR	AGCTGGAGCTGGTGGGGTATAGAAGCGGGAGCATGAGAGCAAGCGCTCCCAATTTGGTAT	Os01g0696900	AK060038	Conserved hypothetical protein.
1121	14	16	Os05g0372100|mRNA|AK102474|CDS+3'UTR	GCATTTTACCTGTGTTTCATACACCTGTCATTTGACAATTTCATGTCGGAGTTATCTGTT	Os05g0372100	AK102474	Similar to Receptor protein kinase-like protein.
1122	14	17	Os06g0354700|mRNA|AK066777|CDS+3'UTR	GTGCAATTTTGTCGGAATTGTAGATCCGCCATTGTGTTAATATGTGAAAGAAACAGCGAA	Os06g0354700	AK066777	Esterase/lipase/thioesterase domain containing protein.
1123	14	18	Os08g0169100|COMBINER_EST|AU174459|7	GAGGAAGAAGAAGAGACATATGACAAGTGGCCTCTGCACATTAGACCATACAACAAGTTC	Os08g0169100	AU174459	Hypothetical protein.
1124	14	19	Os03g0231800|mRNA|AK061945|CDS+3'UTR	AGGGATGCATGTCGACTGCTAATCCTTAAGCTGTATATCCCCCATGAATTCATCATGATT	Os03g0231800	AK061945	Similar to Squalene monooxygenase 1 (EC 1.14.99.7).
1125	14	20	Os02g0289300|mRNA|AK062485|UTR	TGGGTGAACAGGATGGAAGGCATTTTTTATAGGCCCTTGTCAGATGATGGCTTTTGGCTT	Os02g0289300	AK062485	Non-protein coding transcript, uncharacterized transcript.
1126	14	21	Os05g0148700|mRNA|AK104683|CDS+3'UTR	ATGTAACTGACACATCTTTTCAGTGCCAAACTGCCAAAGAAATTAGGAACTGGTGTAAAG	Os05g0148700	AK104683	Armadillo-like helical domain containing protein.
1127	14	22	Os05g0126700|mRNA|AK102104|CDS+3'UTR	ACCCAGAACAAGTTTGTGATCTTTGTCAGTTTCTGGTACCTCGACCGAACAAGTTTTGGT	Os05g0126700	AK102104	Conserved hypothetical protein.
1128	14	23	Os02g0539100|mRNA|AK120285|CDS+3'UTR	TGGAGCTTCAAGTATATATGGTACGTTGGTACTAGGTTCCTTGTCAACATGAAGCTCTCC	Os02g0539100	AK120285	Similar to Digalactosyldiacylglycerol synthase 1.
1129	14	24	Os12g0557900|COMBINER_EST|Os12g0557900|8	TTTGATTACAGATGATCCCTTTGATAGATCGTTCTGTAGATGCCGTGATGAGGAAATATG	Os12g0557900		Cyclin-like F-box domain containing protein.
1130	14	25	Os03g0657100|mRNA|AK066133|CDS+3'UTR	AATTCTTTCAAAGCAAAATGGATGAAACAAAATTGGTTGCACCTCGAGTGCATTTTTCTG	Os03g0657100	AK066133	U box domain containing protein.
1131	14	26	Os04g0125700|mRNA|AK073177|CDS+3'UTR	AGAAACTTATAAACGAATAGACTACCTAAATTTGCTGCGTTGCTTTGTACGTAGCCAGAT	Os04g0125700	AK073177	Concanavalin A-like lectin/glucanase domain containing protein.
1132	14	27	Os02g0229800|COMBINER_EST|Os02g0229800|8	AGCAGCTGCGCGCGCAGCGCAGCGTCGCCGCCACGCCGGACTACTACGGCGCCAGCCCGT	Os02g0229800		Conserved hypothetical protein.
1133	14	28	Os02g0143100|mRNA|AK063330|CDS+3'UTR	TAAATGTTACTGTATATCTCATGATTATCATGAGCGCATAAAGCAAAACTACTTCACTTG	Os02g0143100	AK063330	Similar to Sucrose-phosphatase (EC 3.1.3.24).
1134	14	29	Os02g0531600|COMBINER|CI540085|6	CCTGTGATCACTACTTCTTGCCACTTGTTTTTGTAATCCGATCGGTGTCACTTTTTCTGC	Os02g0531600	CI540085	PEBP family protein.
1135	14	30	Os02g0194700|mRNA|AK071915|CDS+3'UTR	CAGTATGTCATGCGGACGGATGGGATCTGCTGGATTCAGCACATATCATCCAAGAAAAAT	Os02g0194700	AK071915	Similar to Lipoxygenase 2.3, chloroplast precursor (EC 1.13.11.12) (LOX2:Hv:3).
1136	14	31	Os08g0197700|COMBINER_EST|CI091121|6	CCTGGAGGCGTACGTCTACAACATCAAGAACACGCTGGGCGGCAAGATGGCGGACGCCAT	Os08g0197700	CI091121	Similar to Luminal binding protein 5 precursor (BiP 5) (78 kDa glucose-regulated protein homolog 5) (GRP 78-5).
1137	14	32	Os01g0149400|mRNA|D29712|5'UTR+CDS	GCGAATCCCACCGCTTCCCTTTCCTCTCCTCTCCTCTCCCCGGGAAGAAGACAGCAGCGG	Os01g0149400	D29712	Similar to Histone H2B.1.
1138	14	33	Os04g0627300|COMBINER_EST|AU095514|6	TCCCTCTCTCCATGTTGATAAATTACCTCGGATGATTGATTGTACTGTTAATGTGTACTG	Os04g0627300	AU095514	Conserved hypothetical protein.
1139	14	34	Os08g0117300|mRNA|AK104147|CDS+3'UTR	GAGGCTAATTTGCTCACAAGCGCTTCTCATAGAACTTTTCACAATATTTGTGAGAGAAAT	Os08g0117300	AK104147	Similar to 40S ribosomal protein S13.
1140	14	35	Os07g0228400|mRNA|AK106370|CDS+3'UTR	AACTGAATCACAAATCCAACAACAATAAAGCAAAACCATCCCAAAAATTAAATCACCGGG	Os07g0228400	AK106370	Cyclin-like F-box domain containing protein.
1141	14	36	Os08g0306000|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os08g0306000	CI274096	(No Hit)
1142	14	37	Os02g0813500|mRNA|D85751|CDS+3'UTR	CTGGAACGGTAAAAAGGAGACAATGTATACTTGATTGAAATAAGGTTTCTGCATATCAGC	Os02g0813500	D85751	Glutathione reductase, cytosolic (EC 1.8.1.7) (GR) (GRase).
1143	14	38	Os06g0343600|mRNA|AK102481|CDS+3'UTR	TAAGCAAGCTAAATGCTTATGTGGAAGAGAGAGATAAATAAAAGTGGAGAGTGTTGGCTC	Os06g0343600	AK102481	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
1144	14	39	Os12g0638100|mRNA|AK103026|CDS+3'UTR	GCCCAGCTGGTTCTTTGGGCAGAACCAAATCACTGTGGTGGTCTGTACATAGTGGAGACC	Os12g0638100	AK103026	Similar to Receptor-like protein kinase.
1145	14	40	Os03g0668400|mRNA|AK119454|CDS+3'UTR	TTTTTTGCCTTTTGTTAAAGAAATTGACTGCTAATGCTAGGTTGCTATCCTCTGAGCCAT	Os03g0668400	AK119454	Protein of unknown function DUF860, plant family protein.
1146	14	41	Os09g0557900|mRNA|AK108807|CDS+3'UTR	TCCTCCTGTAGTTGTTTTCCCAGTAAATTAGGAAACCATAACATAAGCATATTGCAAAAC	Os09g0557900	AK108807	Similar to Protein phosphatase 2C gamma isoform (EC 3.1.3.16) (PP2C-gamma) (Protein phosphatase magnesium-dependent 1 gamma) (Protein phosphatase 1C) (Fibroblast growth factor inducible protein 13) (FIN13).
1147	14	42	Os11g0258900|mRNA|AK102638|CDS+3'UTR	GAAGATGTCATTTTGGCATCCCCTTGGAGGCAATCTTGTCTGTGTCCCTTTGATGGCCTA	Os11g0258900	AK102638	Conserved hypothetical protein.
1148	14	43	Os06g0565300|COMBINER_EST|CI044706|6	AACAGTTGTAACCATGTTGTTTAGTTGATGACTTAAACACATTTGTCCTGTTGCCCTTGG	Os06g0565300	CI044706	SMAD/FHA domain containing protein.
1149	14	44	Os12g0617400|mRNA|AK107649|CDS+3'UTR	ACCACCCAGTTTTCTGCAAACTGTGGTGATGTTTGGTCACTAATCATGTATGCCTCAATC	Os12g0617400	AK107649	Similar to Neoxanthin cleavage enzyme.
1150	14	45	Os05g0113300|mRNA|AK106443|CDS+3'UTR	TAATTAGCTAGCTTGTAATCGAATGGCAGAAAAAAATTTAAAATAAGCCAGATTTGCTAG	Os05g0113300	AK106443	Sodium/hydrogen exchanger family protein.
1151	14	46	Os09g0522000|mRNA|AK062422|CDS+3'UTR	TGATTTTGAATGTGCAGTCAATGAATTCCTGTAAATTTACTTCTCCTCTCCAAAGAGCTA	Os09g0522000	AK062422	Similar to CBF-like protein.
1152	14	47	Os01g0261200|mRNA|AK102808|CDS+3'UTR	TCGACTTTTGTTCTCGCCAGCTAGTAGTACTATGTTGACGAATGTAGAAGAAAACCTCAA	Os01g0261200	AK102808	No apical meristem (NAM) protein domain containing protein.
1153	14	48	Os07g0641700|mRNA|AF009413|CDS+3'UTR	TCCTTTTATCTGTTGCGATGAAATTCAGTAAACGTTAACGCATCTGAAGAGCCTCTTCCT	Os07g0641700	AF009413	Similar to 10 kDa chaperonin (Protein CPN10) (Protein groES).
1154	14	49	Os10g0128800|COMBINER_EST|Os10g0128800|8	AGGAAAAAACACAAAGAATCATTGGCAAGATTGAAGATAGATCATTTACATGTGAGCACC	Os10g0128800		Cyclin-like F-box domain containing protein.
1155	14	50	Os01g0232300|mRNA|AK120694|CDS+3'UTR	TAGAATAGCTGTACTGTCAATTTTTGGCGTTGTCTTGTGCAATAAGCATTGTCGGCAATT	Os01g0232300	AK120694	Similar to Zinc phosphodiesterase ELAC protein 1 (EC 3.1.26.11) (Ribonuclease Z 1) (RNase Z 1) (tRNase Z 1) (tRNA 3 endonuclease 1) (ElaC homolog protein 1). Splice isoform 2.
1156	14	51	Os12g0605800|mRNA|AK061906|CDS+3'UTR	GCTCCCAACCCACCCCCTGTTGTTGTTGTCGCAAACCTGAAACTGTACAGTGTACATTAC	Os12g0605800	AK061906	Similar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment).
1157	14	52	Os02g0215100|mRNA|AK110993|CDS+3'UTR	CTGCTTGTACTACTTTTCTTAGCCACAGTAATGATAGAACTGTAAGGATTTGGTGGATTT	Os02g0215100	AK110993	Conserved hypothetical protein.
1158	14	53	Os01g0770800|mRNA|AK109200|CDS+3'UTR	CTCTTGAATCTACGCTAAAATCTATATTTGTTATCCTCACAATGGAAAAGAAAATTCAAT	Os01g0770800	AK109200	Ctr copper transporter family protein.
1159	14	54	Os02g0180900|mRNA|AK064416|CDS+3'UTR	GATACAAGCCGCACTAAGGTATTACTACAAAAGAAGAGAAAATTTCACAATCTTACAGAC	Os02g0180900	AK064416	Hypothetical protein.
1160	14	55	Os01g0687300|mRNA|AK064954|CDS+3'UTR	AGTCTTCAAATTCTGCAGGTAGGGGATACTTTAGTAAACGCAACGTGTGATTATGATTTT	Os01g0687300	AK064954	Conserved hypothetical protein.
1161	14	56	Os04g0423700|COMBINER_EST|CI438004|6	TTGCTTGTTGTAGGATGCATGGTTTTAACAGAGATGTAACTTGAGCTGAGTGAGTGCCGA	Os04g0423700	CI438004	Conserved hypothetical protein.
1162	14	57	Os08g0202200|mRNA|AK058765|CDS+3'UTR	TGTATCTATGTTTCTGATGGTCTTGTGGGTTTGAGGCCTTGAGCTTGAGAATGTATTTTT	Os08g0202200	AK058765	Conserved hypothetical protein.
1163	14	58	Os01g0308300|COMBINER|CI547969|0	CGTGAAAATTACCATGCATGTACATGCTTCTACTATCCTCTTGACAATTAAGAATGCCCA	Os01g0308300	CI547969	Disease resistance protein family protein.
1164	14	59	Os03g0413100|mRNA|AK100182|CDS+3'UTR	TGTCCGTGCGTTGTAACAAGATATATGGAAACACTGGCTGATTACACGTGGTTAATTTTT	Os03g0413100	AK100182	Similar to ACR4.
1165	14	60	Os03g0833500|mRNA|AK119356|CDS+3'UTR	TATGACTGCATGAATGCTTTTCTATTGGCGTAGAAAAACGTCAGATTTGTCGGATTTCTC	Os03g0833500	AK119356	Similar to 98kDa HDM allergen.
1166	14	61	Os11g0707900|mRNA|AK105585|CDS+3'UTR	TGGATTGAAAAGAAAAACGCTTTTCCCTTCATCAGTTTGTAAGGCTCCTTTTCTTTCATA	Os11g0707900	AK105585	Protein of unknown function DUF740 family protein.
1167	14	62	Os06g0132600|mRNA|AK074010|CDS+3'UTR	AGTTCTTTGTAAAGCCAGAGGAATATGAGATAAATGATGCGTAGGGATTGTGGTATGACT	Os06g0132600	AK074010	Conserved hypothetical protein.
1168	14	63	Os08g0157600|mRNA|AK121547|CDS+3'UTR	AGGGTATTATCCTTATTATGCATTATAGTCTGGGGAAGGTAATAAGTGGAATTTTGGTTC	Os08g0157600	AK121547	Homeodomain-like containing protein.
1169	14	64	Os01g0762000|mRNA|AK120818|5'UTR+CDS	ATAGGTCTGGTGGCTTCAATTTGAGTGAAATAATGGCTACAACTTTCATTGCCGAAGCTG	Os01g0762000	AK120818	Patatin family protein.
1170	14	65	Os01g0833800|mRNA|AK072219|CDS+3'UTR	TGAAAATGTATGATTTGTCAGGGTTGATTTGAGACAATTCTAACTGTTTACAGGCAGTTT	Os01g0833800	AK072219	IQ calmodulin-binding region domain containing protein.
1171	14	66	Os07g0628900|mRNA|AK111564|CDS+3'UTR	TGCAGGTCTCGTACGATGACGTACGATTACCAACGGGGAGAGGTATTAATGTATGATAGA	Os07g0628900	AK111564	Similar to KI domain interacting kinase 1.
1172	14	67	Os02g0615800|mRNA|AK065018|CDS+3'UTR	ATAATGATGTTGTACCTAGCATGATCTTGTATTATATGCAAGTTGAACTAATAAAAAACC	Os02g0615800	AK065018	Protein kinase-like domain containing protein.
1173	14	68	Os03g0821400|mRNA|AK069793|CDS+3'UTR	TCACATGGAGTGCTCTCTCTGGCATGGCACGGCGGATGCACAGCGCCATGAAGGCGCTCT	Os03g0821400	AK069793	Hypothetical protein.
1174	14	69	Os04g0540600|mRNA|AF464932|CDS+3'UTR	AATTTACGTTTCGTCAAGAAACCACCTTTTAAGTAAGGTAAATGTAAGGTACTAAGGTGC	Os04g0540600	AF464932	Aldehyde dehydrogenase NAD(P)-dependent family protein.
1175	14	70	Os06g0236300|mRNA|AK119955|CDS+3'UTR	GCAGGGTGATGTACTATTATATATTCAGTTTAAGATGCAAAGTACATCCTTTGCAGATAG	Os06g0236300	AK119955	Conserved hypothetical protein.
1176	14	71	Os01g0808100|mRNA|AY620415|CDS+3'UTR	TGATGAGTTGTTGGGCAAATTTGTAACATTTTTGAGAAAAGTGGGGATGTAAATACTTGC	Os01g0808100	AY620415	Similar to Transcription factor HBP-1b(c1) (Fragment).
1177	14	72	Os05g0229000|COMBINER_EST|Os05g0229000|8	TGGCTGCTCTGCAGCACGGTCCAGGCCCCAGGGCAATACCAGCTGCACTGCACCCAGTTC	Os05g0229000		D111/G-patch domain containing protein.
1178	14	73	Os03g0703100|mRNA|AK105850|CDS+3'UTR	GAGCACTATGATTCAGAACCAGATTTGTAGTACTTGTGGTGATTACGCTATTGTGTGTTT	Os03g0703100	AK105850	Similar to Beta-glucosidase.
1179	14	74	Os04g0675800|COMBINER_EST|Os04g0675800|8	TGCTTATATCCTGAAGATTGCTCCTTTCATGGAAACACTGGAGTTGTCTGAAGAAAGACA	Os04g0675800		Conserved hypothetical protein.
1180	14	75	Os11g0435500|mRNA|AK069963|CDS+3'UTR	CAGTTTTGCCATATGGTGCTCTTCACGTAGTGCATGATCTTGCCCATAGAAGAGTGTACA	Os11g0435500	AK069963	Raffinose synthase family protein.
1181	14	76	Os04g0434700|mRNA|AK062857|UTR	AGCTGCAGTTTAGTACTAGTACTAGTAGTCGTCTTGGTGTTTATTTGATGTTTAAATAGC	Os04g0434700	AK062857	Non-protein coding transcript, unclassifiable transcript.
1182	14	77	Os02g0778500|mRNA|AK107205|CDS+3'UTR	GCTGAATATAAATTGTGTACTAGTGTTGAGATTAAACAGCAAGTAGTGTACTAGTGTCAC	Os02g0778500	AK107205	Conserved hypothetical protein.
1183	14	78	Os06g0523400|mRNA|AK121890|CDS+3'UTR	ATTTTCTGACATTCAGTGGATGCAAAACTGGTGAGTGATCATGAAATAGTAAATCTTTGC	Os06g0523400	AK121890	Nucleotide-sugar transporter family protein.
1184	14	79	Os03g0308100|mRNA|AK105977|CDS+3'UTR	TATCTTCTGCGATGAATATTGCAACTTATTTGATGTACTATTAGGAGGATATCTTCTGCG	Os03g0308100	AK105977	Peptidase S14, ClpP family protein.
1185	14	80	osa-miR393|Os01|3'seq	TGGCGGTCGTCGTCTACAAGCAGCTTGACGGATCATGCGATCCTTTTGGAGGCTTCCTCT			miRNA
1186	14	81	DarkCorner		
1187	14	82	DarkCorner		
1188	14	83	DarkCorner		
1189	14	84	DarkCorner		
1190	14	85	DarkCorner		
1191	15	1	DarkCorner		
1192	15	2	DarkCorner		
1193	15	3	DarkCorner		
1194	15	4	DarkCorner		
1195	15	5	DarkCorner		
1196	15	6	Os09g0414900|mRNA|AK059073|CDS+3'UTR	CTGGGCTATCCATTGCTGTACGCCTGAACGGTTCCAGAGGGGTGATGCAAATCATGCAGA	Os09g0414900	AK059073	Similar to GASA5-like protein (Fragment).
1197	15	7	Os05g0581900|mRNA|AK109090|CDS+3'UTR	TGCTGTATGTAGTTACTAGTAGTAATCAGTAAGAACATTGAGCTGAACTTTTGCGTTCAC	Os05g0581900	AK109090	X8 domain containing protein.
1198	15	8	Os08g0562100|mRNA|AK102598|CDS+3'UTR	CTATGTTGCCGAGTTTGTACACTATAATACAATCAACCAAATGCAATGCGGCTGATCGTA	Os08g0562100	AK102598	Similar to Sorghum chloroplast CM3 malate dehydrogenase (NADP) (Fragment).
1199	15	9	POsControl0031|random		
1200	15	10	Os03g0413100|mRNA|AK063316|CDS+3'UTR	CTCAGTCCCAGGACAAGGCTGATGATGCATTTGACTCAGGTGGCGTACCATCATTCATCA	Os03g0413100	AK063316	Similar to ACR4.
1201	15	11	osa-miR167h|Os12|5'seq	CACAAGTTGGTGAAGCTGCCAGCATGATCTGATGATGATGATGATCCACCTCTCTCATCT			miRNA
1202	15	12	Os04g0638900|COMBINER_EST|Os04g0638900|8	TAGCTAGAGCCTGCAGGTTACGTGTCAACGGCGAACGATGTGGGGAGCCATGCGCGGGGC	Os04g0638900		Hypothetical protein.
1203	15	13	Os12g0118800|mRNA|AK063302|CDS+3'UTR	GCACACTGAATTTGGTCAGCAGTTCGCTATTGGACAAAGTAGACCTGCGGAACAAAACAT	Os12g0118800	AK063302	Ankyrin repeat containing protein.
1204	15	14	Os04g0463800|mRNA|AK100348|CDS+3'UTR	TTTGCAGTGTACATGACGTCTAAAGGATTAGGGGCACCCGTGTATACGAGTGTAACTCTA	Os04g0463800	AK100348	Protein prenyltransferase domain containing protein.
1205	15	15	Os01g0895100|mRNA|AK099166|CDS+3'UTR	GCTCTTTCTAGAGCTGACTCTGCATATTTTAGTGGAAAGCCAAAAATTTCCGTCCTCGTG	Os01g0895100	AK099166	Similar to Membrane-associated 30 kDa protein, chloroplast precursor (M30).
1206	15	16	Os02g0168800|mRNA|AK060914|CDS+3'UTR	GGCTTTTGCGGCCAATTATGTTGTAACTTTGTAATTTGATGTAATTTTGCAGATGCTTTG	Os02g0168800	AK060914	Similar to Porphobilinogen deaminase (Fragment).
1207	15	17	Os11g0682500|mRNA|AK120734|CDS+3'UTR	CCGTTGTATTCGTTCCTTTATATATGGAAGTAAACAGAAAAGCAGCTGAGTTAAGCGCTG	Os11g0682500	AK120734	Reverse transcriptase, RNA-dependent DNA polymerase family protein.
1208	15	18	Os02g0580500|mRNA|AK108467|CDS+3'UTR	TGCCCAAAATATGTGGCAATTTGTTGAATTTTGTGATCCTTCAACTACTGCAATGCAGGA	Os02g0580500	AK108467	Similar to Prohibitin.
1209	15	19	Os03g0118700|COMBINER|CI277624|6	TGGACTAGGATCTGATCCTGTGACTCCATATGTACTTGCAGTCTAGCTTGCATGTTTTCT	Os03g0118700	CI277624	Alcohol oxidase family protein.
1210	15	20	Os03g0370900|mRNA|AK101513|CDS+3'UTR	CTACATTGTTCAGTGTATTCTGCATGTCCAGTCTCTTATTATCTATAAAACTTGTCAAGG	Os03g0370900	AK101513	Similar to Cytochrome P450.
1211	15	21	Os10g0563700|mRNA|AK072751|CDS+3'UTR	GTGCGAACTGAAGTTTTTCTTCATTATGTTGCATGTTATGCATGCATTTACCAGTTGCTC	Os10g0563700	AK072751	Similar to Nucleoside diphosphate kinase I (EC 2.7.4.6) (NDK I) (NDP kinase I) (PP18).
1212	15	22	Os11g0600700|mRNA|AK061258|CDS+3'UTR	GCCATGTACAGTATTATTACATGGGAGCTTTTATCTTTCAAAGAATTAATCTGAGTGAGT	Os11g0600700	AK061258	Similar to RING domain protein.
1213	15	23	Os01g0758200|mRNA|AK071083|CDS+3'UTR	GTTGCGGGTGTAATGTAAGAATGGAAGTGATGAGGTTGCGGAGGCAAGTTGCGAACTCCG	Os01g0758200	AK071083	Similar to Dof2 (Fragment).
1214	15	24	Os11g0307600|mRNA|AK121926|CDS+3'UTR	TAGCAATCTTGTGGAATCCTAGTTGTATTTATGGGGTTGATTTCATCCGTTCTTGAGTCC	Os11g0307600	AK121926	Similar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor.
1215	15	25	ETG05_36762		
1216	15	26	Os01g0919500|mRNA|AK067058|CDS+3'UTR	AAGAATACGATTGTATGTCCTGTGGAAATGATCCATGCTATTAAAGGTCTAGATTTTGTG	Os01g0919500	AK067058	Zinc finger, RING-type domain containing protein.
1217	15	27	Os06g0234200|mRNA|AF380335|CDS+3'UTR	TGTCCATGTAATGTATTAGGAAGGTTAATAGCACTCCCTACATCTCAGAATGGAAGTTGT	Os06g0234200	AF380335	Similar to RAC-like GTP binding protein ARAC8 (GTPase protein ROP10).
1218	15	28	Os01g0805000|COMBINER_EST|CI027916|0	GTCCGGTTAATGTGTGAAGTACATTATCAACACAAATTCAAGTTAGCCTTTTTGCTTGCA	Os01g0805000	CI027916	Ribosomal protein L34 family protein.
1219	15	29	Os04g0221000|mRNA|AK102514|CDS+3'UTR	TGTTTAGAGAATGTTTACTTGTACTAACTCAGTCCGAATTCTGGAACACCCTATGGCTCA	Os04g0221000	AK102514	Conserved hypothetical protein.
1220	15	30	Os01g0721900|mRNA|AK059581|CDS+3'UTR	TAATCGGAACAAATAATGGTGTTGCCTGTGCCTTTTTTCCATCGTGTGTTGGTCTACTTT	Os01g0721900	AK059581	Similar to Nuclear RNA binding protein B (Fragment).
1221	15	31	Os01g0973200|COMBINER_EST|CI276041|6	CGTTGTGATCCAATGCTTTTGAGTAGGGATGTATTCATTTGTATAGGTAATTCTGATATG	Os01g0973200	CI276041	Kinetochore-Ndc80 subunit Spc25 family protein.
1222	15	32	Os10g0555700|mRNA|AK061068|CDS+3'UTR	GGCAGACTTATTGTATTGTGACCAAAACCAAGTTTGTAATTGAACTGAATTAATACGGTG	Os10g0555700	AK061068	Beta-expansin.
1223	15	33	Os05g0188600|mRNA|AK111527|CDS+3'UTR	CTCACTTGTTAGCTGTCGCTATATGCTAAGGACAAAGGTTTCTTAAGATGGACAAAGGTT	Os05g0188600	AK111527	Homeodomain-like containing protein.
1224	15	34	Os05g0147200|mRNA|AK064493|CDS+3'UTR	TGACACTGATGCATTCGCAATTAGAAAGCTTGTCCTGAGAGACCTTGATGGGGCTTGAAT	Os05g0147200	AK064493	Initiation factor eIF-4 gamma, middle domain containing protein.
1225	15	35	Os01g0657100|mRNA|AK062362|CDS+3'UTR	TCTCCATTACCATGTTAGAGTAATATATATGTTTGAGTGTGTGCACTCATGCAACAATAG	Os01g0657100	AK062362	Similar to Mycorrhiza-inducible inorganic phosphate transporter (Fragment).
1226	15	36	Os02g0126800|mRNA|AK071820|CDS+3'UTR	TAACCTGTCCTACATGTACAGTACAGAGCAATTTTGCTTTCCAAAGTAACTTGTCTGGCT	Os02g0126800	AK071820	Similar to Golgi SNARE 12 protein (AtGOS12) (Golgi SNAP receptor complex member 1-2).
1227	15	37	Os11g0162300|COMBINER_EST|Os11g0162300|8	ACCGACAACTGGACTCCATTCACGAATACAGTGAAGATATGCGATATTGCACACACACAT	Os11g0162300		Conserved hypothetical protein.
1228	15	38	Os01g0120800|mRNA|AK072604|CDS+3'UTR	CTCCATTGCACACTGGATTGCTACTCGTTAAGTTTGTCCAAACTTTGGCGCTGTTAGTAA	Os01g0120800	AK072604	Similar to Eukaryotic translation initiation factor 3 subunit 10 (eIF-3 theta) (Eukaryotic translation initiation factor 3 large subunit) (eIF3a).
1229	15	39	osa-miR156d|Os02|5'seq	GGAGAAGCTCTCATGAGATTGACAGAAGAGAGTGAGCACACGGCGTGATGGCCGGCATAA			miRNA
1230	15	40	Os01g0611000|mRNA|AK060682|CDS+3'UTR	AGGTGCCAACCTAAACGCACCATCAGACATTATGAATGGGAAGCATTACTAGTGCTCACT	Os01g0611000	AK060682	Similar to Unidentified precursor.
1231	15	41	Os03g0243900|mRNA|AK100431|CDS+3'UTR	GTTTGCGCATTTGTGTCTCGCAGAAAAGAAATGTACAAGATTAATCCCACAGATTAAGAA	Os03g0243900	AK100431	Similar to Thaumatin-like protein.
1232	15	42	Os05g0594500|mRNA|AK067256|CDS+3'UTR	TTCAATGTATGCAAGACGATCAATCCAGCGATGAAGCTGGTGATGTCCCTCTTCTTCCCT	Os05g0594500	AK067256	Invasin/intimin cell-adhesion domain containing protein.
1233	15	43	Os08g0543200|COMBINER_EST|Os08g0543200|8	CGTGCGCGTGCTCATGTGTATGGAGGCACGAAAGATGGAGGAGTTCGAGCGACTGCTTTA	Os08g0543200		Transferase family protein.
1234	15	44	Os06g0568600|mRNA|AY660664|5'UTR+CDS	GCGGAGTCCATCGCTGCTGCTGTGGATACTGTCCTGGTAACCACTGAATGGGCCATGTAT	Os06g0568600	AY660664	Similar to Ent-kaurene oxidase 1 (Fragment).
1235	15	45	Os08g0477100|mRNA|AK108679|CDS+3'UTR	TGGAAAAGTTATACTATGTAAACTTTGTTTGTCGTATATCTGGAATAAAGTACTACATAA	Os08g0477100	AK108679	Similar to Latex allergen.
1236	15	46	Os01g0780300|COMBINER_EST|Os01g0780300|8	AAGTCGTTTTTTTCGCTGCCTGATGATGCCCGCGAACGCGAGCGACCTCCCACCGGACGG	Os01g0780300		Hypothetical protein.
1237	15	47	Os01g0225100|mRNA|AK100398|CDS+3'UTR	CCTGTCTAATTGTTTTGATGTGATGCTCAAGATAACTTATGTCTTGAATGTCAACATTGC	Os01g0225100	AK100398	Smr protein/MutS2 C-terminal domain containing protein.
1238	15	48	Os07g0682300|COMBINER_EST|CB647338|7	TCTCTTCTGGAGGCCAGGGCATCCTCTTTCTTCTCTTTATGGTTTAATAAAGCTATCTTC	Os07g0682300	CB647338	Conserved hypothetical protein.
1239	15	49	Os01g0541700|COMBINER|CI419613|x	TTACGTCCGACCACGTCAAAAAAACAGACTCCCGTCCGCCACGTCAGCACGACAAGTATC	Os01g0541700	CI419613	Conserved hypothetical protein.
1240	15	50	Os03g0752500|mRNA|AK063100|UTR	AGAAGCTGTATTAGTGAGCTGATGGATTGACTAATTAATCAATATATGCATGGGCATGCA	Os03g0752500	AK063100	Non-protein coding transcript, unclassifiable transcript.
1241	15	51	Os01g0897300|mRNA|AK106167|CDS+3'UTR	ATTGTCTGCAAATTTGCAGCATCCCGTCATTTCCAAATTCAAGCGCGCCGTTAACAATTG	Os01g0897300	AK106167	Ribonuclease T2 family protein.
1242	15	52	Os05g0120000|COMBINER_EST|Os05g0120000|8	TGTGGGTGCTGATGAAGAGGGCGTTCACCAACACGAGGCGCATGCCGGAGCTGTTCGTGA	Os05g0120000		Similar to Stigma/style ABC transporter.
1243	15	53	Os03g0726800|mRNA|AK101683|CDS+3'UTR	CTTCAGTGGCTCAGTGACAGTGTACATGCATGTAATGGACCACATTCTGCTGCTCTAATA	Os03g0726800	AK101683	Protein of unknown function DUF676, hydrolase-like domain containing protein.
1244	15	54	POsControl0047|art		
1245	15	55	Os05g0510100|COMBINER_EST|AU029398|6	TATCATCTTGCAAATTCTTTTTTGTATGTTTTCTTGTCGAAGTTTGAATATTTTGCCTTG	Os05g0510100	AU029398	Protein of unknown function DUF567 family protein.
1246	15	56	Os01g0934400|mRNA|AK058904|CDS+3'UTR	ATGTTGTACTGTACCTGTAATGCTGTATCATAATGCTAGTGTCACACATGTGCAATTTTT	Os01g0934400	AK058904	Photosystem II oxygen evolving complex protein PsbP family protein.
1247	15	57	Os12g0615400|mRNA|AK072988|CDS+3'UTR	GATTAAGCTCATCCGAACTCCTGAGCATGGAATGGATCGTGTGTAGCATAATTAGAATGG	Os12g0615400	AK072988	Similar to 37 kDa inner envelope membrane protein, chloroplast precursor (E37).
1248	15	58	Os03g0278900|mRNA|AK066019|CDS+3'UTR	TGATAAGTATAAAATCAATGATCCTTTTGCTAGAAATTGGATTGAAATTATAAACTGCTT	Os03g0278900	AK066019	ATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein.
1249	15	59	Os01g0869500|mRNA|AK070435|CDS+3'UTR	TTGTCGTTGTGTTCTTGTGTCTGTAGTTCGTAACTGCATAGATGAAAACTTTAACATTAG	Os01g0869500	AK070435	Plant nuclear matrix 1 family protein.
1250	15	60	Os06g0685700|mRNA|AB071299|CDS	ATGAACCTTTCAGCGAGTTCACGAAGACGGCGCGTAGGCTGAATATACTAACAGATACAA	Os06g0685700	AB071299	Similar to Auxin response factor 16.
1251	15	61	Os09g0105400|COMBINER|CI330756|6	TATGTTTCCTTTTCCTCTGCCTCACTACACCAATTGGTCTTCCAGTTGAGTAGTGAGTCG	Os09g0105400	CI330756	(No Hit)
1252	15	62	Os04g0404400|mRNA|AK112111|CDS+3'UTR	TCAGTGTGTGTTTTGTTATAGAACTTGCATGGATAAATTGGGGAGTGTATACATGCATAC	Os04g0404400	AK112111	Conserved hypothetical protein.
1253	15	63	Os03g0271900|mRNA|AK103225|CDS+3'UTR	TGTGCTTCACATCACTGCTGGCGTGTGTAGTAGTGTACGGAGTAGTTAAAGGGTGTGTTT	Os03g0271900	AK103225	Peptidase A1, pepsin family protein.
1254	15	64	Os02g0670900|mRNA|AK061649|CDS+3'UTR	TCATTCTGTTTTGTCCCAAGCAAGTAAACTTGTAATGCCCCAACTACCAATCGAAATATC	Os02g0670900	AK061649	Similar to Amino acid transporter protein-like.
1255	15	65	Os02g0739900|COMBINER_EST|CI036243|6	AACTCTGAAGGTGTTGACACTTGACATAACGGCATTACTGCCCGAGTGATTTCAGTATGA	Os02g0739900	CI036243	Non-protein coding transcript, uncharacterized transcript.
1256	15	66	osa-miR397b|Os02|5'seq	AGGGAAGGCATTATTGAGTGCAGCGTTGATGAACCTGCCGGCCGGCTAAATTAATTAGCA			miRNA
1257	15	67	Os08g0520400|mRNA|AK102428|CDS+3'UTR	GTTGCTCCAATTGGCCTCCACAACATCTGTCCAGAAGTTATTTTGTTTGGATTTGTTTGC	Os08g0520400	AK102428	Conserved hypothetical protein.
1258	15	68	Os09g0322600|mRNA|AK070013|CDS+3'UTR	TGAAGGGCCAACACTCGTATAGAGTATTTTTCAGTAGTACTGAAGCGAAGTTTCGCATTG	Os09g0322600	AK070013	Similar to Polygalacturonase inhibitory protein.
1259	15	69	Os03g0225100|mRNA|AK070170|CDS+3'UTR	ATTGCAAGACACAATTTTGTGCAATCGTAATGAGAGACTAAAGAGTCTAGTTCAATTGTC	Os03g0225100	AK070170	Protein kinase-like domain containing protein.
1260	15	70	Os01g0839100|mRNA|AK108227|CDS+3'UTR	CGGTTGTGGTTGATTCTTTGTAAAATACCAATTTACTAGTATAAATATACTGACAGCTTA	Os01g0839100	AK108227	Conserved hypothetical protein.
1261	15	71	Os05g0182000|COMBINER_EST|CI466251|6	CTTGGTGACATAGCAGCTTGGATAATCTGCTTGTTTTGGTGGATGAATAGATCGAGAAAA	Os05g0182000	CI466251	Late embryogenesis abundant protein.
1262	15	72	Os01g0889800|mRNA|AK104708|CDS+3'UTR	ATCGTGAATATAGAGGCGATCAATGAGGTTCACAATGCAGAAGACCATTGCTGTTACTGA	Os01g0889800	AK104708	Rhodanese-like domain containing protein.
1263	15	73	Os05g0513400|mRNA|AK121638|CDS+3'UTR	AATTAAAAACCATACCCACACCATTTTAGTATCTGCTAGGAGCGCCATGAATCCCCTTGA	Os05g0513400	AK121638	Protein of unknown function DUF803 family protein.
1264	15	74	Os01g0145200|COMBINER|CI541843|x	CACTTGGGGTTTGGGGTTTGAAAGACAGTGTCGTTGATGTGCTTTGAGTTCCTGCTTAAT	Os01g0145200	CI541843	Conserved hypothetical protein.
1265	15	75	Os04g0353200|mRNA|AK120373|CDS+3'UTR	TGTTATACCATTCTACAGTCAATCTGTTAATCAGTTCTTATATGTTATTCGAACCCCACC	Os04g0353200	AK120373	Conserved hypothetical protein.
1266	15	76	Os06g0493100|mRNA|AK063797|CDS+3'UTR	TATATATGTATCCCCCTGTCTCGGCAATATATGGATTAATAAGACATGTGTACTCTGGAT	Os06g0493100	AK063797	Conserved hypothetical protein.
1267	15	77	Os07g0495000|mRNA|AK060721|CDS+3'UTR	TGGCTAACCCCTTGAAATGTCGAAATAATGCGTCGCTGTAATGAAACCAGGTACCTGATT	Os07g0495000	AK060721	Cupin, RmlC-type domain containing protein.
1268	15	78	Os11g0448400|mRNA|AB095094|CDS+3'UTR	CAGAATAGTGTAGCTCGTCCCCGACGAAGGAATCAACAGATTTTGCAGAGCTATTCATTT	Os11g0448400	AB095094	Similar to Sigma factor SIG2A.
1269	15	79	POsControl0020|genome		
1270	15	80	Os04g0382300|mRNA|AK104588|CDS+3'UTR	TAATGGATAGCACGGGTGTACATTCAATAACTTGAAATAATATCTGAGCTCCCTTCTGTA	Os04g0382300	AK104588	Similar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1).
1271	15	81	Os07g0644900|COMBINER_EST|Os07g0644900|8	AAGCAACAGCTGGTATTTTTAAAAGCCATCATGGATCTTAGGGACAATATTTCATCGCCA	Os07g0644900		Conserved hypothetical protein.
1272	15	82	DarkCorner		
1273	15	83	DarkCorner		
1274	15	84	DarkCorner		
1275	15	85	DarkCorner		
1276	16	1	DarkCorner		
1277	16	2	DarkCorner		
1278	16	3	DarkCorner		
1279	16	4	DarkCorner		
1280	16	5	Os03g0742800|mRNA|AK069015|CDS+3'UTR	TGCTGGAGTTCTCTTGAGACATTTGCTAATTTCTGAGCAGTAAAACACCCTTTGCCTTCC	Os03g0742800	AK069015	Similar to Auxin-responsive protein IAA14 (Indoleacetic acid-induced protein 14) (SOLITARY-ROOT protein).
1281	16	6	Os03g0563400|COMBINER_EST|CI418557|6	TTCGTGTAATATTGACAAAGTGTTGTACAAATTTCCTGACTAATTTCAGTTGTGCCTGTG	Os03g0563400	CI418557	Zinc finger, BED-type predicted domain containing protein.
1282	16	7	Os02g0661500|mRNA|AK068317|CDS+3'UTR	TATGCAGGTGGATCCTGCTGCAGTTTACATCGGCATGTAGCAATTTGGTTCGATGATACT	Os02g0661500	AK068317	Hypothetical protein.
1283	16	8	Os02g0106800|mRNA|AK060675|CDS+3'UTR	TTAAAAACACTGTTAACTTTACCACAGATGGGAACGCTAAATTTATGTGATTTGTATGTG	Os02g0106800	AK060675	TMPIT-like family protein.
1284	16	9	Os07g0204900|mRNA|AK065213|CDS+3'UTR	GGTGCTTAAATTTGGTGAGTACTGCTGTACTTTATAAGGCAGCTTTAGAGTTTTTATAAG	Os07g0204900	AK065213	Similar to Zeta-carotene desaturase (Fragment).
1285	16	10	Os01g0776800|mRNA|AK101996|CDS+3'UTR	GAGCTTGTTGATTTATGAAAATTGGCCGTGTTTAGTTTCACGCCCAATTTTTTTTATACG	Os01g0776800	AK101996	Conserved hypothetical protein.
1286	16	11	Os03g0325400|mRNA|AK064647|UTR	GCAGTGTTGGGAGTCTGTATACAGACCATAGCTTTTCTCTTTTCTCTTTGAGGCAATTGT	Os03g0325400	AK064647	Non-protein coding transcript, uncharacterized transcript.
1287	16	12	Os03g0372900|mRNA|AK100417|CDS+3'UTR	ATTAATTTTAGGAAATGAATAAAATAAGAACTATCTTATAAAGAATTAATTTGTTGGTGG	Os03g0372900	AK100417	Cyclin-like F-box domain containing protein.
1288	16	13	Os01g0374400|COMBINER_EST|Os01g0374400|8	GCTCTTATATGTTCATCTTACGACTTTGATTATGCGTTGATAACCAATTTACTGATCACC	Os01g0374400		Conserved hypothetical protein.
1289	16	14	Os04g0593400|COMBINER_EST|CI422315|0	TTTCGTTGTCGCGCTTGCTTGTAAAACCATCGTGTGATACTGCGCAGTACGTGTGTTAAT	Os04g0593400	CI422315	Bet v I allergen family protein.
1290	16	15	Os11g0126900|mRNA|AK069257|CDS+3'UTR	TTGCATGGGCAGATAGACAAACAGACGGAATTCTTGATGTAACCGATGCAAGGAAAGATT	Os11g0126900	AK069257	Similar to NAC domain transcription factor.
1291	16	16	Os08g0526200|mRNA|AK071263|CDS+3'UTR	TTTGGTGATTATTGTGGTTGTTTTTTTTGGGCAAAGAGTGGTTGAGTTTTGGTTGTGTCG	Os08g0526200	AK071263	Hypothetical protein.
1292	16	17	Os01g0850400|mRNA|AJ575220|5'UTR+CDS	TGCAGTTCTCATGGGCAACTTCGTAAGAACTCATTGCTGGGTCCCGAGTTTAATGAGTTT	Os01g0850400	AJ575220	Similar to MYBY1 protein (Fragment).
1293	16	18	Os05g0487300|mRNA|AK064162|CDS+3'UTR	ATATTCAGGGATGAAGACTGTAAAGCTTTTGCTAGCTTGGGCCTCCTCTTTGCAGCAGTA	Os05g0487300	AK064162	Conserved hypothetical protein.
1294	16	19	Os03g0624600|mRNA|AK062675|CDS+3'UTR	TTTTGGTGGAGACGGGGCCCTCAAGTTTAATACAAAGCAGTAAGTCTATTTTGCATACTC	Os03g0624600	AK062675	No apical meristem (NAM) protein domain containing protein.
1295	16	20	Os01g0897800|mRNA|AY288943|CDS+3'UTR	CCTGTATACTTCTCTGACTTTGAGCAACCTGTCGATTAATTTCAAATTTATTCAGATTCG	Os01g0897800	AY288943	Rad21/Rec8 like protein, N-terminal domain containing protein.
1296	16	21	Os02g0202000|COMBINER_EST|CI420687|0	GTTTGCAACTATGTGTAGCTATATGTGTTTATGAAAAGCTATATATACGCAGTCTCCATC	Os02g0202000	CI420687	Pathogenesis-related transcriptional factor and ERF domain containing protein.
1297	16	22	Os02g0761100|mRNA|AK070404|CDS+3'UTR	TATCGTAGGAAATGTCTGGCGGATTGAATTGTCAAACTCTTGGAAAGGCCTTTTGAATGA	Os02g0761100	AK070404	Similar to Cyclophilin-40 (Expressed protein).
1298	16	23	Os05g0304100|mRNA|AK101238|CDS+3'UTR	TAACCCTACGTGCTCTGTTTTTTGATATGGCTGTCAAGCAGCGATATGTCCATCAGTCCA	Os05g0304100	AK101238	Conserved hypothetical protein.
1299	16	24	Os09g0324200|mRNA|AK109621|CDS+3'UTR	GAGTTGTGACCAATTTATTAAAGTGTCTCACAGCTTTATTACATCAATAGAAATCAGGCG	Os09g0324200	AK109621	Cyclin-like F-box domain containing protein.
1300	16	25	Os01g0597600|COMBINER_EST|AU056136|7	TAGTGTGACCACAGTGTCCTTAAAATAAAGGGCGCTTGAAAAAATTTTCGGAGTTAGTTT	Os01g0597600	AU056136	Amino acid/polyamine transporter II family protein.
1301	16	26	Os02g0702600|mRNA|AK102549|CDS+3'UTR	ATAGTGTATGCATGGTAAAAGCTACTAGCATTGGCCGCATCGTACATCAACGTTTGCAGC	Os02g0702600	AK102549	Protein of unknown function DUF315 domain containing protein.
1302	16	27	RC7		
1303	16	28	Os01g0899200|mRNA|AK108736|CDS+3'UTR	TTGCTTTGCTTGCTAAGCAATGGCATGATTCATGTATGATGATGGAATCTGTAGCCTCTA	Os01g0899200	AK108736	Similar to ERD3 protein.
1304	16	29	Os01g0549400|mRNA|AK122104|CDS+3'UTR	AGTGAAGTTGGTAGCTCTGTTATTTGTGAACCAATACCGGAGGTGCAAATCATGCAAGAT	Os01g0549400	AK122104	Similar to RNA helicase-like protein DB10.
1305	16	30	Os07g0506700|mRNA|AK073959|CDS+3'UTR	CAATTCTTCAAATACTTGCCGGGCCAATTAAGTATTTTACTATGCCTTCTGAGCAATATA	Os07g0506700	AK073959	WD40-like domain containing protein.
1306	16	31	Os09g0444700|mRNA|AK120833|CDS+3'UTR	TGTATACTGAAAAATTCCTGTCCATCTATATAAACGGCTGGTTCTCCATGCTGCAATGTT	Os09g0444700	AK120833	Mitochondrial substrate carrier family protein.
1307	16	32	Os08g0434100|mRNA|AB052844|5'UTR+CDS	GACGAGTCCGGCAACAGCCAGCTGTACCAGCTCTACTTCTGCGTGGACGCCGCCGGCGAG	Os08g0434100	AB052844	Similar to S-like ribonuclease (RNase PD2) (Fragment).
1308	16	33	Os03g0146800|mRNA|AK121746|UTR	TGCCCTCTTTGTTAAATTGTAACCACCCTACATATATGTACTAGTATCACCAATAAAGTG	Os03g0146800	AK121746	Non-protein coding transcript, unclassifiable transcript.
1309	16	34	Os07g0512000|mRNA|AK108133|CDS+3'UTR	AAATGCTTATGTGTATCAAATTATGGAGCAAAAAGGGAAAAAGTGGATGTGCTACCAGCA	Os07g0512000	AK108133	Prephenate dehydratase domain containing protein.
1310	16	35	Os10g0510000|mRNA|AK070531|CDS+3'UTR	CGTAAGTACGTGGGGAGTCAAGAACATTATGTGTGTAGTTTGATTTCATAAATTGATTTG	Os10g0510000	AK070531	actin [Oryza sativa (japonica cultivar-group)].
1311	16	36	Os07g0112600|mRNA|AK109561|CDS+3'UTR	TGTACTTTTTCCTTCTAGGATCGAGGCCTCCACAAACAAAGGCCTTATAAAAGGAAGAGG	Os07g0112600	AK109561	Conserved hypothetical protein.
1312	16	37	Os11g0469000|COMBINER_EST|AU029311|7	ACGTGCACATCATTTGTCCCCCTCCCCCATCTTATGGTCCTACATACACATTGACTATTT	Os11g0469000	AU029311	Hypothetical protein.
1313	16	38	Os02g0771600|mRNA|AK066805|CDS+3'UTR	TATTGTTCTGTGCTTCAATGGCTACCACGTTAGATGGGCCTTGTGCTAATGTTGTTTTAT	Os02g0771600	AK066805	Similar to 1-aminocyclopropane-1-carboxylate oxidase (Fragment).
1314	16	39	Os01g0962700|mRNA|AK119199|CDS+3'UTR	AATGCATGACGTCATGACAACCTCCTTTATGATCAATATATATGGATGTGGATTTTCATC	Os01g0962700	AK119199	Similar to Peroxidase 12 precursor (EC 1.11.1.7) (Atperox P12) (PRXR6) (ATP4a).
1315	16	40	(+)E1A_r60_a135		
1316	16	41	Os01g0905200|mRNA|AK067779|CDS+3'UTR	AACACAGCCAAACAACAGACTATAGTTGTTTACCATGGATTCTTTTGTAATAACACATGT	Os01g0905200	AK067779	Exo70 exocyst complex subunit family protein.
1317	16	42	Os02g0775200|mRNA|AK069984|CDS+3'UTR	AGGTGATGCATGATGCGTGTAACGTTTTATGCAGTAGAAAATGTATTCACAGTTCCAGCT	Os02g0775200	AK069984	Similar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5).
1318	16	43	Os12g0209300|COMBINER_EST|Os12g0209300|8	ATTACATGGAAAATTGTGACAAAGAGAGCATTGTCCTTAACCATTCTTACCGTCTCAAAT	Os12g0209300		AAA ATPase, central region domain containing protein.
1319	16	44	Os03g0131100|mRNA|AK100046|CDS+3'UTR	ATGTTGGAGTAGTTTCGATGTTGCTCGTGTAAACCTGCTCTTTTACGGGTGAAGATTTTT	Os03g0131100	AK100046	Plant regulator RWP-RK domain containing protein.
1320	16	45	Os06g0267500|mRNA|AK060434|CDS+3'UTR	AAGTCATTTTCTGGAGCTTGTGGTAAAGCAGGGCTGAGAATCTCGTGCAAGCTTCATCTT	Os06g0267500	AK060434	Similar to NAM1 protein (Fragment).
1321	16	46	Os05g0158700|mRNA|AK101414|CDS+3'UTR	TGTTCTTCCTTCTTGTCTTGCACTTTTCATATAGCAAAATGGTTACTGTGAAGATTTCCT	Os05g0158700	AK101414	Similar to OsGA2ox1.
1322	16	47	Os04g0173300|mRNA|AK069921|CDS+3'UTR	TTGCCATACATCCCAATCATATTATTTGGCAACTATATAAGCTGAATTTACCTGCATTGC	Os04g0173300	AK069921	Hypothetical protein.
1323	16	48	Os02g0140500|mRNA|AK067920|CDS+3'UTR	TTGTAAAGCAGTACTACTTTTGCTATTACTACTGCAGTACTACTTGTGTTTGTCTCGTCT	Os02g0140500	AK067920	Similar to mutator-like transposase [Oryza sativa (japonica cultivar-group)].
1324	16	49	Os09g0425900|mRNA|AY224518|CDS	AGTCCGGATGCTGCAAGCCACCCAGCAGCTGCAACTTCCTCTACGTCAGCGGCACGAACT	Os09g0425900	AY224518	Similar to Senescence-associated protein 5.
1325	16	50	Os01g0695300|mRNA|AK099451|CDS+3'UTR	TTTCTAACTTCTGGGACTTTGCAACGAGGAACGTGCCTGATAAATAAGAAAAATAGTTTC	Os01g0695300	AK099451	Similar to Farnesyl pyrophosphate synthetase (FPP synthetase) (FPS) (Farnesyl diphosphate synthetase) [Includes: Dimethylallyltranstransferase (EC 2.5.1.1); Geranyltranstransferase (EC 2.5.1.10)].
1326	16	51	osa-miR169i|Os08|5'seq	GTAGCTCTGGTAGCCAAGGATGACTTGCCTGTGTCCTTGTGTAGAGGATCATTCAGAAAA			miRNA
1327	16	52	Os11g0537900|COMBINER|CI105468|6	CACTTTGTTTCAGACGGGTGGAAGATCCACACCTGAAAATCGCTTTCGGCTGCACGGAAA	Os11g0537900	CI105468	(No Hit)
1328	16	53	Os12g0164800|COMBINER_EST|CI156047|6	TTTTTTCACTCATCATCCCATGGTGAAACTGACAAATATCCATGGTAGATGATACTGTTT	Os12g0164800	CI156047	Protein of unknown function DUF676, hydrolase-like domain containing protein.
1329	16	54	Os07g0120900|mRNA|AK073714|CDS+3'UTR	AGTGTATTGATCTGAAATGTGTGCTCCATATATTTGCTGCTGCTGTTTGCGCAGCGCAGA	Os07g0120900	AK073714	Protein of unknown function DUF1719, Oryza sativa family protein.
1330	16	55	Os11g0578700|mRNA|AK102056|CDS+3'UTR	CTTTTTGGATACAAGAACAACCATCGTGATATTGGAGTGTTGGACTTGGAAAATTTCCGC	Os11g0578700	AK102056	Hypothetical protein.
1331	16	56	Os03g0333300|mRNA|AK063858|5'UTR+CDS	ATAAGTTGGCAGAGAAAACTGAGAGCTTGACAGTCGCTGAGACTGGTGAGCCAAGTTTTA	Os03g0333300	AK063858	Similar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38).
1332	16	57	Os08g0527300|mRNA|AK121686|CDS+3'UTR	CAGGGCTTTGCCAACATGTACGTACCTAGTTGGGGATATTAGCTGGTGTTCTTGATCATT	Os08g0527300	AK121686	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
1333	16	58	Os11g0602300|mRNA|AB118011|5'UTR+CDS	ACTAAAAAAGGCGTTGAAGGACTCGAAAGAACAGGGGTCGCAGAAGGATTCAGATGAACT	Os11g0602300	AB118011	Similar to HVA22-like protein a (AtHVA22a).
1334	16	59	Os03g0380600|COMBINER_EST|Os03g0380600|8	ATGAAACTACTGCAGCAGCATCAGCTTCTCGGTGTTTAGAGTTTGAAAATCAAGACCCCA	Os03g0380600		Conserved hypothetical protein.
1335	16	60	Os03g0704400|mRNA|AK101297|CDS+3'UTR	TTTTTTGTGGTGCCCTTGGCATTGTACGCTCCATATTTGCGTGAGTAGGAAACTTGGAAG	Os03g0704400	AK101297	Protein kinase domain containing protein.
1336	16	61	Os04g0166300|mRNA|AK064066|UTR	GAGGCGTTGAGGCGCAGATCCAAGTTTTGGGGATCAACAAGTGACAAGAGTAAAGATTAA	Os04g0166300	AK064066	Non-protein coding transcript, uncharacterized transcript.
1337	16	62	Os12g0471100|mRNA|AK069404|CDS+3'UTR	CCATACATAAAATGGAATAATATAAAATTAGTGGTGTAACACTACTTATTTTCTCGATCT	Os12g0471100	AK069404	Similar to ATPase 2.
1338	16	63	Os03g0569900|mRNA|AK119985|CDS+3'UTR	GTGGCTGTACTAAAAACTGCAACATCTGCAATTTGGAATGTTTGGTCAACCAGTTGGATC	Os03g0569900	AK119985	Similar to RNA Binding Protein 45.
1339	16	64	Os06g0622700|mRNA|AK107021|CDS+3'UTR	TTGGTTCCTTCCCCCCTTGTTTTTATAATATCCTCCTATGCATAATGCATTATCCAGGTA	Os06g0622700	AK107021	Eukaryotic transcription factor, DNA-binding domain containing protein.
1340	16	65	Os05g0263200|COMBINER_EST|Os05g0263200|8	TCTTTGGAAAGCTTATCAAGTCAGCTTTCCAATGCCACCAATACCAAATCGGGACAACAA	Os05g0263200		Retrotransposon gag protein family protein.
1341	16	66	Os07g0191200|mRNA|D31843|CDS+3'UTR	ATACTATATACAAACTCTTTTTACTACTAGATGATATAATAGTTCAATTTTGTTTTGTCA	Os07g0191200	D31843	Plasma membrane H+ ATPase (EC 3.6.3.6).
1342	16	67	Os02g0108500|mRNA|AK063089|CDS+3'UTR	CCGGCCGTTTTCCGTCATCGATTCTCGTCACCGTCACCACCGGTGAGTTCGTCTCGTCGT	Os02g0108500	AK063089	Non-protein coding transcript, unclassifiable transcript.
1343	16	68	Os01g0551000|mRNA|AK071219|CDS+3'UTR	TTTGTAAATACCCCGGGATGCTCAGGAAAACAAAATGTAATAAACCAAACATTGGCTTGG	Os01g0551000	AK071219	Conserved hypothetical protein.
1344	16	69	Os06g0204400|mRNA|AK100462|CDS+3'UTR	ACAAAAGCGTTCCATGATTGTAGCTGGTTAATTTGCATGTCTACCATAATGCGTCACCTG	Os06g0204400	AK100462	Similar to Aminoalcoholphosphotransferase.
1345	16	70	Os11g0264300|mRNA|AK068456|CDS+3'UTR	CAATTGGAAGTGATAACTCTGCAGGATAGTTTTTTCAGTAAATTGTTTGAATAGTTCCTT	Os11g0264300	AK068456	Plant regulator RWP-RK domain containing protein.
1346	16	71	Os05g0417300|mRNA|AK073207|CDS+3'UTR	ATATTTTGTTGCCAACTTACATGAAAGTCAGTGAACTCGCTGAACCGATATGGATATGGG	Os05g0417300	AK073207	Conserved hypothetical protein.
1347	16	72	Os04g0630000|mRNA|AK060199|CDS+3'UTR	CTACTGGCCAAAATTTTGACTCCTTCAGTTAATGATTTTCGTATACAAATATGGTTTCAC	Os04g0630000	AK060199	SDA1 domain containing protein.
1348	16	73	Os06g0726200|mRNA|AK104020|CDS+3'UTR	TTACATCGATGAATAAGAATTCATCCGAGCAGACAAATAATACAATCATCAGTAATGCCC	Os06g0726200	AK104020	Endochitinase precursor (EC 3.2.1.14).
1349	16	74	Os09g0514400|mRNA|AK098845|CDS+3'UTR	TGAGGTGCCTAGCTACATTTGTTATGAACTTTCCTTGGGCATAACTGATCACTGATATTA	Os09g0514400	AK098845	Similar to Protein farnesyltransferase/geranylgeranyltransferase type I alpha subunit (EC 2.5.1.58) (EC 2.5.1.59) (CAAX farnesyltransferase alpha subunit) (Ras proteins prenyltransferase alpha) (FTase-alpha) (Type I protein geranyl-geranyltransferase alpha subunit) (GGTase-I-alpha).
1350	16	75	Os03g0226300|mRNA|AK111731|CDS+3'UTR	TGATTGTTCGCATTACGCTGTCAGCTGTTATGGGTTAGTAGTTATAACTTTCTCACTATG	Os03g0226300	AK111731	Similar to Pto kinase interactor 1.
1351	16	76	Os12g0598900|COMBINER|CI222854|6	TTCCGAGGCCTTCGGGCCCCCTTCTTGTATAGACTGATTTAATCTGTAATCAAATAAAGA	Os12g0598900	CI222854	(No Hit)
1352	16	77	Os10g0420200|mRNA|AK110922|CDS+3'UTR	AATTCTTGTCAAACGATTCCGTGTTCCAACTGTTGATAGAGATGTGAGCAACACAACGTG	Os10g0420200	AK110922	IQ calmodulin-binding region domain containing protein.
1353	16	78	Os04g0517700|COMBINER_EST|Os04g0517700|8	CGGACCATCTACAATTAATAGTGGTCTTGAGATTGAAACAAGTAGTACCGGCTATCTTGG	Os04g0517700		EGF-like calcium-binding domain containing protein.
1354	16	79	Os04g0446600|mRNA|AK106628|CDS+3'UTR	CCTGTGAAAAACCGTTGTAATATGTTGCTCTACAAAACGATGATATATGATGATATACCC	Os04g0446600	AK106628	Conserved hypothetical protein.
1355	16	80	Os07g0510200|mRNA|AK069383|CDS+3'UTR	GCTTTTCCTTCTAGGTAAGGGTAGGAGAAGTGCAGCAAGCAACCATGTGTGGTTTTATGA	Os07g0510200	AK069383	Glycoside hydrolase, family 17 protein.
1356	16	81	Os02g0625500|mRNA|AK059188|CDS+3'UTR	TGCCGTGATTTTTGTTTCACTGCTGCAAACCTTACTTTATTCTCGGTATAAGGCACAATT	Os02g0625500	AK059188	Similar to Adenosine kinase-like protein (Fragment).
1357	16	82	DarkCorner		
1358	16	83	DarkCorner		
1359	16	84	DarkCorner		
1360	16	85	DarkCorner		
1361	17	1	DarkCorner		
1362	17	2	DarkCorner		
1363	17	3	DarkCorner		
1364	17	4	DarkCorner		
1365	17	5	Os10g0495100|mRNA|AK059574|5'UTR+CDS	GATCAATGAAGGACTAACCCCTGACATCATTGTATATACCCCCCTAATTCATGGTTTTTG	Os10g0495100	AK059574	Similar to Fertility restorer.
1366	17	6	Os08g0491100|mRNA|AK060215|CDS+3'UTR	AAGATGGCTGTATCACCTTTCTTTTTGCTGAAGATCTTCGGAATGATCATATCTGTACAT	Os08g0491100	AK060215	Conserved hypothetical protein.
1367	17	7	Os04g0185100|mRNA|AK119406|CDS+3'UTR	CATCGTGTGTAAACTCTATTTGTAAAGCCTTGAATGGCATCAATCCAGAAGAAAGGATGT	Os04g0185100	AK119406	Conserved hypothetical protein.
1368	17	8	Os08g0277900|mRNA|AK072643|CDS+3'UTR	TGCCCAACAATATGTCTGAGACTACCACTCACGTGGAATTTGTTGGATTGCAATGAGAAG	Os08g0277900	AK072643	Similar to Syntaxin 52 (AtSYP52).
1369	17	9	Os03g0100900|mRNA|AK061783|CDS+3'UTR	ACTGATTTGTTTGTACAAATGAATGATTTGCAGTTGTGGAAGTTGAATAGATGTTCGGTC	Os03g0100900	AK061783	Protein of unknown function DUF862, eukaryotic domain containing protein.
1370	17	10	Os10g0422200|mRNA|AK103743|CDS+3'UTR	TGTTCTTTCATTAGCTTGTACCAGCACCTTTATTGATGAGGAAATGATGCCAAATGTTGG	Os10g0422200	AK103743	Similar to Homocysteine S-methyltransferase 3 (EC 2.1.1.10) (S- methylmethionine:homocysteine methyltransferase 3) (SMM:Hcy S- methyltransferase 3) (ZmHMT-3).
1371	17	11	Os02g0642200|mRNA|AK105194|CDS+3'UTR	GTGTGTACTTTTTTTTCTTTGGAAAAATTGGAACCATGCCATTATAATTTTGTAAAATTT	Os02g0642200	AK105194	Similar to Remorin.
1372	17	12	Os05g0405000|mRNA|AJ004966|CDS+3'UTR	TGCCATGGTAATGTACCAAACAGCGATGACGACGAAGAATCGAATAAAGGTGGTGATTAC	Os05g0405000	AJ004966	Orthophosphate dikinase precursor (EC 2.7.9.1).
1373	17	13	Os04g0686300|mRNA|AK070132|CDS+3'UTR	CCTGTAAACGGTTAATTAATTTGCCTAGCGAGTTTACAAGATGAAAACTTTGGTCATCGC	Os04g0686300	AK070132	Protein of unknown function DUF167 family protein.
1374	17	14	osa-miR167b|Os03|Mature	TGAAGCTGCCAGCATGATCTATGAAGCTGCCAGCATGATCTATGAAGCTGCCAGCATGAT			miRNA
1375	17	15	Os01g0778500|COMBINER|CI411050|0	TCCCTCTTTGGATGAGTGGCGAAGAAGAAGATGAACAGGAGTTGAATCTCGCGAGATTTA	Os01g0778500	CI411050	Conserved hypothetical protein.
1376	17	16	Os06g0709500|COMBINER|CI436641|6	GGTAAGCACAAGGAGGGCAAGAATGAACTTTATCATGACACCAAGTTTGCATGCGCACAA	Os06g0709500	CI436641	(No Hit)
1377	17	17	POsControl0043|art		
1378	17	18	Os04g0218600|mRNA|AK103472|5'UTR+CDS	TGTCCACCAGAGAATGTGATCGATATCATATTGAAATCCGCCGAAGATCTCAATGGAAAA	Os04g0218600	AK103472	Conserved hypothetical protein.
1379	17	19	Os04g0578800|mRNA|AK072395|CDS+3'UTR	TGGGATGGAAACGGAAACGAGGGTCTCACCTCTGTTCTGGGGGCATGGTCTACTCGTGAA	Os04g0578800	AK072395	Protein of unknown function DUF604 family protein.
1380	17	20	Os10g0356600|COMBINER|CI321280|1	GTATGCAAGATGGAAAACAGATATGGGACACTCTAGAGAAGCATCTCCCAATGGATTTAC	Os10g0356600	CI321280	(No Hit)
1381	17	21	osa-miR167g|Os03|Mature	TGAAGCTGCCAGCATGATCTGTGAAGCTGCCAGCATGATCTGTGAAGCTGCCAGCATGAT			miRNA
1382	17	22	Os10g0518300|mRNA|AK099732|CDS+3'UTR	CAGGCGAGTAGGTTGTGTGAACTGCTGTCCTATCTCCCTCTCAAAGAAGGAATAAAATGT	Os10g0518300	AK099732	Protein prenyltransferase domain containing protein.
1383	17	23	Os02g0261400|COMBINER_EST|Os02g0261400|8	AGGATCAACTCAAGAAACTAAAAGCATCAACGCCAGGTTTACGTGGTAAAGCATGTCCTC	Os02g0261400		Conserved hypothetical protein.
1384	17	24	Os06g0145300|COMBINER_EST|Os06g0145300|8	CACATGGATGCCTTCGAGACCAGCTGGTTTCAAACAGCAGCAGGGGACGTGACAGTCTGA	Os06g0145300		Transferase family protein.
1385	17	25	Os11g0641300|COMBINER_EST|Os11g0641300|8	AGGATGCCGTCGATCCTGAGGGTGCCGTCCAACATCAACGAGAAGTCGTCGAGCTTCATA	Os11g0641300		Conserved hypothetical protein.
1386	17	26	Os12g0618400|mRNA|AK107860|UTR	GTAGTTGGGTTTCGTGATTGAACACCTAAGGAAAGGAAGCTTGATAAATGGAAGATAGTC	Os12g0618400	AK107860	Hypothetical protein.
1387	17	27	Os09g0442800|mRNA|AK071116|CDS+3'UTR	TTCATGTTCCTTGGTGCGTGCAGACATTGTAAAACAAAGAAAGTTTGTTCTGGAATCTTG	Os09g0442800	AK071116	Conserved hypothetical protein.
1388	17	28	Os02g0816500|mRNA|AK120302|CDS+3'UTR	CTGAACCATCCTTACTTTATGTGCTTGCTTGTTCTTCCTGAAGTACACAGTTAAGCATGG	Os02g0816500	AK120302	Tubulin binding cofactor A family protein.
1389	17	29	Os05g0506800|COMBINER|CI434600|0	ACCACCATCACTGATTTGTTGAGAGCAAAAACCATGACATGATTAATCCTAGCAGCATGG	Os05g0506800	CI434600	Lipolytic enzyme, G-D-S-L family protein.
1390	17	30	Os07g0458800|mRNA|AK111873|CDS+3'UTR	TGGTTTACTTGTTCGCATATCAAAAGATTGATAAATTCGAGTTTTTATTATTTGTTTGGT	Os07g0458800	AK111873	Ribosomal protein S16 family protein.
1391	17	31	RC4		
1392	17	32	Os02g0810900|mRNA|AK070982|CDS+3'UTR	GGTACGTCGTATAGCGCTGTTGCATTGTTTGGAGGTAAATTATATATCTTAGCCTTTAAT	Os02g0810900	AK070982	Similar to NAC-domain containing protein 21/22 (ANAC021) (ANAC022). Splice isoform 2.
1393	17	33	Os01g0276800|mRNA|AK102926|CDS+3'UTR	TTTCTATGCCACCCCAAAGATGCTAGACTGTTGTTTGTAACAATCTGAGTGTTTCTGAGT	Os01g0276800	AK102926	Virulence factor, pectin lyase fold family protein.
1394	17	34	Os05g0572900|mRNA|AK103180|CDS+3'UTR	TAAAGTCGCAGCTCCAGAGGACAAGTGAAGTTAGGACATGGACATGGAAATGCAATCATT	Os05g0572900	AK103180	Protein prenyltransferase domain containing protein.
1395	17	35	osa-miR164d|Os02|3'seq	CGGCGGGGCTGGCTGGCCGGCCGGCTTGCAGCATGTGCGCTCCTTCTCCAGCATGGCTTC			miRNA
1396	17	36	Os02g0673500|mRNA|AK073183|CDS+3'UTR	ATATGTGCATTGCATCATTAAGAGATATTCTCTCCATTTAGTGTTGGTCATTCCAAGATG	Os02g0673500	AK073183	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
1397	17	37	Os01g0348800|mRNA|AK062553|CDS+3'UTR	ACCTCAAACCTTGCCTTGTTATTATTTACAAAGTGTGTGCCGTCATTGAATAAAGAATTG	Os01g0348800	AK062553	Similar to Salt-stress induced protein (Salt protein).
1398	17	38	Os02g0201500|COMBINER_EST|CI453125|1	CATGCAACATAATAACCTAACTAACAAGAGAGAATGTAAGAAAGCGGTAAGCTGCTCGCT	Os02g0201500	CI453125	EF-Hand type domain containing protein.
1399	17	39	Os02g0822600|mRNA|AK104610|CDS+3'UTR	GGGTTCAGAGTCTAGAGCAACTGATACTTGTCTTGTAATCTTGTTTAAAGGTGCACGTTC	Os02g0822600	AK104610	Similar to Chloroplast 50S ribosomal protein L9 (Fragment).
1400	17	40	Os08g0470000|COMBINER|CI478654|x	TGGGCCCACATTTCTTTTTTTGAATGACTAATGGGTCCCACGCATATTTTTTATTTGTAC	Os08g0470000	CI478654	(No Hit)
1401	17	41	(+)E1A_r60_a22		
1402	17	42	Os10g0351500|mRNA|AK102659|CDS+3'UTR	TGAGTTCCATGTATTTGCTGCAAGCTTCCTCAATACAGAAGCGTACAGTATAATCTTGAG	Os10g0351500	AK102659	Protein kinase domain containing protein.
1403	17	43	Os10g0407100|mRNA|AK066741|CDS+3'UTR	GTCATTGGGTAATAATAAGCGCTGGAAGTCTTAGCTGATATCATGGTTGACAAAAAAGAA	Os10g0407100	AK066741	Ribosomal L32p protein family protein.
1404	17	44	Os11g0670800|COMBINER|CI337534|6	TGACCACAGGAGCAAAATAATTTTGTTCCCAGGCATTGCTTTATGTGCTATGCAACTTGT	Os11g0670800	CI337534	(No Hit)
1405	17	45	osa-miR531|Os11|Mature	CTCGCCGGGGCTGCGTGCCGCCATCTCGCCGGGGCTGCGTGCCGCCATCTCGCCGGGGCT			miRNA
1406	17	46	Os03g0311000|mRNA|AK064126|CDS+3'UTR	ACATTACGTCTTTCAGTCCGTGCTGCTGACTATAAATATATAGTTCGCTGCTCTTCTCTC	Os03g0311000	AK064126	Conserved hypothetical protein.
1407	17	47	Os12g0538700|mRNA|AK063610|CDS+3'UTR	TTTAATGTTATCCCTCTCCAGCTCTTTTTTCCAATGAGAGCTGTGTTTTGTAACCTCGTG	Os12g0538700	AK063610	Similar to AT.I.24-1 protein (Fragment).
1408	17	48	(-)3xSLv1		
1409	17	49	Os01g0723200|mRNA|AK063794|CDS+3'UTR	AGCCGACCTGTTTTATCTTGCAAATTATTATGTGGTTTGATTATCCCTTTTTCTCCTCAG	Os01g0723200	AK063794	Similar to 40S ribosomal protein S19-like.
1410	17	50	Os03g0836000|mRNA|AK063598|CDS+3'UTR	CGCCTCGGCCGTTCTGTGACTGCGGAACATTAGCTATGTATGTATATTTGCCTAAGTATT	Os03g0836000	AK063598	Similar to Actin 7 (Actin 2).
1411	17	51	Os09g0410400|mRNA|AK072004|CDS+3'UTR	GAATTCTGAGGCACAATTCGCTAGTTCGGATGTTTGGTTTCCCATGTAAGGAATCTTACC	Os09g0410400	AK072004	Zinc finger, RING-type domain containing protein.
1412	17	52	Os01g0884200|mRNA|AK064579|UTR	AGCTCGGTTGGAAAATAAATGCGTCTGTTGTATTAATTCCACGCTTTTTCCTCGCATGGT	Os01g0884200	AK064579	Non-protein coding transcript, unclassifiable transcript.
1413	17	53	Os07g0147500|mRNA|AK062172|CDS+3'UTR	CTGGACTTGACTGCCAGCGGTGGTAATGAATAAGGCCGAGTAATGTTAATTCTAAGTTAT	Os07g0147500	AK062172	Similar to Photosystem II 10 kDa polypeptide, chloroplast precursor.
1414	17	54	(+)E1A_r60_a104		
1415	17	55	Os04g0312300|COMBINER|CI276250|6	ACACTTCCCTGACATGCCAACGGGGGACAACGTGTTGAACACACCAGCATGGGGACTTCA	Os04g0312300	CI276250	(No Hit)
1416	17	56	Os04g0548300|mRNA|AK063594|CDS+3'UTR	GAGTTCTATGCAAAGTTAACACTAACTGGAACATTCTGGAATATATTCATTTTGCTGTGT	Os04g0548300	AK063594	Armadillo-like helical domain containing protein.
1417	17	57	Os02g0823300|mRNA|AK099915|CDS+3'UTR	ATGTCCTGAACTGAACTGAACAGAAGAGACACTGGCAGTTACTCATATAGATTATTAATC	Os02g0823300	AK099915	Similar to Neuralized protein.
1418	17	58	Os03g0724600|mRNA|AK063718|CDS+3'UTR	GGGGATGATATACCCACTGGATTCATCTTGGTTTTCTGAATGCAAGGGTCAATTAGCACT	Os03g0724600	AK063718	Conserved hypothetical protein.
1419	17	59	Os04g0413000|COMBINER_EST|Os04g0413000|8	GTTGGAAGGTGGTAAATTGCGGGAGATCACAAAGTCATCTTTCTTGTCTCGAGATAGCCA	Os04g0413000		ABC transporter, transmembrane region, type 1 domain containing protein.
1420	17	60	Os05g0150500|COMBINER_EST|Os05g0150500|8	GGACGATCGCAGGTCCAAGGTGTAGAATGAAAATTCACAGCCTTTTTCAGGACATGGAAA	Os05g0150500		Conserved hypothetical protein.
1421	17	61	Os06g0320300|mRNA|AK071655|CDS+3'UTR	CGAGACATCGGAGTTTTGCTTCTGGTGATGAAAATTGTATGAACTAGCATCGGCTTATGG	Os06g0320300	AK071655	HMG-I and HMG-Y, DNA-binding domain containing protein.
1422	17	62	Os03g0621700|mRNA|AK109821|CDS+3'UTR	GAGAGGTATACATCCATCAATTTTGTAAAATTAAATCCAAAAGTGACAACAACTTGTGCT	Os03g0621700	AK109821	Conserved hypothetical protein.
1423	17	63	Os05g0569900|mRNA|AK069416|5'UTR+CDS	CAAGATGGGACTTTTGGTGTAAACTCCGATAATGATGTATCTATCCATGATTATCTTCCA	Os05g0569900	AK069416	Conserved hypothetical protein.
1424	17	64	Os05g0559400|mRNA|AK061439|CDS+3'UTR	GCTTCCTGTGTGATACTTTCATCAATTCTCTCATATATATATTATCTGGAGTTGCACTTG	Os05g0559400	AK061439	Similar to IAA11 (Fragment).
1425	17	65	Os04g0513900|mRNA|AK058333|CDS+3'UTR	ATAATGTTGATTAGAATGGATACATGATATCCACCTATATATATCCAATTTATTGGACAA	Os04g0513900	AK058333	Glycoside hydrolase, family 1 protein.
1426	17	66	Os01g0808400|mRNA|AK112112|CDS+3'UTR	TTCATGGCATGGTATTACATGCACCTAAAATGATGAAATTAATTGGAAGGGATGGTGAGC	Os01g0808400	AK112112	Similar to Calcium-dependent protein kinase (Fragment).
1427	17	67	Os12g0128600|mRNA|AK120379|CDS+3'UTR	ATGTAGAATCTACTATAGTTGATGCTAGAAACTATACCTAAGGGGCATCACTTGCTTTTT	Os12g0128600	AK120379	Zinc finger, Tim10/DDP-type family protein.
1428	17	68	Os01g0290100|mRNA|AK069735|CDS+3'UTR	ATTTTCAAGCTGTAATGTAAGAACAACAATAATCTGAATCCAAGGAGAATTGCCGCCGCT	Os01g0290100	AK069735	Aminotransferase, class V family protein.
1429	17	69	(+)E1A_r60_a104		
1430	17	70	Os03g0775300|mRNA|AK100507|CDS+3'UTR	ACATGGAGCTCTGTTTTATTTCTCTGACCAGATGGTTTAAAAATGTTGTGATGTTTTTCG	Os03g0775300	AK100507	Flavodoxin/nitric oxide synthase domain containing protein.
1431	17	71	Os02g0316900|mRNA|AK070114|CDS+3'UTR	GGACTTCTAAATGGATACATAGAGGATTCTAATGTGCAACCAGATGATTTGCCTACTCAT	Os02g0316900	AK070114	Conserved hypothetical protein.
1432	17	72	Os07g0493400|COMBINER_EST|Os07g0493400|8	GCAGCAGTAGAAACTTACAATTGGTATCTTCAAAAGTTTGAAGACTATCCTCGCTCTCGC	Os07g0493400		3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
1433	17	73	Os09g0249700|mRNA|AJ243828|CDS+3'UTR	TTGAGCAAGATCGGACACATTATTATGTTTGTTTACATGGTAGTTTTGGGCCTTGGTTTC	Os09g0249700	AJ243828	Protein phosphatase 2A A subunit (Phosphatase 2A regulatory A subunit).
1434	17	74	Os02g0640200|mRNA|AK069773|CDS+3'UTR	AAAGTAGATCAGTCACACGTGTAAGTTGATACTTAAGCATGTTTGCTATCCGAAACATTT	Os02g0640200	AK069773	Conserved hypothetical protein.
1435	17	75	Os08g0465800|mRNA|AB056060|CDS+3'UTR	GGGACTGACTGGCGGTGTACGGACATGGCTGCCCTTGTTCTTATGTTGAACTGTTGATGT	Os08g0465800	AB056060	Glutamate decarboxylase (EC 4.1.1.15).
1436	17	76	Os03g0624800|mRNA|AK100295|CDS+3'UTR	CCCAGACCCGACCTAATAAGAGGTGTATTTTGGACCTGTTAAAATTTACTCCTATTTACT	Os03g0624800	AK100295	Protein prenyltransferase domain containing protein.
1437	17	77	Os02g0105400|mRNA|AK103257|CDS+3'UTR	TCACTACAAGAGTGATCGACTCGACTGTAGTATGTGTGTGCAATATAATGTGCTGTCTAT	Os02g0105400	AK103257	Similar to L-lactate dehydrogenase A (EC 1.1.1.27) (LDH-A).
1438	17	78	Os06g0730600|mRNA|AK070316|CDS+3'UTR	TTACAATTTTGGCGTGGAACTAAACACAGCCTAATTGATGCAAGTCAGTCAGACATTAGC	Os06g0730600	AK070316	Peptidase S9A, prolyl oligopeptidase family protein.
1439	17	79	Os05g0466000|mRNA|AK064529|UTR	AGGCAGCAAAGCTATTCCACTATCTTGATTCTATGACAGTTGAAAGAGATATAAGCATCT	Os05g0466000	AK064529	Non-protein coding transcript, putative npRNA.
1440	17	80	Os01g0728100|mRNA|AK070946|CDS+3'UTR	AACTGTACACCGAATAGATGTATTCCTCATTCTTTGTATGCATGGCAACCTTTTTCTCAA	Os01g0728100	AK070946	Lipolytic enzyme, G-D-S-L family protein.
1441	17	81	Os03g0812300|mRNA|AK108409|UTR	TTTGCTCAGGAAACTTCGGAACCATTTCCACGTGAGGACTCTTGTCTGTACCAATCTTGT	Os03g0812300	AK108409	Non-protein coding transcript, unclassifiable transcript.
1442	17	82	DarkCorner		
1443	17	83	DarkCorner		
1444	17	84	DarkCorner		
1445	17	85	DarkCorner		
1446	18	1	DarkCorner		
1447	18	2	DarkCorner		
1448	18	3	DarkCorner		
1449	18	4	Os12g0152800|mRNA|AK071572|CDS+3'UTR	ACATCTCTACATGTTGATGCCATAGCATATTACTGTAGGAAAATTTGTTCCTTTTCACTC	Os12g0152800	AK071572	Conserved hypothetical protein.
1450	18	5	Os01g0886200|mRNA|AY551913|CDS+3'UTR	TGTGGTATTGTACGTATAGTACGCTGGTAGACCTACGTATACGTATACGTATGTATGATG	Os01g0886200	AY551913	Similar to AGAMOUS homolog.
1451	18	6	Os08g0564300|mRNA|AK121506|CDS+3'UTR	AGATGTTCTAAGAATGAATTAATGAAATGAATTACTATACTGCTAGCTAGCTAGCTCATG	Os08g0564300	AK121506	ABC transporter, transmembrane region domain containing protein.
1452	18	7	Os07g0636900|mRNA|AK102097|CDS+3'UTR	CTTTCGTATGCGTGTTTGAGCTGGATTTTTCACATTTTTGTCCTTTTAAAAAACTTATTT	Os07g0636900	AK102097	Protein prenyltransferase domain containing protein.
1453	18	8	Os08g0236700|COMBINER_EST|CI442539|6	TCCATGATACGTCTTGTCGTAGTTCCACATGTTTTCTCAGATTTTCATCCTTGAAACAGG	Os08g0236700	CI442539	Conserved hypothetical protein.
1454	18	9	Os03g0764300|mRNA|AK068541|CDS+3'UTR	GTGTTGTTTTTGCTATTGTGTAACCACACCACGATGTAATCATTGTTGATTTTTTGAGGC	Os03g0764300	AK068541	Protein kinase-like domain containing protein.
1455	18	10	Os07g0599600|mRNA|AK070771|CDS+3'UTR	ATGATCATGTAAACTGTGGTGTTTGCTAGGAATGTGTGAGTGATGCTTGATGTTTCAGCC	Os07g0599600	AK070771	Conserved hypothetical protein.
1456	18	11	Os05g0112000|mRNA|AF272860|CDS	CCATTGAGGTGCAAGACTGTGGACATCAAATGTGTGCACCGTGCACGCTGGCACTGTGCT	Os05g0112000	AF272860	Zinc finger, RING-type domain containing protein.
1457	18	12	Os08g0502700|mRNA|AK065126|CDS+3'UTR	ATGCTAAGGAGTAAGGAGTATAATTTTGTGAAGGTACTGCAGCTTTTACTTAATTAATCT	Os08g0502700	AK065126	Aminotransferase, class V family protein.
1458	18	13	Os04g0183500|COMBINER_EST|CI276824|6	GTGGTACATTATTGGTACAGACAAACTGATATCAATTTGTTCAAGAAGAGCAAACTCTAC	Os04g0183500	CI276824	Amidase family protein.
1459	18	14	Os01g0717000|mRNA|AK062152|CDS+3'UTR	AGGCCGCTTGTGGGGCTAGTAGTGCCGTCGTGTTTCATGTGTATGTATACCTAAATATAT	Os01g0717000	AK062152	Similar to GmCK1p (EC 2.7.1.32).
1460	18	15	osa-miR169o|Os11|Mature	TAGCCAAGAATGACTTGCCTATAGCCAAGAATGACTTGCCTATAGCCAAGAATGACTTGC			miRNA
1461	18	16	Os01g0616800|mRNA|AK111368|CDS+3'UTR	AGGATTAGCGATTGGTTTATCTATCAAAGAGATGGTTTATAAGAGATGATAAGTCACCTG	Os01g0616800	AK111368	Pentatricopeptide repeat containing protein.
1462	18	17	Os03g0431100|mRNA|AK058643|CDS+3'UTR	TAATATCTCACTCTCCCCGTGTTAGTGACTACAAATCGAGCCTCACGTCGAGACATCTTT	Os03g0431100	AK058643	XYPPX repeat containing protein.
1463	18	18	Os10g0189200|COMBINER|CI330756|6	TATGTTTCCTTTTCCTCTGCCTCACTACACCAATTGGTCTTCCAGTTGAGTAGTGAGTCG	Os10g0189200	CI330756	(No Hit)
1464	18	19	Os04g0303300|COMBINER|CI427075|x	GTCCAAGATGAAATAGGCGGCTACTGAGCACAAGAAAATCCACCGATCTATGCACATCAT	Os04g0303300	CI427075	Curculin-like (mannose-binding) lectin domain containing protein.
1465	18	20	(+)E1A_r60_a107		
1466	18	21	Os08g0485400|mRNA|AK100705|CDS+3'UTR	AGGGATATTCGTCGGTTCGCTGGTACTGTTCCTAATGCGACAACAACAGGTGATATTGAT	Os08g0485400	AK100705	Similar to 2-nitropropane dioxygenase-like protein.
1467	18	22	Os03g0241900|mRNA|AK111568|CDS+3'UTR	GTACTGATTTGTAACCTGTCGAATTACTATATGTGTATACATGATGCACAGTGATCTCAC	Os03g0241900	AK111568	Similar to Senescence-associated protein 12.
1468	18	23	Os04g0553800|mRNA|AK068076|CDS+3'UTR	TTTCTTGTAATTGATATCATCAGTTCCACACGTCCACTATCATGAGATTCAGGTGTTCTT	Os04g0553800	AK068076	Glycosyl transferase, family 8 protein.
1469	18	24	Os09g0473500|COMBINER_EST|AU101866|7	CAGTTCAAGCGACGATATTATATTTTGCTGCAGTTGCATTATAAAGGTGAGTCTCATTCC	Os09g0473500	AU101866	Conserved hypothetical protein.
1470	18	25	Os08g0104900|mRNA|AK063987|CDS+3'UTR	TTTGCTCGTAACTATGCTACTATTGCTACACATTTGATCACACAGCATTGTTCAGTTGAC	Os08g0104900	AK063987	Protein of unknown function DUF6, transmembrane domain containing protein.
1471	18	26	Os11g0582700|mRNA|AK103872|CDS+3'UTR	GTGTATATTCTATATTCTGTTCTGTGACTTCCATTCAGCCATGTTGCTACAATCTTGGTT	Os11g0582700	AK103872	Protein of unknown function DUF295 family protein.
1472	18	27	Os10g0396600|COMBINER|CI543163|6	GAGCTAAGCCTTGATTAGAACTGCAGCGGGAACACCACTCCACAGGCATCCTTGACGGCA	Os10g0396600	CI543163	(No Hit)
1473	18	28	Os02g0541700|mRNA|AK062186|CDS+3'UTR	TTTATTTCTGCCAGAGGCATTGAACTCTCTACATCTGGGTTCGTACTGCGTTATTGGCTC	Os02g0541700	AK062186	Similar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7).
1474	18	29	Os02g0521700|mRNA|AK063046|CDS+3'UTR	CCCAGTACAGTGTTAATAACATTGTCAACTTTCATTATCTGGGTCGCCAAGTTTGGGCGT	Os02g0521700	AK063046	Conserved hypothetical protein.
1475	18	30	(+)E1A_r60_1		
1476	18	31	Os08g0135900|mRNA|AK069187|CDS+3'UTR	TTTGCTCCGTAGTATGCTGTGTTCTCTCTGAATCTTCAGTTGTCTTGTTACTTTGTGAAG	Os08g0135900	AK069187	Similar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment).
1477	18	32	Os07g0609000|mRNA|AK104294|CDS+3'UTR	CAGTGTTCATCTTTTCTTCTCGCTCTGCAACTGCAAATTTGTATGTCAGATAATTTTAAG	Os07g0609000	AK104294	Dimeric alpha-beta barrel domain containing protein.
1478	18	33	Os05g0489600|mRNA|AK120035|CDS+3'UTR	TTTTGTACCTCTGTACTCGCCACAGATGTTGTAGTATTGACTTGTCTTGGGCATAGCGTA	Os05g0489600	AK120035	Similar to ADP-ribosylation factor 1.
1479	18	34	Os11g0431300|COMBINER_EST|Os11g0431300|8	ATTCAACTGACCTCGGGTGGACCATCACGGCAAAGCCTTCAATCATCCTTATGAATGAAA	Os11g0431300		"Peptidase S10, serine carboxypeptidase family protein."
1480	18	35	Os06g0699300|COMBINER_EST|CI119313|6	AACCGATTCTCCTCAAGGACTGCGACAAGATTGAAGCTCATGCTTAGCAGGAAAACCATT	Os06g0699300	CI119313	"Zn-finger, CCHC type domain containing protein."
1481	18	36	Os04g0382300|mRNA|AK071912|CDS+3'UTR	TACGACAATGGTTCCAAATGGATGGGAATAGTGTACAGTTTGCCTTGTGTAGTTCTTTGG	Os04g0382300	AK071912	Similar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1).
1482	18	37	Os12g0194700|mRNA|AK121912|CDS+3'UTR	GTTTTCATGGTCAATGGACATCTCGGTCATTTATCCTGTTTAGCGATGTATGTTGCCTGG	Os12g0194700	AK121912	DNA-directed RNA polymerase, 13 to 16 kDa subunit family protein.
1483	18	38	Os04g0380200|mRNA|AK104271|CDS+3'UTR	TGCAAATATAATGTAGGGAAAAAGTATACATGTTTACTTGTTAATTGTCATTGATGATTT	Os04g0380200	AK104271	Conserved hypothetical protein.
1484	18	39	Os03g0702100|mRNA|AK063307|CDS+3'UTR	GGCAGTACCGCCCGTGGGTTTGGACTTTGTATACTTTGGAGGTTTACCAAGCTTGCTCCG	Os03g0702100	AK063307	Conserved hypothetical protein.
1485	18	40	Os05g0407200|mRNA|AK111298|UTR	TGGCTTGATGGTAACATTGTCAAACTGATCCTTCGTGTTGTGCAATATAAGCTGAACTGT	Os05g0407200	AK111298	WD40-like domain containing protein.
1486	18	41	Os09g0347500|mRNA|AK062048|CDS+3'UTR	GTTATGCCAATAGTTGGATCTTCTTGCAAATGAAAGTACTTCTCGGCCGGCTGTTTATGG	Os09g0347500	AK062048	Similar to Protein transport protein Sec61 alpha subunit isoform 2 (Sec61 alpha- 2).
1487	18	42	Os07g0191900|mRNA|AK107253|CDS+3'UTR	GATTCATTTTGTGTACTCCTTCATCCACACAAGATGGTCAAAAACGTCTCTGCCCATGAC	Os07g0191900	AK107253	Conserved hypothetical protein.
1488	18	43	Os02g0684500|COMBINER_EST|CI032284|0	TGGTTGTGATTTGCTCATTTCCATAGATGTAATGACATTACGATTTCAATCGTAGCAATT	Os02g0684500	CI032284	Similar to Histone H4.
1489	18	44	Os02g0261600|COMBINER_EST|Os02g0261600|8	GTTGGTCTATGAGATCTCCAAAAATAGGAAGAAATCCCTACGGCAAGGGAAAGAAGACGA	Os02g0261600		NB-ARC domain containing protein.
1490	18	45	Os03g0862200|COMBINER_EST|CI086701|6	ATTTGCATCCCCTCCGTGTGTTGGGCATGGGCATATTTGCTTAGAGGGTGTGTATAATAT	Os03g0862200	CI086701	Similar to Kinesin heavy chain (Fragment).
1491	18	46	Os04g0527400|mRNA|AK064991|CDS+3'UTR	ATCTCAAGAGCATTGTACAGGCGAATCTTATTCTGACAAAGGAAATGCTTTGCCAAAAAA	Os04g0527400	AK064991	Conserved hypothetical protein.
1492	18	47	Os06g0203200|mRNA|AK106056|CDS+3'UTR	TGTTGGGCTTTCAGAAAGGGGAAAATAAGTTGGGCTGCGATATGAAGAGGAAAATAAGTC	Os06g0203200	AK106056	Flavin-containing monooxygenase FMO family protein.
1493	18	48	Os01g0743300|mRNA|AK069026|CDS+3'UTR	GAGCAAAGCTTTGGAAAGTAAACTGTATCAAAATAGGACTCGAGGGAATAAAGGGTACAT	Os01g0743300	AK069026	Protease-associated PA domain containing protein.
1494	18	49	Os05g0304400|mRNA|AK073143|CDS+3'UTR	GAGTAGATTTTACCGAGTCATGCGAATGAAAATTATAATTTAACAGCTTAACCTACCCAG	Os05g0304400	AK073143	Similar to GDP dissociation inhibitor protein OsGDI2.
1495	18	50	Os08g0305000|mRNA|AK102896|CDS+3'UTR	TGGTTAAAAGACGATAAGACTGCTAGCTACTATCATAAACATGAATGTCACAAAATCTGG	Os08g0305000	AK102896	Hypothetical protein.
1496	18	51	Os01g0372400|mRNA|AK108314|CDS+3'UTR	TGATGCTTGCTACTGTTTTCTTTTTCTTAAAAAAAGAGAATCATACTCTCTCATTCCCAT	Os01g0372400	AK108314	Glutathione S-transferase, N-terminal domain containing protein.
1497	18	52	Os05g0560900|mRNA|AK063973|CDS+3'UTR	ATGCTTACTGCGCCATACGAGTGTACCTATATGTGTGCTATATGTGTGCTACCTCCGTTC	Os05g0560900	AK063973	Isopenicillin N synthase family protein.
1498	18	53	Os01g0924000|mRNA|AF050674|CDS+3'UTR	AACAATGTTTGGAATGTAAATCATCAACTATGAGATGAATACAAGGCCCATCTTCAACTC	Os01g0924000	AF050674	Similar to Chloroplast 50S ribosomal protein L27 (Fragment).
1499	18	54	POsControl0048|art		
1500	18	55	Os09g0453200|COMBINER_EST|Os09g0453200|8	ATTAGTCAAGCTTGAAACCTCTGTCCAAGCAATACATGAAAACCTGCTCTTGCTGAGATC	Os09g0453200		emp24/gp25L/p24 family protein.
1501	18	56	Os03g0149800|mRNA|AK109394|CDS+3'UTR	CATCTCAAGTGTTCCCGCCCGGACATGTCAATCTTTCGTACGTGATCGATCGATATTAAT	Os03g0149800	AK109394	Similar to RING-H2 finger protein ATL1D.
1502	18	57	Os10g0415300|mRNA|AK108799|CDS+3'UTR	AAAGAAAGAAATGCTTCAGGATGTTGATAGTATTGCCGCATGAAATTTTTTGATTAAACA	Os10g0415300	AK108799	Similar to Glutathione reductase (Fragment).
1503	18	58	Os05g0511800|COMBINER_EST|Os05g0511800|8	GGAGGAGGTGAGTGGCCTCGTGGTGTTCGCCGGTCAAGTCGTCAACCCATTGCTCCATTG	Os05g0511800		Proteinase inhibitor I4, serpin family protein.
1504	18	59	osa-miR398b|Os07|3'seq	ACACGGTGATGAGGCGGTCTGGTCTTTCGTGTGTTCTCAGGTCGCCCCTGCCGGGACTCT			miRNA
1505	18	60	Os11g0414000|mRNA|AK059141|CDS+3'UTR	CTGATCCTAATAGTCTACTGAATGTTAAAATCCCATGCAAGAAGTTATTCCAGGATTTGC	Os11g0414000	AK059141	eIF4-gamma/eIF5/eIF2-epsilon domain containing protein.
1506	18	61	Os12g0479400|mRNA|AK060796|CDS+3'UTR	CGGTAATCGGTGTACCCCTCAAGAAGGCAAGGCAATTTGACCCTAAAATGTTGCCATTTT	Os12g0479400	AK060796	Similar to Auxin response factor 1.
1507	18	62	Os04g0680300|mRNA|AK121081|CDS+3'UTR	TGAAATTCGCAGTCCACCTTAGGCTGGGCTAGATGCTAACAAGATCTTAACGATAAATCC	Os04g0680300	AK121081	Conserved hypothetical protein.
1508	18	63	Os07g0258700|mRNA|AK106061|CDS+3'UTR	CATCAAACACACTCAGTATGAACAAAAAACTAAGTGTAAACTATTTGCAACGTTGAACGG	Os07g0258700	AK106061	BTB domain containing protein.
1509	18	64	Os06g0715400|mRNA|AK073963|5'UTR+CDS	ATCAGAGAAGCAGTTTGAAACAATGGAGAAACTCTTCGACAGGCTAGTTGCAAGAACCAA	Os06g0715400	AK073963	t-snare domain containing protein.
1510	18	65	Os10g0454500|COMBINER_EST|CI192435|6	TTGTTCTCATTTATTTGTACTTGTTTCATGTGTTGTGCAACCAAGAAATAAAGGGCTTCA	Os10g0454500	CI192435	Eggshell protein family protein.
1511	18	66	Os01g0139900|mRNA|AK121677|CDS+3'UTR	GTCAGTTTTGTTGGCTTTGTGCTTGTAGGCTTGTAGCTCCCTTCTTCTTGTATGATATAA	Os01g0139900	AK121677	Conserved hypothetical protein.
1512	18	67	Os04g0624600|mRNA|AK059368|CDS+3'UTR	CAGAATGGCATGTGACGGCCTGTGTAGCTTTTTAATTTCTCGTGCTGACATCTCAAAATT	Os04g0624600	AK059368	Similar to Starch synthase DULL1 (Fragment).
1513	18	68	Os02g0789100|COMBINER_EST|Os02g0789100|8	TAAGCTAAGAAAGCCGGATGAGCCAGATTTTTCAGCTGAACCCTCTCCGTTTTTCATGCA	Os02g0789100		Cyclic nucleotide-binding domain containing protein.
1514	18	69	Os09g0526700|mRNA|AB097460|CDS+3'UTR	CTTATATAGTACTAGTATCAAAATTGTCCATGGTCTTATGAACTGTGTGACTAGAAAATG	Os09g0526700	AB097460	Similar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase).
1515	18	70	Os02g0602100|mRNA|AK111593|CDS+3'UTR	GAAACTGGTACATAGTAATGCAAAATGTAAGGTAATATGCTGAGGCTTATTGTGTCCACT	Os02g0602100	AK111593	Similar to PITSLRE serine/threonine-protein kinase CDC2L2 (EC 2.7.1.37) (Galactosyltransferase associated protein kinase p58/GTA) (Cell division cycle 2-like protein kinase 2) (CDK11). Splice isoform SV7.
1516	18	71	Os09g0365100|mRNA|AK121161|UTR	TTTTTTCCAATGTCGCATGTGTGTGAAACATTTTTTACTACACAATGAAACATTTTTCAC	Os09g0365100	AK121161	Non-protein coding transcript, unclassifiable transcript.
1517	18	72	Os08g0546300|mRNA|AK119794|CDS+3'UTR	AAGTACTATGGAACAATCATGTAATGCCCGGTTGCTGGTTCATTAACGATGACCTCCTTT	Os08g0546300	AK119794	Conserved hypothetical protein.
1518	18	73	Os01g0276500|mRNA|AK099335|CDS+3'UTR	CATGTCTGGAATTTGCAGTGCTGTTCTTGCTGTCGCCAATAAAATAATAAAATCAGCTCA	Os01g0276500	AK099335	Similar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
1519	18	74	Os01g0282800|mRNA|X78142|CDS+3'UTR	TTCGTATGCTATCGCATATGTTTGGGGAGTGTATTGGATTCTTGTACTGGTTTTGATTGC	Os01g0282800	X78142	Similar to Tubulin beta-5 chain (Beta-5 tubulin).
1520	18	75	Os04g0112000|mRNA|AK073646|CDS+3'UTR	TAGCAGAGATAATTAAGAATGATGAACTACGAACTACAAAGTGATATGTTTAATTAGTTG	Os04g0112000	AK073646	Conserved hypothetical protein.
1521	18	76	Os08g0440800|mRNA|AK071520|CDS+3'UTR	ACCACAGTTCTCCCTGTATGTTGTTGGCTCTTTTACAATTAAGAATAATGCATGTTGAAG	Os08g0440800	AK071520	Glyceraldehyde-3-phosphate dehydrogenase.
1522	18	77	Os08g0183900|COMBINER_EST|Os08g0183900|8	CCAGCTTTCAATTATCCCCAAAAAGTGATTTTCTCAAAACTACGAGGGGAGGAGGAAGCT	Os08g0183900		NAD-dependent epimerase/dehydratase family protein.
1523	18	78	Os02g0743800|mRNA|AK064134|CDS+3'UTR	TCGAGATTTTGTGCTCTAAGCTCTGGTGGTTGTGCAAATGGATATCGGCATCTACAAAGC	Os02g0743800	AK064134	CS domain containing protein.
1524	18	79	Os11g0595900|COMBINER_EST|Os11g0595900|8	GTGCGGATAGCAGGTGCAGCAACATCAAGCATGGCTGAGAGCGAAGGATATCAACGGTAG	Os11g0595900		Hypothetical protein.
1525	18	80	Os06g0140800|mRNA|AK065683|CDS+3'UTR	TTCTCCTTTGCCATTCATAATGATGTGTTGTAAGCTTGTAATTAGTGCTCTCAACATTTG	Os06g0140800	AK065683	Protein kinase-like domain containing protein.
1526	18	81	Os11g0701200|mRNA|D55708|CDS+3'UTR	ACAAGGATGTGGTTTTGTCAATGATGTGCTTCTATGCTCATAAATAAATACACGGACTTA	Os11g0701200	D55708	Glycoside hydrolase, family 18 protein.
1527	18	82	DarkCorner		
1528	18	83	DarkCorner		
1529	18	84	DarkCorner		
1530	18	85	DarkCorner		
1531	19	1	DarkCorner		
1532	19	2	DarkCorner		
1533	19	3	DarkCorner		
1534	19	4	DarkCorner		
1535	19	5	Os02g0566700|mRNA|AK102754|CDS+3'UTR	CCCTTCTCAGGGCTTATCTTTGTTTTGGAAAAAGATAAGATGGGTTTTTAACATGAGGAA	Os02g0566700	AK102754	Conserved hypothetical protein.
1536	19	6	Os03g0622100|mRNA|AK063506|CDS+3'UTR	TTTAGGATGAAGGAAGTATGCACGTACGTACCTGGTGATGATCAAGCTTTCTGGTCTGAT	Os03g0622100	AK063506	Transcriptional factor B3 family protein.
1537	19	7	Os05g0485700|COMBINER_EST|AU101215|7	CCGGCCTAATTCATCGATCGATGCATATATAAGAACAAAAGAGGAGTGGAAACTGAAACG	Os05g0485700	AU101215	Hypothetical protein.
1538	19	8	Os01g0504500|mRNA|AK122047|5'UTR+CDS	CCAGACTCAAAGCCTAATATTTCCTATGGTTCTAAGCTCATCAATAACACTAGCACTCTT	Os01g0504500	AK122047	Multi antimicrobial extrusion protein MatE family protein.
1539	19	9	Os06g0107100|mRNA|AK068804|CDS+3'UTR	AATACTGTATTATTTATCAAGAGTAATACTATTATTATTAGAAGAAGAAGAAGAAAAGTT	Os06g0107100	AK068804	Protein of unknown function DUF819 family protein.
1540	19	10	Os04g0654500|COMBINER|CI560562|x	TGCCGTGCGGCGCCATTGCCGTGGCCGTAGTAGCTATAGTTGTGTACAGGTGGAGATAAA	Os04g0654500	CI560562	Conserved hypothetical protein.
1541	19	11	Os01g0138100|mRNA|AK107843|CDS+3'UTR	TCTTTGTATATTTTTCTCCTACTCTATATTGATAGGAGGCAAAGCTTTTGCCACTATTGG	Os01g0138100	AK107843	Conserved hypothetical protein.
1542	19	12	Os10g0119300|mRNA|AK063350|CDS+3'UTR	TCAAGAACAATCATGTTTCCCTTCGTCACAGGTGTTAATTCGTGGCTCGCCAATTTCTCT	Os10g0119300	AK063350	Actin-binding FH2 domain containing protein.
1543	19	13	Os06g0618100|mRNA|AK103787|CDS+3'UTR	TTCCCTCGGCGCTTCAGTCAAATTTTGTAATGCTTCGAATGCACTATATAACCTAGCAAA	Os06g0618100	AK103787	Zinc finger, CCCH-type domain containing protein.
1544	19	14	osa-miR166h|Os02|5'seq	GGTGGCTTGTGGGGAATGTTGGCTGGCTCGAGGTATCCACATCTTAATTCCTCTCCGGCG			miRNA
1545	19	15	Os08g0547200|mRNA|AK101130|CDS+3'UTR	GTAAACCGTACATTGTTTGCCGGGAAAATTTTGTTTTTGCCTTTAATGTGTATTATTGGC	Os08g0547200	AK101130	RabGAP/TBC domain containing protein.
1546	19	16	Os05g0113000|mRNA|AK067079|CDS+3'UTR	GTAAATGACTCGATGAAATTCTCTAGTGACCACTATTCTCGTGTACATTGTTTTGAACCA	Os05g0113000	AK067079	Amino acid-binding ACT domain containing protein.
1547	19	17	Os10g0317900|mRNA|AK060703|UTR	TCACCAACTTTTATTCTTGTGAAAGGTTATTACCGTGCGAATAAATAGTGGGTTTGAACT	Os10g0317900	AK060703	Similar to Flavonoid 3'-monooxygenase (EC 1.14.13.21) (Flavonoid 3'-hydroxylase) (Cytochrome P450 75B2).
1548	19	18	Os01g0737600|COMBINER_EST|Os01g0737600|8	ACGCACCCCCACCTGCCGTCTATCCCCAAGCTCGAGGAGGCTGGACAGGAGTGGAAGGGG	Os01g0737600		3'-5' exonuclease domain containing protein.
1549	19	19	Os09g0371300|COMBINER_EST|Os09g0371300|8	TGTGCCGGAGAAATCAAGAACGAGCATCTACGCGCTCGACAGGTCGTTCGAGTCGATCCT	Os09g0371300		Major facilitator superfamily protein.
1550	19	20	Os08g0397900|mRNA|AK109817|CDS+3'UTR	ACAAACCTGAATAGATGAACCTGATGATAGGTTCAGAGTAACCAGGGTGCCTTCAGCAGT	Os08g0397900	AK109817	Conserved hypothetical protein.
1551	19	21	Os07g0142300|mRNA|AK108823|CDS+3'UTR	TGCTTGGCTATAAGTACTTGTATGTGGCATTTGTTTATAAAAGTTTCATTTTGGTTGGTT	Os07g0142300	AK108823	Conserved hypothetical protein.
1552	19	22	Os08g0320100|mRNA|AK104999|CDS+3'UTR	CTGGAGCATATTTTCTGTGGATCTTTCCTATCATAGGCTTGATATGATGGCGATGAAGTA	Os08g0320100	AK104999	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
1553	19	23	Os06g0342200|mRNA|AJ563658|CDS+3'UTR	CATCTTGTGATATGAGATATTTGTCATGGTTTGAGGTGGTTAAATAATTGTTGGATTCCG	Os06g0342200	AJ563658	Similar to Eukaryotic translation initiation factor 1A (EIF-1A) (EIF-4C).
1554	19	24	Os09g0309200|mRNA|AK109582|CDS+3'UTR	GGACTGGATAGATATGTAATACTACTCTCCATGCATGATAAATTATAATGCTGCGTATAG	Os09g0309200	AK109582	Calmodulin binding protein-like family protein.
1555	19	25	Os07g0551500|COMBINER_EST|CI481528|6	TTTTGGAATGCGGATCCCTGTGAGAATCCTACAGTTCTCTGAGAATTTTGCTCTGTTTCA	Os07g0551500	CI481528	Similar to Cellulose synthase.
1556	19	26	Os02g0227600|mRNA|AK111918|CDS+3'UTR	AACCAGTTGCTCACCACTGTCAAGATTTATATTAACAACTTCGCCAGCACTCTACCAAGT	Os02g0227600	AK111918	Leucine-rich repeat, plant specific containing protein.
1557	19	27	Os06g0594400|mRNA|AK065435|CDS+3'UTR	CAATTTTGAAATTTTTGATCAAATGACAGTGTGTGTTTGTAACAAACACACGCCTTTTCG	Os06g0594400	AK065435	Cyclin-like F-box domain containing protein.
1558	19	28	Os03g0701200|mRNA|AK061528|CDS+3'UTR	ATGCATGTGTATATCAGTTCTGATGATCAGCTTTTGTTTGCTGTAAAATGTAAATGGCAC	Os03g0701200	AK061528	Similar to Sugar-starvation induced protein (Fragment).
1559	19	29	Os11g0264000|COMBINER_EST|CI453880|0	TATTGTAAGATGCCAAATTGTAACTAAATCCATTTGGATTTAATTTATGAAGAAGTGAAA	Os11g0264000	CI453880	Cupredoxin domain containing protein.
1560	19	30	Os05g0581800|mRNA|AK102861|CDS+3'UTR	ATTCTGATAGAAAGGACCGTTCTTTCTCAGTTTGTTTTGTTCTTCCGTTTACATATCATG	Os05g0581800	AK102861	Protein of unknown function DUF1296 family protein.
1561	19	31	Os09g0570500|mRNA|AK069259|CDS+3'UTR	ACAACTGATCATTTGAACAAACTGATTGATGGGATACAGTAAGAGGGAACTAATGTTCCT	Os09g0570500	AK069259	Zinc finger, RING-type domain containing protein.
1562	19	32	Os04g0175600|mRNA|AK098998|CDS+3'UTR	TCGCTATATATACTGAACAATATATGTCAAATATACAATATAAAATGTAAAGTGTCCCTT	Os04g0175600	AK098998	Similar to 0-methyltransferase (EC 2.1.1.6) (Fragment).
1563	19	33	Os12g0516800|COMBINER_EST|CI257278|6	ACCTGATGTTATCATCATCTGAGAAAAAGCAGCTATTTTTCATGTAAATCTGGGATAACC	Os12g0516800	CI257278	Protein of unknown function DUF231, plant domain containing protein.
1564	19	34	Os03g0432900|COMBINER_EST|AU057841|7	CGAACCTCCTCAAATGTACTTCTCAGCCATTTGCTATATTAGGCCTGTAAAATCACAAGG	Os03g0432900	AU057841	Conserved hypothetical protein.
1565	19	35	Os12g0621300|mRNA|AK101072|UTR	TTCATCTGTTAATAGGTCAGGAGAAGACATGGCTTCAAGCAGTTGGGTATGTGACAGAGT	Os12g0621300	AK101072	Conserved hypothetical protein.
1566	19	36	Os07g0578200|mRNA|AK070952|CDS+3'UTR	AGCCTAGCCGCATTGTTCACAAGAATACATAGCTTGTATGCTAATTTTATATTTATTCGC	Os07g0578200	AK070952	Conserved hypothetical protein.
1567	19	37	Os05g0568100|mRNA|AK069724|CDS+3'UTR	GTAGAAAAGGCGTTTAACCAACCTGTAAATGATACAGTACCCTAGTATTGTAGTACTTCG	Os05g0568100	AK069724	Similar to Iron sulfur cluster assembly protein 1, mitochondrial precursor (Iron sulfur cluster scaffold protein 1).
1568	19	38	Os07g0258400|mRNA|AK103557|CDS+3'UTR	TTTTGGCCCATGGGAGTAGATTGTTGCTTTTTTTCTTAGTGATTAGTTATTGGCAGATTG	Os07g0258400	AK103557	OsNramp1 (Integral membrane protein).
1569	19	39	Os01g0832200|mRNA|AK068980|CDS+3'UTR	ACGCCCCTTCTCGAGTATTCCTAATTAATTATCAGAAATAATTACTCTGACTTTGGATTG	Os01g0832200	AK068980	Conserved hypothetical protein.
1570	19	40	Os02g0119300|mRNA|AK065427|CDS+3'UTR	GTCCATATCAGTTCATTGTGATGAATAGGCATTCCTTCACTTTTTGAAGGCTAGTGCACA	Os02g0119300	AK065427	Peptidase M14, carboxypeptidase A family protein.
1571	19	41	Os06g0152300|mRNA|AK102929|CDS+3'UTR	GTAAAGTAGGGGTAGCTTTGTCTCTTTGATTGTAACTAGTAGTACTTCTTTCAAACTTTC	Os06g0152300	AK102929	Similar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase).
1572	19	42	Os03g0268900|mRNA|AK099430|CDS+3'UTR	GACGCGTGATATATTTTTCCATTGCACAAGCCCTTTCAGAACTATGTGATGGAGGCGTTG	Os03g0268900	AK099430	Similar to Short chain alcohol dehydrogenase-like.
1573	19	43	Os08g0210900|COMBINER_EST|Os08g0210900|8	GCAAGGGAAAAGAAGGATTATTGCGTCAGCGGCTAGGGTTTGCGGTGGACCGGGTGCACG	Os08g0210900		Hypothetical protein.
1574	19	44	Os01g0775500|mRNA|AK100936|5'UTR+CDS	AACTGGTTACTTCAGTTCGACGATGATCATGGGATCAACGGTGATCAAGTCTCTGACATT	Os01g0775500	AK100936	Jacalin-related lectin domain containing protein.
1575	19	45	Os07g0656400|COMBINER_EST|CI044454|0	TGTCATTTACATGTGGAATCAGATGCCAGAAACTTACTTTGTCAAGATTGGAATGTACAA	Os07g0656400	CI044454	Conserved hypothetical protein.
1576	19	46	Os05g0548900|COMBINER_EST|CI548173|3	TATCGTGCGTATTTGGTATGGAACTGTGTTATTGTTTGCAGATAAATAAACACAGATGTG	Os05g0548900	CI548173	Similar to Phosphoethanolamine methyltransferase.
1577	19	47	Os01g0974000|mRNA|AK121398|CDS+3'UTR	CCTTGCGCAAAGGTAACCAGCAAGGAATGCATAAATACATGAAAACTTTGTTGTCTGAGT	Os01g0974000	AK121398	Mammalian cell entry related domain containing protein.
1578	19	48	Os07g0571100|mRNA|AK067380|CDS+3'UTR	GGATGTCAAAAGCTGGTCTCTTTCTCCCTCTCCCAACTGCTTTAGCTTTGTTCTTTTTGT	Os07g0571100	AK067380	Conserved hypothetical protein.
1579	19	49	Os12g0444500|mRNA|AK060955|CDS+3'UTR	ACTGTATGTTGTGATTGAAAGCTCTGCCTATGTAAACTAAAACTGAATTGTTCCTTGGTC	Os12g0444500	AK060955	Conserved hypothetical protein.
1580	19	50	Os10g0458700|mRNA|AK101347|CDS+3'UTR	TCTGCATGTAAACTGAGCTATAAGCTCCATTTTGTCAGGCTTGTGAATGAAATTGAAAAC	Os10g0458700	AK101347	Ribonuclease H domain containing protein.
1581	19	51	Os01g0572700|mRNA|AK105334|CDS+3'UTR	ATGAGTGCGTCGTGGACGTGGAATGATGGAATTATTGTAGTTGCGTCGATCACATGGAAA	Os01g0572700	AK105334	Calcium-binding EF-hand domain containing protein.
1582	19	52	Os07g0206700|mRNA|AK072893|CDS+3'UTR	GTGTATTGTAACTTTGCAATAAGGCACCTGCTTGATAGCTTTCTTTTCATATTGTTCTTC	Os07g0206700	AK072893	Cycloartenol-C-24-methyltransferase 1 (EC 2.1.1.41) (24-sterol C- methyltransferase 1) (Sterol C-methyltransferase 1).
1583	19	53	Os02g0107600|mRNA|AK102128|CDS+3'UTR	AAATGGGTAATAACGCAATATATATAGCTGGATGAGATGATCATGGCATGTTGGCGGCGT	Os02g0107600	AK102128	Protein of unknown function DUF1677, Oryza sativa family protein.
1584	19	54	Os07g0628500|mRNA|AY222337|CDS+3'UTR	AGCACCTAATCTGTATATCTGAATCTCAGTTTTAAGTGGTCAAATAGGTGACATTCAGAA	Os07g0628500	AY222337	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
1585	19	55	Os03g0211100|mRNA|AK111964|CDS+3'UTR	AGGGACAGTAGTTGTAAGATGGAACTCTAATTATTGCATTGATATACATGAATCACTCAG	Os03g0211100	AK111964	Zinc finger, RING-type domain containing protein.
1586	19	56	Os02g0224900|mRNA|AK101829|CDS+3'UTR	ATTGATTGCACACACACAAAAGGTGGGTCTTTGTGTCGACTCGGCGTTCATATACCCAAA	Os02g0224900	AK101829	Conserved hypothetical protein.
1587	19	57	Os04g0509500|mRNA|AK107601|CDS+3'UTR	TGAGACAAACGACGAGATGTGGATGATGATGTGTATGGTTTCGAATTAATCTCGCCTTCA	Os04g0509500	AK107601	Similar to Ammonium transporter Amt1;1 (Fragment).
1588	19	58	Os03g0721400|mRNA|AK102605|CDS+3'UTR	TTGTGTCAAAGATAACATTGTTGCCATGATGCCATCCCCTCTTGCTCTGTTGTGTGGACT	Os03g0721400	AK102605	Protein of unknown function DUF841, eukaryotic family protein.
1589	19	59	Os07g0198300|mRNA|AK071830|CDS+3'UTR	CTCTAGTAGCTACGCGTGTTGTGTGTGTGGTCTCGAACGACTTTATAATCTCAGTGTGAT	Os07g0198300	AK071830	Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
1590	19	60	Os01g0152600|COMBINER_EST|Os01g0152600|8	GGCTCCATTGGCTATATTGCACCAGAAGCAAATGAGACAGATGTGACAAATGCAAGCACA	Os01g0152600		Serine/threonine protein kinase domain containing protein.
1591	19	61	Os10g0465700|mRNA|AK067249|CDS+3'UTR	GGGAACACACACACACTGGCACTCAAAAGTTGTTGTCACGCTTGGGGAATATATCCATTT	Os10g0465700	AK067249	Similar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
1592	19	62	Os04g0433600|mRNA|AK068114|CDS+3'UTR	TTGTCACATGTTGTACGAAGGGGAAGATGCAATAAAAGGCTGGTGATTCATAGAAAAAGA	Os04g0433600	AK068114	Protein of unknown function DUF668 family protein.
1593	19	63	Os08g0200600|mRNA|AK120197|CDS+3'UTR	CCCTTTCTCTTTACTCTCTAGATGTATTTGTCATTGCAGATGAATAAAGATTTCAGAGAC	Os08g0200600	AK120197	Similar to NAC-domain containing protein 21/22 (ANAC021) (ANAC022). Splice isoform 2.
1594	19	64	Os05g0532600|mRNA|AK106711|CDS+3'UTR	ACGCAGAACACAGTATTGTCCTTCCAACAAATTTCCGGCTAAATTTATCCGGAGCAACAG	Os05g0532600	AK106711	Similar to Hexokinase.
1595	19	65	Os02g0817800|mRNA|AK068473|CDS+3'UTR	GACCATAGATTTTTGCTGTATGTGGTCATCTAAGGGTTTTAATATTCCATTTCCAGGGTG	Os02g0817800	AK068473	Similar to Telomere binding protein-1.
1596	19	66	Os08g0166400|mRNA|AK110809|CDS+3'UTR	CTGTAAGGGGTCTAGTGAACCCTTGAGGCACCAATATTAGAAAAAGGTTGTGGATTTTTT	Os08g0166400	AK110809	Zinc finger, SWIM-type domain containing protein.
1597	19	67	Os06g0124800|COMBINER_EST|Os06g0124800|8	AACTTTTGCTTGTTTGGTTTGCCGCCGCTGCCTGAGAAGGGAAAAAGTGATTTGGGTCTG	Os06g0124800		Conserved hypothetical protein.
1598	19	68	Os10g0415800|mRNA|AK066318|CDS+3'UTR	GCAAATTCAGTCGGATTTACTAATTACTACTAGCTACTGCTCTGACCGTGATTGATGATC	Os10g0415800	AK066318	Similar to Acylamino acid-releasing enzyme.
1599	19	69	Os03g0313600|mRNA|AK067474|CDS+3'UTR	TCTTTTTCAATCGCAAGTGGCCTTGCTACAGTCTTCATTAATGCAGCATTCGCCTTTGCA	Os03g0313600	AK067474	Similar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment).
1600	19	70	Os08g0538300|mRNA|AK112001|CDS+3'UTR	ATCTGGAAGGCTATATGTAAGATATTGACTTCTACATTCCAATGGAAATAAATAAATATT	Os08g0538300	AK112001	Similar to LysM domain-containing receptor-like kinase 3.
1601	19	71	Os10g0382100|COMBINER|CI500295|x	TGCGTCCAAATGACGAGGCGATCTGAACTGTTATATGTAATTCTACTTATATCATGTTTG	Os10g0382100	CI500295	Conserved hypothetical protein.
1602	19	72	Os04g0493100|mRNA|AK101636|CDS+3'UTR	TGTGATATGTAACTATGTGTCTCTTCAGTAACATGATAGTAGCAGCATGTTGCTGCTAGC	Os04g0493100	AK101636	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
1603	19	73	Os02g0101000|mRNA|AK061115|CDS+3'UTR	AGATTGCAGCTTGCTCATTCATCATCGTGGTAGGGGTTTGCTGCGCTTGCGTGGGGACAT	Os02g0101000	AK061115	Amino acid/polyamine transporter II family protein.
1604	19	74	Os01g0874100|mRNA|AK105804|CDS+3'UTR	TATCAAACTCGTCCATGTAAATGTTCACTCTTCTTCGTCGTCAATAAAAGGCGTCCCTGT	Os01g0874100	AK105804	Deoxynucleoside kinase family protein.
1605	19	75	Os04g0605100|mRNA|AK061266|CDS+3'UTR	AGAAGAAAAGATTGTAGAAAGAGGACGAGGGAAACTTGATGCTAGAGAATTACCGTCTCC	Os04g0605100	AK061266	WRKY transcription factor 68.
1606	19	76	osa-miR164e|Os03|Mature	TGGAGAAGCAGGGCACGTGAGTGGAGAAGCAGGGCACGTGAGTGGAGAAGCAGGGCACGT			miRNA
1607	19	77	Os01g0872800|mRNA|AK062100|CDS+3'UTR	GCAAACAATTTTGCTCGTTTGTTTTGTAATTTGGTGCAGCAGATAGCATCAGGAATTCAG	Os01g0872800	AK062100	Similar to 3-phosphoinositide-dependent protein kinase-1 (Fragment).
1608	19	78	Os02g0582300|mRNA|AK101861|CDS+3'UTR	ATAGCTGAGCACATGGAGGTGCCACATTTTGTCACACTAAATGTTACTCCATCCGTCTCA	Os02g0582300	AK101861	Protein prenyltransferase domain containing protein.
1609	19	79	Os04g0441200|COMBINER_EST|Os04g0441200|8	CGAGCACCGTGGCCGGAGCCCGGCGGCGGCGCGGACCCATCTCTCGACGGATTCACGCCG	Os04g0441200		Hypothetical protein.
1610	19	80	Os03g0153900|mRNA|AK106420|CDS+3'UTR	CAAATGATGGAATTGGATTTTGTGATAAAAGCTGCCTCAAAACATGTATGGGTTTAGGTC	Os03g0153900	AK106420	Aromatic-ring hydroxylase family protein.
1611	19	81	Os06g0325200|COMBINER|CI261002|6	AACACCTTGCAAGCACTGAAAATACCCTTGACGATGAACACGAGTTTTGGCAACGCGTAA	Os06g0325200	CI261002	Major facilitator superfamily protein.
1612	19	82	Os08g0504400|mRNA|AK072089|CDS+3'UTR	TGAGGTGCGAGTGCATGATTTGTAGCGAGATTTGCTACTGTAGACTTAAATTAGTACATT	Os08g0504400	AK072089	Similar to Uncharacterized enzyme involved in pigment biosynthesis.
1613	19	83	DarkCorner		
1614	19	84	DarkCorner		
1615	19	85	DarkCorner		
1616	20	1	DarkCorner		
1617	20	2	DarkCorner		
1618	20	3	DarkCorner		
1619	20	4	Os01g0639100|mRNA|AK073640|CDS+3'UTR	TTGGTTGACATGCTTTGCCGTGACTGTATTGCTATGGACTTTAAAGGGTTGCGAGTCTAA	Os01g0639100	AK073640	Similar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).
1620	20	5	Os02g0247800|COMBINER_EST|CI444145|0	TGAAGGCCTCAAAGCTAGAATTGTTCACTTTTTGGGCGATCCACAGTTGTAGTTCCTTTG	Os02g0247800	CI444145	Conserved hypothetical protein.
1621	20	6	Os11g0152700|mRNA|AK069411|CDS+3'UTR	CAGCTGCACTAGCAAAATTTTCAGATGGAATGAATGGGATTGCATGATTTTCAGTTACTG	Os11g0152700	AK069411	Similar to Transcription factor HBP-1b(C38) (Fragment).
1622	20	7	Os11g0145400|COMBINER_EST|CI025097|0	TGTAGTTCGTTGTGCCAATGACTGTTGTCAACTTTGAATATGTCGTTGTAGTATGATCAA	Os11g0145400	CI025097	Similar to Ubiquitin-like protein 5.
1623	20	8	Os06g0639500|mRNA|AK099542|CDS	ATTTCCAGGCAAATTTAACCTTGGTGAAGTATGCAGTTGCTTGGCAGATCCCTCTGAGGT	Os06g0639500	AK099542	Protein kinase-like domain containing protein.
1624	20	9	Os12g0633700|COMBINER|CI420352|x	CGAGCTGCTACCGAGGGAAGAATAGTAGAGCAACAAGTTCTCGAAGTAATGAATCGAGTT	Os12g0633700	CI420352	Similar to GDP dissociation inhibitor protein OsGDI1.
1625	20	10	Os04g0616000|mRNA|AK106295|CDS+3'UTR	GAGTTCAGGCAATGATAGTATGTATTGCTTGTTCTCCTTGTCTGATGAACAAAGTAATTG	Os04g0616000	AK106295	Conserved hypothetical protein.
1626	20	11	Os03g0670700|mRNA|AK119242|CDS+3'UTR	GCTTGTTGCTATCTATCGGAATGAAATGAAATAGAAAACAAGGAGAAAAAAAAGAGTTCG	Os03g0670700	AK119242	Similar to Glycine-rich RNA-binding, abscisic acid-inducible protein.
1627	20	12	Os05g0503300|mRNA|AK103289|CDS+3'UTR	GGAACCCTGGCTGTTTACTTTGGAATAAATTGCTTGGAAAGTGTACTGAATAAATTTTTC	Os05g0503300	AK103289	Similar to Sulfite reductase (Fragment).
1628	20	13	Os11g0146800|mRNA|AB079874|CDS+3'UTR	AAGAATACAACTACTGCTGCTGCTATGTTTTTGCCACTGCTGAGGAAAGAGGCAACCTCA	Os11g0146800	AB079874	Similar to Disrupted meiotic cDNA 1 protein (Fragment).
1629	20	14	Os12g0540700|mRNA|AK107996|CDS+3'UTR	CTGCTGCTGCTGAGATAGTGAGATGAGATGATGATGGAACTGGAAATATATATGCTGTAT	Os12g0540700	AK107996	Conserved hypothetical protein.
1630	20	15	Os08g0230500|mRNA|AK107589|CDS+3'UTR	TTTGCAGAAAGATAGCTGTGAAAGAAACCAATGTTAACCATTTGCCAGTTACCTGGTAGT	Os08g0230500	AK107589	Protein of unknown function DUF537 family protein.
1631	20	16	Os06g0148600|mRNA|AK121786|CDS+3'UTR	TGCTACTTGTCATGTCTACTCTTATGCTAGAATGATTTGCTCTGGATTCAGAAAGCATTG	Os06g0148600	AK121786	Protein of unknown function DUF295 family protein.
1632	20	17	Os02g0664000|mRNA|AK058456|CDS+3'UTR	GTTATTGAGACCTGCGACTGCGATGAGCAAGTTTTGACGTGTAACGTGTACTCGTTCTAT	Os02g0664000	AK058456	Similar to Phospholipid hydroperoxide glutathione peroxidase, chloroplast precursor (EC 1.11.1.12) (PHGPx).
1633	20	18	Os06g0341500|mRNA|AK106755|CDS+3'UTR	GACCACTAATTTTTGTAACAGCCAATGACATCATAATATATGAAGGCATCTCTCCAGACG	Os06g0341500	AK106755	Conserved hypothetical protein.
1634	20	19	Os01g0145600|mRNA|AK072818|UTR	GTGTGTGTACTAATTTTCTGGAATGTCATGTAATCAGAAGAGTTGTTTAGAAGAGGCATA	Os01g0145600	AK072818	Conserved hypothetical protein.
1635	20	20	Os12g0530100|mRNA|AK109551|CDS+3'UTR	ATGGTATAGTGAGAGAGTTCAAAGTAAGGGATATATATATAGCGGTTTATAATTTATTTT	Os12g0530100	AK109551	Similar to Peroxidase 24 precursor (EC 1.11.1.7) (Atperox P24) (ATP47).
1636	20	21	osa-miR530|Os04|3'seq	TGTTGTTCCTGGTCTCTTCCTGATCCCTAGGTGCAGAGGCAGATGCAACTATGTCATAGA			miRNA
1637	20	22	Os05g0441400|mRNA|AK108756|CDS+3'UTR	TACCCGTCGTGTATCAAGCTTGCATGAGTGGAAGTAATCAAGTAAACTGTAATATTGAGT	Os05g0441400	AK108756	Protein of unknown function DUF623, plant domain containing protein.
1638	20	23	(+)E1A_r60_n9		
1639	20	24	Os02g0815500|mRNA|AK099733|CDS+3'UTR	TTTCGCTTAGAAGCACTTTGAACTGTGACACCACTCTGCTATAATAATATATGTGCTGTT	Os02g0815500	AK099733	Alcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH).
1640	20	25	Os01g0251000|mRNA|AK100105|CDS+3'UTR	TCAGGCCTGAAGAGTAGTTGATCTATCTTACAAGTTGAATTGTTGATGCGAATCACATCT	Os01g0251000	AK100105	Conserved hypothetical protein.
1641	20	26	Os05g0409800|COMBINER_EST|Os05g0409800|8	GTTGACAAGCTTCCTGGATATAGTTCAGTTGAATTTGATGTTAATGTCTCTGAACCAAGA	Os05g0409800		Tetratricopeptide-like helical domain containing protein.
1642	20	27	Os02g0162500|mRNA|AK058907|CDS+3'UTR	ATGCTTAACAAACCCAATATGTGTACCTTCGTGGTTCCTTATAATATGGTTGGATTGTCT	Os02g0162500	AK058907	Similar to 40S ribosomal protein S14.
1643	20	28	Os08g0517500|mRNA|AK065593|CDS+3'UTR	TCATGCTGCTAGAGCAGCAATGGCCTTGAGGCTTTTTTGTGGAAGCTAGATGCTTTGTAT	Os08g0517500	AK065593	Pyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein.
1644	20	29	Os07g0205000|mRNA|AK072032|CDS+3'UTR	CTTGTTGTGTAATGTGTTATGTGTATGCTTATTATGTGAAGATACCCACCGTCAGTTCTC	Os07g0205000	AK072032	Similar to Cytochrome-C reductase 14 kDa subunit (EC 1.10.2.2) (Fragment).
1645	20	30	Os11g0546100|mRNA|AK068611|CDS+3'UTR	TGTATGAAACTGGTGAACGCAGTGTTTGACAGATCTGTTTGCCTAATTGACTGGAAGTTG	Os11g0546100	AK068611	Lung seven transmembrane receptor family protein.
1646	20	31	Os05g0480000|mRNA|AK061052|CDS+3'UTR	CCTACTTCTGTTGGTCAGCTTCTTGCAACCTATGTAGATTTCTGAACTGTTTCTTCAGCC	Os05g0480000	AK061052	Protein kinase domain containing protein.
1647	20	32	Os10g0357700|mRNA|AK106693|CDS+3'UTR	ATTCTACTCTTCAATCTCAGTAGACGATGACAACCCAGAGAGTTTCTACAGCCAAAATGT	Os10g0357700	AK106693	Conserved hypothetical protein.
1648	20	33	Os10g0181700|mRNA|AK058820|CDS+3'UTR	AGATGAAGTGACTTCTGTGACTCGTGCTGATGTGCTTCAACTGTAATTATCAGACTCAAA	Os10g0181700	AK058820	ATP-binding region, ATPase-like domain containing protein.
1649	20	34	Os06g0196600|mRNA|AK060515|CDS+3'UTR	AAAGTTAGATCTCCTGTTCCATAGAAATGCTTGAGCCAAGGAATTGCTTGTCTGTAATTT	Os06g0196600	AK060515	Similar to 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplast precursor (EC 2.3.1.41) (Beta-ketoacyl-ACP synthase I) (KAS I).
1650	20	35	Os09g0111800|mRNA|AK069338|CDS+3'UTR	ATTTTGGGCTTGTTTTTCGGTTTCTAGTGCTAAAGATGATACTTACAATTATGGGTCTTG	Os09g0111800	AK069338	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
1651	20	36	Os09g0540600|mRNA|AK101798|CDS+3'UTR	TTCGTTTGACACCTCCAATCCAAGGATGGAACATCTTGATGTAGAATGTCCAACTATTTA	Os09g0540600	AK101798	Similar to WD-40 repeat protein MSI1.
1652	20	37	Os04g0606700|mRNA|AK103790|CDS+3'UTR	GTTTTGTCTTGTTCTTCGGCTGATAATGCTGCTTCTTCTGATAACAATTGCCCCTGGAAA	Os04g0606700	AK103790	Conserved hypothetical protein.
1653	20	38	Os02g0107200|COMBINER_EST|Os02g0107200|8	TTCAAAGCAGAAGGAAACAAGTAGCACTAGTGGGATGCGAGACAGTGTTGAAACAAGTCC	Os02g0107200		Diphosphomevalonate decarboxylase family protein.
1654	20	39	Os02g0297600|mRNA|AK064947|CDS+3'UTR	ACTTGTTTCATCATGTAAATTATTCAGCTGGTCTTACTGTTTTATGGAGTTAAGGTCGAG	Os02g0297600	AK064947	Protein of unknown function DUF707 family protein.
1655	20	40	Os03g0235900|mRNA|AF140606|CDS+3'UTR	CTTCCTGAACCTTGTTAACATTAGCAATATAATGGTGGTGGAAAAGGACAATTGTGTTGC	Os03g0235900	AF140606	Nitrate transporter.
1656	20	41	Os04g0569100|mRNA|AK112099|CDS+3'UTR	CGCCTGGCAAATGCAAACCTTGTTATGCTAAAATATGTTTTAGATCAATCTGATTCTGAA	Os04g0569100	AK112099	Similar to OCL1 homeobox protein.
1657	20	42	Os12g0293000|mRNA|AK069712|UTR	GTGTTACCGTGGGATATTTGTATCCTACCAAAGTGGTATTCTTGCTTTGAGGAAATAATA	Os12g0293000	AK069712	Hypothetical protein.
1658	20	43	Os12g0272100|COMBINER_EST|Os12g0272100|8	CACATCACATTAAGTTCAGCCAAATATGAGCATAGGTCTAACTTTGTGCCGCCACCACCA	Os12g0272100		Hypothetical protein.
1659	20	44	Os10g0412800|mRNA|AK070592|CDS+3'UTR	CACATGAACTTATGTGGACACACGGTAGGACCTGTAGGACCTATATACATCTCATTGGTG	Os10g0412800	AK070592	Conserved hypothetical protein.
1660	20	45	Os04g0150700|COMBINER|CI330756|6	TATGTTTCCTTTTCCTCTGCCTCACTACACCAATTGGTCTTCCAGTTGAGTAGTGAGTCG	Os04g0150700	CI330756	(No Hit)
1661	20	46	Os04g0674100|COMBINER_EST|CI526397|6	TGTACAGTGTGTATTAGGTCCTGGGTGGAGAGTTTAAGATTCTGAGAATCTGTTGGTTGA	Os04g0674100	CI526397	Thioredoxin-like fold domain containing protein.
1662	20	47	Os03g0270200|mRNA|AK102826|CDS+3'UTR	AGCAAATGTTTTGTACTGTTGAGAGAACACTTCATCTTGCCCTCTTATTTTGCGGTTCCA	Os03g0270200	AK102826	Splicing factor PWI domain containing protein.
1663	20	48	Os10g0561400|mRNA|AJ495799|CDS+3'UTR	CAAAATCAGTAATGGTAGTGCTGATCTTCGTGGTTGTACTGTTGTAAACTCTTTTATAAG	Os10g0561400	AJ495799	Similar to Transcription factor MYBS3.
1664	20	49	Os06g0658400|COMBINER|CI448191|0	GGATGTACCGTTGAACTATTAATTTGTGGTCTATGCACTATTTGTGGTCTAGCACTTATT	Os06g0658400	CI448191	Conserved hypothetical protein.
1665	20	50	Os02g0581400|mRNA|AK071897|CDS+3'UTR	CATACGAGAGACTGATATTTTTCCGCGTGTTCTTCTTCACAGCCTTCTTCAGTATTCCCT	Os02g0581400	AK071897	Similar to 2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase (EC 4.1.1.71).
1666	20	51	POsControl0012|genome		
1667	20	52	Os03g0322900|COMBINER_EST|CI387122|5	CAAGTTTCACTAGCTGCTTTTATTTTGCTTTCGTTAAGTTTCCACTACCGTGTATGTTCC	Os03g0322900	CI387122	Apolipoprotein/apolipophorin domain containing protein.
1669	20	54	Os04g0466600|COMBINER_EST|CI525990|0	AAACTGCCTTATGGCCTTTGCCAACGTTGACCAGGCGAATGGAAATGAAAATGGCTTTGA	Os04g0466600	CI525990	Porphyromonas-type peptidyl-arginine deiminase family protein.
1670	20	55	Os05g0577300|COMBINER|CI096250|6	ATTTGATCTGCCGTGCAGTCAAATAAATTTCTTCGTTTAGCTTTGGTGCTCACGGGCATC	Os05g0577300	CI096250	(No Hit)
1671	20	56	Os03g0169000|mRNA|AK107189|CDS+3'UTR	TCGTGTTCATGACAATCAATTAATTCATGATGATAGCCAAAGCAAAATACATGCTTTTCT	Os03g0169000	AK107189	Protein of unknown function DUF246, plant family protein.
1672	20	57	Os05g0436400|mRNA|AK060776|CDS+3'UTR	CTGGTTTTGAGAATTGTTTGGTCTGGTGAGTAGATGAGGAATGCATCCTAAGTGGTTTAG	Os05g0436400	AK060776	Peptidase A22, presenilin signal peptide family protein.
1673	20	58	Os04g0188400|COMBINER_EST|AU166251|6	ACGCTTGATTGCATGTAGCTAGTATCCATATATGTACGGTTGTGGCTCTAGTTGTGGTTG	Os04g0188400	AU166251	Hypothetical protein.
1674	20	59	Os08g0532200|mRNA|AK062854|CDS+3'UTR	TGATTTTACCATCCCAATTTGGATCATGATCTTGATGGGTGTATTGGTTATCGAAGGCAC	Os08g0532200	AK062854	Similar to Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GSA) (Glutamate-1-semialdehyde aminotransferase) (GSA- AT).
1675	20	60	Os07g0166100|mRNA|AK069169|CDS+3'UTR	TTTGAAACATGGAAGCAGAAATGAACGGTCTCTGGCTTGGATGACGCGAGAGTTTGTTGT	Os07g0166100	AK069169	Membrane attack complex component/perforin/complement C9 family protein.
1676	20	61	Os12g0615400|mRNA|AK103998|CDS+3'UTR	GATTAAGCTCATCCGAACTCCTGAGCATGGAATGGATCGTGTGTAGCATAATTAGAATGG	Os12g0615400	AK103998	Similar to 37 kDa inner envelope membrane protein, chloroplast precursor (E37).
1677	20	62	Os01g0728900|mRNA|AK071876|UTR	ATTACTCTTTTTCTTAAAATTAAAGGTAGGGCAAACATTACTGCCTCTGCCTCAATATGC	Os01g0728900	AK071876	Non-protein coding transcript, uncharacterized transcript.
1678	20	63	Os03g0795800|mRNA|AK102207|CDS+3'UTR	AGTGGATCCTGGAGACTTTTTATGGAACCGCATAATTGAATTTGTTAGCTATATTTCAAC	Os03g0795800	AK102207	Protein of unknown function UPF0005 family protein.
1679	20	64	Os01g0769000|mRNA|AK072195|CDS+3'UTR	GGGTACTGGAAACTGGGGGTATATCTCTTAATTGTAAATCGTTACAGTTTGTTGTCATTT	Os01g0769000	AK072195	Conserved hypothetical protein.
1680	20	65	Os05g0135700|mRNA|AK103157|CDS+3'UTR	GAAAGAAGGAAAGATGCTACACTACTTTGAGAAGAAGAAATGAAACCTCCTATGTTTTGG	Os05g0135700	AK103157	S-adenosylmethionine synthetase 1 (EC 2.5.1.6) (Methionine adenosyltransferase 1) (AdoMet synthetase 1).
1681	20	66	Os11g0655200|COMBINER|CI535974|x	TCTCCTTTCCCAACAGTCATGGGTTTTCCTGTACCATTCATTAGTAAGGCTTTTGAAAGA	Os11g0655200	CI535974	NB-ARC domain containing protein.
1682	20	67	osa-miR531|Os08|Mature	CTCGCCGGGGCTGCGTGCCGCCATCTCGCCGGGGCTGCGTGCCGCCATCTCGCCGGGGCT			miRNA
1683	20	68	Os05g0597400|COMBINER|CI348849|6	TTTCGTGAAGAGGTATATGGGTGTGTAATTAAACTTGTCCATCTTTTCCTGGAGATGCAA	Os05g0597400	CI348849	Conserved hypothetical protein.
1684	20	69	Os06g0133500|COMBINER_EST|CI520089|0	TTGAGATGACGGGTTGTACAGAGCTGGAAACTAATCGAATATGAGCCCCTCTTCTTTTTT	Os06g0133500	CI520089	Conserved hypothetical protein.
1685	20	70	Os05g0516700|mRNA|AK109131|CDS+3'UTR	TTGTCACGGACGCTCGCATCTATGGTTAATTAAATCAGTATGATGGTATGCCTAACGGAT	Os05g0516700	AK109131	Conserved hypothetical protein.
1686	20	71	Os03g0856500|mRNA|AK071750|CDS+3'UTR	CTCTGTTTAACCAACTGTTTTCGATATATTTATATTATTAATGATTTTTCCAAGGTTTTT	Os03g0856500	AK071750	Similar to Plastid-specific 30S ribosomal protein 1, chloroplast precursor (CS- S5) (CS5) (S22) (Ribosomal protein 1) (PSRP-1).
1687	20	72	Os11g0270500|mRNA|AK110480|CDS+3'UTR	TCAACAAGGAATATGGCTCAACAGGCTCACAAATAACGGAGTTAAACCCAAATTTCTTTC	Os11g0270500	AK110480	Disease resistance protein family protein.
1688	20	73	Os09g0284400|mRNA|AK110658|CDS+3'UTR	AAGAGGAGCGTTATTTTTTGTTCTAACCAGCACAAGCTATTGCACTGTAAGCAATGACAA	Os09g0284400	AK110658	GrpE protein family protein.
1689	20	74	Os10g0207500|mRNA|AK121594|CDS+3'UTR	CTATTAGCTACGTACTGTCTTCGATGTTTCAGACATTCAGTTGATCGAGCTTATTTATCT	Os10g0207500	AK121594	Conserved hypothetical protein.
1690	20	75	Os11g0194400|COMBINER|CI350369|0	CTCCTCGCCACCAAGTTCAACTATATATGGAGCTTGTTGGATCTCATGAAAGCTGTCCTA	Os11g0194400	CI350369	(No Hit)
1691	20	76	Os10g0403700|COMBINER_EST|Os10g0403700|8	ACAGGAAGCCCTCATGGTCCAGGAATTCTCAAGGGCAATCACATTACAAATTTCCATCCT	Os10g0403700		Similar to AX110P-like protein.
1692	20	77	Os04g0432000|mRNA|AK065036|CDS+3'UTR	AAGTGGTTCTGTCACTGTCTTTGTAATGACTGATTTAAGTTAGCATGCAGAAACATAATG	Os04g0432000	AK065036	Serine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7).
1693	20	78	Os08g0535800|mRNA|AK067906|CDS+3'UTR	GATCTGCATCAATGCATGCCCCCCTTTAATTTCTTCTTCCTCCTTAATTATTTTTTCCCA	Os08g0535800	AK067906	No apical meristem (NAM) protein domain containing protein.
1694	20	79	Os06g0683000|mRNA|AK105443|CDS+3'UTR	TTGCATGATGTTGTGGTGCTTAGGAATATGGCATCAATTCGAGATAGTGGTGAATGTTGA	Os06g0683000	AK105443	Zinc finger, C2H2-type domain containing protein.
1695	20	80	Os12g0158400|COMBINER_EST|Os12g0158400|8	CGCGCGCCGACTTCCGGGAGAGCATGGTGCAGATGGTGGTGGAGATGGGGCTGTGCGGGT	Os12g0158400		Protein of unknown function DUF623, plant domain containing protein.
1696	20	81	Os03g0850800|mRNA|AK101366|CDS+3'UTR	GGATCATGTGTTTCTTAGAACCGTACTCATAATACGGATGAAGTGAAATAAATATGGTTC	Os03g0850800	AK101366	Conserved hypothetical protein.
1697	20	82	Os11g0568300|mRNA|AK103282|CDS+3'UTR	TGTGGACTCCCTATTATTATGCTTTCTGATGTAAGATTAGTGCTCCAATGAACTGCAATA	Os11g0568300	AK103282	HMG-I and HMG-Y, DNA-binding domain containing protein.
1698	20	83	DarkCorner		
1699	20	84	DarkCorner		
1700	20	85	DarkCorner		
1701	21	1	DarkCorner		
1702	21	2	DarkCorner		
1703	21	3	DarkCorner		
1704	21	4	Os07g0153300|mRNA|AK066146|CDS+3'UTR	CTGAAGAAAACATGTTCTTCAGTATCGTGACCAGTTTTTGACCCGATCGGATACTAATGT	Os07g0153300	AK066146	Protein of unknown function DUF1365 family protein.
1705	21	5	Os01g0205300|COMBINER_EST|Os01g0205300|8	TTGGCGAGGGCGAGAAGGATGAAAGGTTACTCGAGGCTGAAGAAGAGTGAGCTGATTGAT	Os01g0205300		Rho termination factor, N-terminal domain containing protein.
1706	21	6	Os06g0143400|mRNA|AK120946|CDS+3'UTR	GCCTAACTTGTACATTCTTGCCATCTTTTTCTTATTAATTGAATGAATGAATCGCAGACC	Os06g0143400	AK120946	Similar to Acyl-ACP thioesterase (Fragment).
1707	21	7	Os01g0763600|mRNA|AK066596|CDS+3'UTR	TGTAATAATTGTCTTTAAAACAGTTGTATCTGATTAGTTCCTTGAAACAAAGTTCATTGA	Os01g0763600	AK066596	Glycerophosphoryl diester phosphodiesterase family protein.
1708	21	8	Os03g0593600|COMBINER_EST|Os03g0593600|8	CATCAAATCTGAGGAGCTAGACATGACAGAGGTATTTGGTATCACGTTGCAAGGAGTGCA	Os03g0593600		Cytochrome P450 family protein.
1709	21	9	Os03g0639600|mRNA|AK111569|CDS+3'UTR	AGAATGATGGAATGACAAAGCAGTGTCACGTAGTTATACGTACCGTGCAACATGATTGAT	Os03g0639600	AK111569	Similar to Zinc-finger protein Lsd1.
1710	21	10	Os01g0131600|mRNA|AK063183|UTR	TGGTTTCTGTCGAGGAGATTGACGGATTCGATCGATTCGTGTTCGTCTCCGTCAAATTTT	Os01g0131600	AK063183	Similar to AP2 domain containing protein RAP2.6 (Fragment).
1711	21	11	Os12g0211500|mRNA|AK103606|5'UTR+CDS	GAAATCCACAGATGTTGTACTAGTCCTCTTCACTGCATTGGGATTTGGTGTTTCCTATGC	Os12g0211500	AK103606	Leucine rich repeat, N-terminal domain containing protein.
1712	21	12	Os06g0674800|COMBINER_EST|CI447717|0	GATCTGCACAGATACTACAACATGTAAAATTGCAATTGCAATGATTTGAGCTGTTTCTTG	Os06g0674800	CI447717	Hypothetical protein.
1713	21	13	Os04g0120000|COMBINER_EST|CI260116|6	CGCGTGCACGAAGTACGCGTCGAATGGTCCGAAAAATTGGCTCCTCACCCTTGCGCAAAA	Os04g0120000	CI260116	Peptidase S8 and S53, subtilisin, kexin, sedolisin domain containing protein.
1714	21	14	Os11g0121600|mRNA|AK063194|CDS+3'UTR	ATGTATAAATGCTTCTCAAGGGGCTTAAGACCCTCCTTATTTCTACATTGTGCATGACCT	Os11g0121600	AK063194	Conserved hypothetical protein.
1715	21	15	Os03g0136200|mRNA|AF042333|CDS+3'UTR	GAGGATTTTGGGTTGGAAAGACAAGGTCGGGATCTCTTTTAAAGTTTGTTTTTCTTTTCT	Os03g0136200	AF042333	24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2).
1716	21	16	Os09g0441100|mRNA|AK107584|CDS+3'UTR	GAACCAATCCCAACTAGAGTGAGATAAGATTTATCTCCTCCTAAAACCGCTGTATATGGT	Os09g0441100	AK107584	Similar to Cytochrome P450 monooxygenase CYP92A1.
1717	21	17	Os01g0830200|mRNA|AK099788|CDS+3'UTR	GCATTGAGTCTGTTCAATTAGAAAACACAAGATCACTGTGTATACTGTTCAAAGAATGTG	Os01g0830200	AK099788	Zinc finger, RING-type domain containing protein.
1718	21	18	Os02g0198500|mRNA|AK062474|CDS+3'UTR	AGTTACTGTAAATTGTAATTAAGTCTAATAATAATCATCATCATCTTTGGATTCTCAGTT	Os02g0198500	AK062474	Conserved hypothetical protein.
1719	21	19	Os01g0825700|mRNA|AJ575227|CDS	TCAAATGAATGGGAATCAACAACCGCCAGGTTCTTCAGCGGCAGCAAGCAAACCTTATTA	Os01g0825700	AJ575227	Similar to VHS2 protein (Fragment).
1720	21	20	Os12g0132900|mRNA|AK068041|UTR	CAAACAAATTGAAAGACAAGGGAGGGAAGGGGTGTTCTTTCGGCCAACCTGGCTAATTAA	Os12g0132900	AK068041	Non-protein coding transcript, putative npRNA.
1721	21	21	Os02g0524600|COMBINER_EST|AU068637|6	GGCGTAGGTTCACCTCTTGACTTCCATGTTGTATTTTGCACTCGCCGTATATGCACTTAT	Os02g0524600	AU068637	WD40-like domain containing protein.
1722	21	22	Os11g0264300|mRNA|AK064859|CDS+3'UTR	ATGGTGCTTTGAAACATGTACATATTTATGAAACCCGGTGCAATAGAGTCGAAGGATGTT	Os11g0264300	AK064859	Plant regulator RWP-RK domain containing protein.
1723	21	23	Os08g0473600|mRNA|AK064071|CDS+3'UTR	TTCCTGCCGGTAGAAAGCACTATTAGCTTTAGCTATAGCGATCGAGTTGCATGGTGCTTT	Os08g0473600	AK064071	Alpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase).
1724	21	24	Os05g0110000|mRNA|AK067181|CDS+3'UTR	CATTGTGGCGATGATTCTTTGCATCTGTGAGAACGGAATGAATGAAACCATTTTGATGTT	Os05g0110000	AK067181	Zinc finger, RING-type domain containing protein.
1725	21	25	osa-miR399j|Os04|Mature	TGCCAAAGGAGAGTTGCCCTATGCCAAAGGAGAGTTGCCCTATGCCAAAGGAGAGTTGCC			miRNA
1726	21	26	Os06g0716000|mRNA|AK061844|CDS+3'UTR	ACATAGCTTAGTAGTACAGCCCTGAGTTTGAGTGGAAATATAGCAAGATCACAAGTGATG	Os06g0716000	AK061844	Protein of unknown function DUF668 family protein.
1727	21	27	PTaControl0002|mRNA|X94352|3'UTR		
1728	21	28	osa-miR172c|Os07|5'seq	CTTGTTGCGGGTGCAGCGTCATCAAGATTCACGTGTGCCGCACGGCACACGTATCGGTTT			miRNA
1729	21	29	Os01g0685500|mRNA|AK064463|CDS+3'UTR	CCACCTTCTATACTACTGTGTAAATAAATGGCACTAGCTTTTCAACGTATTTTTCACTAG	Os01g0685500	AK064463	ATP-dependent DNA ligase family protein.
1730	21	30	Os08g0208400|mRNA|AK102509|CDS+3'UTR	CCAGGATGGTTTAGGAAACATGTGAGTCATTATTTAAGTATTTTCAGTTTTGACTCTGTG	Os08g0208400	AK102509	En/Spm-like transposon proteins family protein.
1731	21	31	Os09g0395300|COMBINER_EST|Os09g0395300|8	TGCCTACCTGTTCTTTTCCAGCAACCATGGCCGGTGTGAACCGGCCTCTCTTGACCAGAA	Os09g0395300		Similar to CDPK substrate protein 1.
1732	21	32	Os06g0194200|mRNA|AK111269|CDS+3'UTR	GCATGAACAAGGCCAGTGCCATCGCCCACTGTCCAATGATCAGTGAACCACGTGATTTCT	Os06g0194200	AK111269	Conserved hypothetical protein.
1733	21	33	Os05g0582300|mRNA|AK066579|CDS+3'UTR	TTTTTCCCCTCCCCTTTCTGCCATTTCATTTGTCATTGGAGAACGACTATGAATTAATTA	Os05g0582300	AK066579	Solanesyl diphosphate synthase.
1734	21	34	Os07g0124900|mRNA|AY339373|CDS+3'UTR	ATTACGGGGATCTTATTATATATATATGTACGTTGTCGTTCGAATAAAAGAAGAAAATAA	Os07g0124900	AY339373	Allergen V5/Tpx-1 related family protein.
1735	21	35	osa-miR395f|Os04|3'seq	ACTTCACATGGTACTATTTCAAGGCCTACTATGTGAATTGTTTGGGGGAACTCTCGATGT			miRNA
1736	21	36	Os02g0640800|mRNA|AK067764|CDS+3'UTR	AGTATCTAGGTACTATGAGGTACCAAATAGTACAATTTGGTACTTCATAGTACCTTCTCA	Os02g0640800	AK067764	Similar to (-)-isopiperitenone reductase.
1737	21	37	Os12g0124000|mRNA|AK060098|CDS+3'UTR	ATGGTAGCCCCGTGATCAACTTAAAATGCATTTATCAAGTACCAAAGATGCCAATATTAC	Os12g0124000	AK060098	SMAD/FHA domain containing protein.
1738	21	38	Os02g0135200|mRNA|AF194416|CDS+3'UTR	AGTGTGTGATGACTCTATCTGCCATATGAACAATCTGGCACTTTTTTACCTTAGTACCAT	Os02g0135200	AF194416	Similar to Blast and wounding induced mitogen-activated protein kinase.
1739	21	39	Os11g0702000|mRNA|AK106678|CDS+3'UTR	AGAATTGGATTTGGATTTGGTTGATATTCTTTGATCTTTCTTATTGTTGTGAACGATTTG	Os11g0702000	AK106678	Conserved hypothetical protein.
1740	21	40	Os12g0540200|mRNA|AK065534|UTR	TGTAACACTGAGAGATATTTGTGTCCTAAATCTCAACGTGTATTGGTTCTTCATGTTGGT	Os12g0540200	AK065534	Non-protein coding transcript, putative npRNA.
1741	21	41	Os06g0682500|COMBINER|CI419126|6	TTTGTGAGTTGAATGCGAATTGTTGGATTGGATCTGATGCCTTTGATGACATGATGGTTT	Os06g0682500	CI419126	(No Hit)
1742	21	42	(+)E1A_r60_a107		
1743	21	43	Os05g0539700|mRNA|AK105671|CDS+3'UTR	GCCAATACCACTGGCATAGTGCTGAGAAATTTTGATCTAGGAGAGGCAATGTTTTTGTGC	Os05g0539700	AK105671	Similar to Nucleosome assembly protein 1.
1744	21	44	Os01g0623600|mRNA|AK103106|CDS+3'UTR	AATAATTTGGTACCGTGAGGTCCTGTACCTCGAGGTACTTTTTGTTGGACCGGAGCAAAT	Os01g0623600	AK103106	Similar to Polygalacturonase precursor (EC 3.2.1.15) (PG) (Pectinase).
1745	21	45	Os08g0136700|mRNA|AF097724|CDS+3'UTR	CATGCTAGCTGCAGTTTGTTTGGAATAAATTAATAAAGATGTGTATTGGGCATGTTGTAC	Os08g0136700	AF097724	Protein of unknown function DUF26 domain containing protein.
1746	21	46	Os01g0103000|mRNA|AK066123|5'UTR+CDS	ACACTAGCAGAATTCTCAAGGGAGGGTACTTTGCCTTCCCACTAGAAGAGCTTATTGCTT	Os01g0103000	AK066123	Non-protein coding transcript, unclassifiable transcript.
1747	21	47	Os03g0215700|mRNA|AK099772|CDS+3'UTR	TCGTGTGTTCGCGCAGGTTAACTACAAGTTGTATGTTGTACTTTTGGCATATTTACCAGA	Os03g0215700	AK099772	Myosin II heavy chain-like family protein.
1748	21	48	Os10g0510000|mRNA|AK101613|CDS+3'UTR	TGTTTGGGGAGGTCGAGATTTTAAGAAGTAGCTAGCTAGTGAAAATATGAAAATGCTAGG	Os10g0510000	AK101613	actin [Oryza sativa (japonica cultivar-group)].
1749	21	49	Os08g0156600|mRNA|AK063143|CDS+3'UTR	AAGACACGATACATGGATTAGATTCTCGTAGCTCCAAAGCACTGCTTGGCAAGAAGTTGC	Os08g0156600	AK063143	Major facilitator superfamily protein.
1750	21	50	Os09g0297100|mRNA|AK073729|CDS+3'UTR	GGATGTAAAATTGGAAACAGATGCTGTGTCAAGAAATGTGTAACTGCAGGTCCTTTATAT	Os09g0297100	AK073729	Similar to CROC-1-like protein (Fragment).
1751	21	51	Os02g0808800|mRNA|AK064401|CDS+3'UTR	TCAGGATGTAAATTTGAATATCATTGTATTTATTTTCTATGTTGCAGGGAATTTCCGAGT	Os02g0808800	AK064401	Similar to Cinnamoyl-CoA reductase (EC 1.2.1.44).
1752	21	52	Os04g0672800|mRNA|AK068413|CDS+3'UTR	CTGTAGCTTTCATTCCATGACGAGCGAACTAGTACCTCTATCGCAATAGAAGCAACTGTA	Os04g0672800	AK068413	Conserved hypothetical protein.
1753	21	53	Os04g0162500|mRNA|AK108645|CDS+3'UTR	ACACAAAATTCAATTCAAATTAGATATAATTCTCTGTTATTTCTCATTGCTTACACACTT	Os04g0162500	AK108645	Zinc finger, C2H2-type domain containing protein.
1754	21	54	Os08g0554900|mRNA|AK105089|CDS+3'UTR	TGAGGTTATATAAGGCTAATTACGATTGTTAATTTCATATGGCAGAGCATATTTCTCAAT	Os08g0554900	AK105089	Nonaspanin (TM9SF) family protein.
1755	21	55	Os02g0270800|COMBINER_EST|Os02g0270800|8	CACAGGCATGTACTCATGCCACACTACAAGTTCAGTGTATATACCTTATATGGCATCGGT	Os02g0270800		Subtilase.
1756	21	56	Os01g0780600|mRNA|AK120823|CDS+3'UTR	TGCAATAAGATGCTTATGTTTCATAGGATAATAAGCTAGTTTTAGGCCTTGAACAGAGTC	Os01g0780600	AK120823	Conserved hypothetical protein.
1757	21	57	Os02g0762600|mRNA|AK103657|CDS+3'UTR	TGCAGCGCTTGTGTAGATCGAAAATTTTATGGTGCAATCATTAGTCTGCCAGATGGCCAG	Os02g0762600	AK103657	Conserved hypothetical protein.
1758	21	58	Os08g0383700|mRNA|AK073566|CDS+3'UTR	TGGCATGTATGATGCCTTGTCAAAAGGGACTCCATTAGCAGTGTAACTTGACTTTTGCCG	Os08g0383700	AK073566	Repressor protein.
1759	21	59	Os10g0499900|COMBINER|CI275131|6	AACTTCCTGGTTCATAGAAGTGTATCTGGCAACGTTCAAAACTTCAATTTATCGAAGTAC	Os10g0499900	CI275131	(No Hit)
1760	21	60	Os01g0825900|mRNA|AK101175|CDS+3'UTR	AACCAACTATAAATATATTTTAAAGAGATAAAAGAGGAAATAAAAGAGCAGCAGGCTACA	Os01g0825900	AK101175	Protein of unknown function Cys-rich family protein.
1761	21	61	Os05g0351200|COMBINER|CI208459|6	TTCTTCTTCGTAGTTTGTTTGGTGGGGTTCGCTTGGGGTAATGAGGTGGTATTGGGAAGA	Os05g0351200	CI208459	Pathogenesis-related transcriptional factor and ERF domain containing protein.
1762	21	62	Os08g0114300|mRNA|AK105866|CDS+3'UTR	AAATTGGTTGGCGTGATTTGATTTTGAGATGTAATGATGCTTTAATGTGGACAGTGTCAG	Os08g0114300	AK105866	Plant-specific FAD-dependent oxidoreductase family protein.
1763	21	63	Os06g0646900|mRNA|AK063383|CDS+3'UTR	TGAGCTGCATGTCAAAGAGGAAGAAATACTGACGGTGGGTGATTTGAAATGCTTCCCAGT	Os06g0646900	AK063383	Similar to Homogentisic acid geranylgeranyl transferase.
1764	21	64	Os10g0437900|COMBINER|CI199341|6	GGGGTGTGGACTGATGATATGGAGTATTGTACAGGATTCAGCAACTACTGTAAATCTGTA	Os10g0437900	CI199341	HSP20-like chaperone domain containing protein.
1765	21	65	Os04g0682300|mRNA|AK073871|CDS+3'UTR	ATACAGCAGAGCAGTGCAGATCTCTCTTCATGTCGAAGTGACCTGATTACCGTGCATTTT	Os04g0682300	AK073871	Similar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2).
1766	21	66	Os03g0735900|COMBINER_EST|Os03g0735900|8	AACGACGGCACCGTCGTGTCCAAGCCCAACATCGACGAGAAGAAGGCCATGGGATGTTAA	Os03g0735900		Phospholipid/glycerol acyltransferase domain containing protein.
1767	21	67	Os05g0460500|COMBINER_EST|CI239574|6	ATTGTTAGCCCTTTTCCTTTCGGTTTGTAATTGTCAACAATGTGGTACTATGCTTGGTTC	Os05g0460500	CI239574	Similar to Histone H2B.2.
1768	21	68	Os01g0795100|COMBINER_EST|Os01g0795100|8	ACAACGGCCAGAAGACAGTGAGAATCCCGATAGCAGTCAGGATTACAATTCAGGATTTCT	Os01g0795100		Similar to Subtilase.
1769	21	69	Os02g0820200|mRNA|AK059979|CDS+3'UTR	TGCAAAATGCAATATTACATGTCAATTTTTCTCTAATGGACACCTATAACATGGTTTGTG	Os02g0820200	AK059979	Zinc finger, RING-type domain containing protein.
1770	21	70	Os11g0576900|mRNA|AK072935|CDS+3'UTR	AGCCTGTTTTATTCTGTGACATTTGTAAGGTTATTCTTTCCTTAATCTTAATTAATTGTA	Os11g0576900	AK072935	Protein of unknown function DUF295 family protein.
1771	21	71	RC9		
1772	21	72	Os08g0445700|mRNA|AK109708|CDS+3'UTR	AGATGGTGGTATTTAAGTAGAGGGCCTTTGTGATTCTATCTTTTCTGTTAGAATACACAT	Os08g0445700	AK109708	HAD-superfamily hydrolase subfamily IIB protein.
1773	21	73	Os03g0803900|COMBINER_EST|CI374989|6	GGCGTTTTACTCAATTTGTCGCAGAATTTTTGATTTGACATGGTCATAAGTTATGACATG	Os03g0803900	CI374989	Galectin, galactose-binding lectin family protein.
1774	21	74	Os05g0209100|mRNA|AK069043|CDS+3'UTR	TTTGGCGTGTTTGTGTTATGGTAGTGCTCTACTGTAAGCCTGTAGCAAAATCTCCTAAAA	Os05g0209100	AK069043	Glycoside hydrolase, family 47 protein.
1775	21	75	Os04g0405300|mRNA|AK110700|CDS+3'UTR	CTGTCACGTTAGGCTTGTGTCACGATCGACGCTGTCACAGTTTATGTTTGACTTATGTTC	Os04g0405300	AK110700	Similar to Stem secoisolariciresinol dehydrogenase (Fragment).
1776	21	76	Os08g0307600|COMBINER|CI266199|6	TGTTTTAACATCTCATGGGTAGATGTTATACTTTAGAATAACATTGTGGTGGCTTAAAAT	Os08g0307600	CI266199	(No Hit)
1777	21	77	Os10g0487600|mRNA|AK059738|CDS+3'UTR	ATGGAGATCACTGTTGCCTGGTCATGTCTTTCTTTATCATGTCGATGATTTGGGGGTAGT	Os10g0487600	AK059738	Conserved hypothetical protein.
1778	21	78	(-)3xSLv1		
1779	21	79	Os04g0473400|mRNA|AK067896|CDS+3'UTR	GGTTCAATTTAGTGATGTTCTGCATCATACATTCATACTATACACATAAGCCATTTTGCC	Os04g0473400	AK067896	Similar to 60S ribosomal protein L6-B (L17) (YL16) (RP18).
1780	21	80	Os12g0497300|mRNA|AB080264|CDS+3'UTR	TTGTGTTTCAGCGGGGGTGTACAGCAAGTCGCCACAATTTTGGCTTGGCACCAGCGATGT	Os12g0497300	AB080264	Similar to DNA repair protein RAD51 homolog.
1781	21	81	Os03g0843300|mRNA|AK104650|CDS+3'UTR	TTGTGGGGTCAGTTGATATTTTTCGTTATGTTTTCCCCAAATACTGGTTGTGAGGGCGAA	Os03g0843300	AK104650	Late embryogenesis abundant protein 2 family protein.
1782	21	82	Os05g0532800|mRNA|AK111043|CDS+3'UTR	GTTACTGTCTTGCTGATGAACATAAGTGCTGAAGTGCAAATGGGCGCTACTGAATTTGTC	Os05g0532800	AK111043	Conserved hypothetical protein.
1783	21	83	DarkCorner		
1784	21	84	DarkCorner		
1785	21	85	DarkCorner		
1786	22	1	DarkCorner		
1787	22	2	DarkCorner		
1788	22	3	DarkCorner		
1789	22	4	Os01g0235300|mRNA|AK059862|CDS+3'UTR	CTCGAGTGCTCGATTCAGACTGATCTTGCATGTCATTGTGTGGCTAATGTGATGTTTCCA	Os01g0235300	AK059862	SOUL heme-binding protein family protein.
1790	22	5	Os10g0384600|mRNA|AK071078|CDS+3'UTR	AGAACTACAATTTAAATATGCATGTTGCAAAGTTTGTAACAATCGGAATACGGATGTCGG	Os10g0384600	AK071078	Cyclin-like F-box domain containing protein.
1791	22	6	Os12g0143900|mRNA|AK065216|CDS+3'UTR	ATGTCCACGAATGCTTGATAATCATCTAATAGGATGATCAGGTAAAAGAATAGCCTGTTT	Os12g0143900	AK065216	Similar to Long chain acyl-CoA synthetase 6 (EC 6.2.1.3).
1792	22	7	Os07g0541700|mRNA|AK105128|CDS+3'UTR	TTACCGATATTTGTACAACGGACTCTTATTAATCTGGCTATCTAGGTGTTGTGTTTTCGG	Os07g0541700	AK105128	Similar to Receptor-like protein kinase 5.
1793	22	8	osa-miR399f|Os06|5'seq	TGGTGGATTACCGGGCCATGTCTCCTTGGGCAGAGGTGATCAGATTGCACACTTCACTTC			miRNA
1794	22	9	Os03g0173500|mRNA|AK099854|CDS+3'UTR	TTCTGTTTCGTGAGGGGGTCTACATAGTTCTTTCTTTGTGTGTGGCTGTAGGGGTGAAAA	Os03g0173500	AK099854	Similar to Kinase associated protein phosphatase.
1795	22	10	Os11g0679700|mRNA|AK120619|CDS+3'UTR	GTGTTTTAATCAAATTAATGATTGTATAGAAACAACAAGAAGCTGGCACCATCAAGGAGC	Os11g0679700	AK120619	Lambda integrase-like, N-terminal domain containing protein.
1796	22	11	Os12g0540100|COMBINER|CI413782|6	TACGTTCTTTTCTGGATTGATATAATGTAATAATTGGCTGTAGCTTGTAAAGGCTGGGAT	Os12g0540100	CI413782	Conserved hypothetical protein.
1797	22	12	Os04g0616700|mRNA|AK111539|CDS+3'UTR	ATTAGGGAGTTATCTCACACGGTTTTCCGGTCAAGACATACAAATTAGAGAGAATCTCTT	Os04g0616700	AK111539	Protein kinase-like domain containing protein.
1798	22	13	Os11g0572400|mRNA|AK101277|CDS+3'UTR	TTGAGCTAGTAACCTACACCCTGAATTGTAGTACTATAGTTTTTGTTGTTGACACATGTT	Os11g0572400	AK101277	Similar to ST3GAL-I sialyltransferase (Fragment).
1799	22	14	Os11g0252900|COMBINER|CI348323|6	TTGTTCAACCTTAGACACTAATCCCTCCGTATACGGTTGAACGTGCATTTGGGTCACTAA	Os11g0252900	CI348323	Conserved hypothetical protein.
1800	22	15	Os10g0458600|COMBINER|CI422732|6	GAACAAGCAAGACAACGAAGGGAACACTGCTCTGCACCTAGCTGTAGAAGCTGGGGATTG	Os10g0458600	CI422732	(No Hit)
1801	22	16	Os06g0473200|mRNA|AK119330|CDS+3'UTR	CTGACATGCTGGTGTGTGGGGTCTCAACCCAGATTACAATGAGCATATTATGGTCATGTT	Os06g0473200	AK119330	Similar to NPK2.
1802	22	17	Os07g0203500|COMBINER|CI515211|x	CCACCGGCGGGCAACGCCAGGATGAGGCGTGAAGCCCTGAAGCAGGTTCGGCGGGGAGTA	Os07g0203500	CI515211	Conserved hypothetical protein.
1803	22	18	Os07g0642300|COMBINER_EST|CI428332|0	AAGTCCCAGAGGAATACCCCTACAAGGATGATGACTGACTTGACGATTTCGTGGATAGTT	Os07g0642300	CI428332	Transport protein particle (TRAPP) component, Bet3 family protein.
1804	22	19	Os01g0678600|mRNA|AK062194|CDS+3'UTR	CCAATACTTTTCTCCCACTTCTGTTATCCTTCACATCAGTGTTGTAAAATGACAAGCTGA	Os01g0678600	AK062194	Ribosomal protein S20 family protein.
1805	22	20	Os11g0706100|mRNA|AK070611|CDS+3'UTR	TGGTTTTGGAGCCACTTCTTCCCTCGTCCTATCAAAAGAAGCAATGATCATTAGATATAA	Os11g0706100	AK070611	Protein of unknown function DUF37 family protein.
1806	22	21	Os04g0618500|mRNA|AK103625|CDS+3'UTR	AACTTGTGTGAGGCAGTCTGTATCTTGATATTTATCATGCTCAGCTCAACTGTCATATCT	Os04g0618500	AK103625	Similar to Gamma-SNAP (Fragment).
1807	22	22	Os05g0452900|mRNA|AK063393|CDS+3'UTR	GAGCGAGTACTACTAAATTTGTTTACAACCCTTGCTAGTTTAATTACTCCCTCCATCCTA	Os05g0452900	AK063393	Conserved hypothetical protein.
1808	22	23	Os07g0623200|mRNA|AK058506|CDS+3'UTR	TTTGGAGGAAATAAAAAGAATAAAAACATGACCAATCACAATGCAAGGATCTTGTACCCC	Os07g0623200	AK058506	Heavy metal transport/detoxification protein domain containing protein.
1809	22	24	Os01g0536000|mRNA|AK120431|CDS+3'UTR	ATCAACACGCTTTGTAGTTTGTCTCAAGATGTATTAATTTCTCCCTGCTCCATTAGCAGC	Os01g0536000	AK120431	Similar to CBL-interacting serine/threonine-protein kinase 24 (EC 2.7.1.37) (SNF1-related kinase 3.11) (SALT OVERLY SENSITIVE 2 protein).
1810	22	25	Os04g0682800|mRNA|AK060526|UTR	ATTCTGATTTCCCATATGTTTGTATATTTATGCTGGATACTGTTATAGTTTGTCATATTT	Os04g0682800	AK060526	Sodium/hydrogen exchanger family protein.
1811	22	26	Os04g0261400|mRNA|AK109843|CDS+3'UTR	GTGGGGTGGGGGTGGTAGGGGCATGAGATTGGAGATCATTTGCACCATTAATTTGCTTTG	Os04g0261400	AK109843	Cytochrome c region domain containing protein.
1812	22	27	Os06g0634000|mRNA|AK073652|CDS+3'UTR	CTGTATGATGTTTTGCTTTGTAATGTATCATAAGGAATAAAACAATTGGGCCACTTAACT	Os06g0634000	AK073652	Conserved hypothetical protein.
1813	22	28	Os01g0188200|mRNA|AK106248|5'UTR+CDS	TTGTATTTCATGGTATGCTTGTAAAACTCGAGATGTCAATCAAGAATCAGGGGATTCAAA	Os01g0188200	AK106248	Conserved hypothetical protein.
1814	22	29	Os04g0612600|mRNA|AK104427|CDS+3'UTR	ACTCTGAACCCCTGCTGTATAAACAAATATAATGTAGAATCTTGAATGGTGACGTTTGTG	Os04g0612600	AK104427	Similar to Coatomer-like protein, epsilon subunit.
1815	22	30	Os08g0208200|mRNA|AK062824|CDS+3'UTR	TTTTTTATTAATATCACATAGCTTGCCAATTCATGCTGGGCAAGACATGCAGGTTGTTAC	Os08g0208200	AK062824	Peptidase A1, pepsin family protein.
1816	22	31	Os11g0107600|COMBINER_EST|AU094304|6	AGAAGAATTCTGTTATTGATCCTGATATTGATGTGATCCGTCTCATCAATCGTGCCGGTT	Os11g0107600	AU094304	Prenylated rab acceptor PRA1 family protein.
1817	22	32	Os01g0142300|mRNA|AK060202|CDS+3'UTR	TCCACGGCATCAACACATCAAGATGCTATTGTGCACGCAATGAAAAGTTTGGTATCAACT	Os01g0142300	AK060202	Glycosyl transferase, group 1 domain containing protein.
1818	22	33	Os10g0498800|mRNA|AK058916|CDS+3'UTR	ACGAGACACATTTTTACCAAAAAGGGAAATAGATTGAATGTTCTTCCAAGGAATGCAGAT	Os10g0498800	AK058916	Protein of unknown function DUF974 family protein.
1819	22	34	Os01g0369900|mRNA|AK100034|CDS+3'UTR	CATTTGTGGTGTGAACCTCAGCTTGTACCGTGTGTACTATACTAGTATAAAAACGACTTA	Os01g0369900	AK100034	Similar to Oxo-phytodienoic acid reductase.
1820	22	35	Os06g0481800|COMBINER_EST|Os06g0481800|8	AGTTGATTTACTTCATGAGCACAATAACCCACATTACCGGTGCCAAAACGGGTGGACAAG	Os06g0481800		"Transposase, IS4 domain containing protein."
1821	22	36	Os04g0493400|mRNA|AK099973|CDS+3'UTR	TTAGGATCGCGGGATCGAAAGATGAGTAAACATGTGTACCGGTGGACCACTTAAATAATT	Os04g0493400	AK099973	Similar to Chitinase.
1822	22	37	Os05g0391000|mRNA|AK105218|5'UTR+CDS	AAATTATCCGTGCATAGCACCGCCTCCTCTCGCTTCCTCCACCGGATCTGGATGAGGGGA	Os05g0391000	AK105218	Conserved hypothetical protein.
1823	22	38	Os08g0560600|mRNA|AK109222|CDS+3'UTR	TAGCATGCAGAACAGCTAATTTTCTGCAGCAGAGCTGAATACTGAAGTTGTGTGCTGTAC	Os08g0560600	AK109222	Conserved hypothetical protein.
1824	22	39	Os04g0278500|COMBINER_EST|Os04g0278500|8	ATGATTTGCTTAATGCTGTGGCAGCTGAAGAGAACTCCGATCAGGAGGACACTTGTCATA	Os04g0278500		Hypothetical protein.
1825	22	40	Os01g0199400|mRNA|AK070748|CDS+3'UTR	AGGACTGGGTCGAAAACTGAAAAAGGGTTTGTGATCTGTAATTATATATATACACCCGCA	Os01g0199400	AK070748	Alpha/beta hydrolase family protein.
1826	22	41	Os07g0490500|mRNA|AK061151|CDS+3'UTR	TGATTACCTATGTATTGACAGGTCTCTACGTGAAAAGAACTTCTCAGATTAGTTCTTGTG	Os07g0490500	AK061151	Xanthine/uracil/vitamin C permease family protein.
1827	22	42	Os12g0620400|mRNA|AK059973|CDS+3'UTR	ATATATTCCCCGGTAATGCCTGTGTAATACTAGTAGTGATGTAATCTAAGTTGTGTCTTG	Os12g0620400	AK059973	Methyl-CpG binding domain containing protein.
1828	22	43	Os08g0104700|mRNA|AK067468|CDS+3'UTR	CAAATGTTCATTGTTAATTTCACAGTTATTACAGTGAAATTGCAAAATTGATGATTATTC	Os08g0104700	AK067468	Chaperonin Cpn60/TCP-1 family protein.
1829	22	44	Os07g0568600|mRNA|AK073000|CDS+3'UTR	CAAACATTTGGCGAAATGTACTGTACAAGAGAAAGGAAAAGGAAGTAGGTGGTTTTTGTG	Os07g0568600	AK073000	Similar to Calcium-dependent protein kinase.
1830	22	45	Os10g0184300|mRNA|D21309|5'UTR+CDS	CACTGGGTGGAGTTCCAGAACAAGTTTTACGAGGGTGATGGATACAAGTTTGTACCCTTT	Os10g0184300	D21309	ATPase, V0/A0 complex, 116-kDa subunit family protein.
1831	22	46	Os02g0474700|mRNA|AK068629|CDS+3'UTR	GGTTTTGTTCTTGTCTAGATCTTACCGTGAGTTTCCATTGGTGGGCTGGGATATACGGTT	Os02g0474700	AK068629	Armadillo-like helical domain containing protein.
1832	22	47	Os04g0635700|mRNA|AK062025|CDS+3'UTR	AACACAGCTTAATTACGAAGAATCAGTTTCAAGAATATATGGATCAGAAATTGCTGTCGG	Os04g0635700	AK062025	Ribbon-helix-helix domain containing protein.
1833	22	48	Os02g0791900|COMBINER|CI265181|6	TTTTTTGACGTGGGTAGTGTTTAGTTCCTCCAAACTTCTGAAAATTCCATCACATCAAAT	Os02g0791900	CI265181	(No Hit)
1834	22	49	Os01g0973500|mRNA|AK069546|CDS+3'UTR	GATTGATTGCTTGATTAAGCTTCTTCATTCATGTTGGCCGCTGCAAATCCGACCGACTCT	Os01g0973500	AK069546	Similar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).
1835	22	50	Os01g0580500|mRNA|AK102472|CDS+3'UTR	GTTTGTAACTTTGTATACTTGTTTGGTTTGAATCAATCGTCGTGTAGTACGCAGGGTTCC	Os01g0580500	AK102472	Similar to 1-aminocyclopropane-1-carboxylate oxidase (Fragment).
1836	22	51	(+)eQC-39		
1837	22	52	Os02g0590400|mRNA|AK061356|CDS+3'UTR	CCATGCAGCTTTGTGTATACCGATGGGTTGGTTGGTAAATAAAAACCAAAAATTACTGCT	Os02g0590400	AK061356	Lecithin:cholesterol acyltransferase family protein.
1838	22	53	Os03g0648400|mRNA|AK058555|UTR	TCAACATTTTTTGTGGTCAGATGGCTATGCTTGCACCGTGAGACTCGTAGAGTTGTGCAT	Os03g0648400	AK058555	Similar to DnaJ protein homolog (DNAJ-1).
1839	22	54	Os10g0568900|mRNA|AY307388|CDS+3'UTR	CCTGTAAAAAACTCCCAGTATGCATATTGCCGAAAATAACTGTAATGTATGTTTACATGG	Os10g0568900	AY307388	Haloacid dehalogenase-like hydrolase domain containing protein.
1840	22	55	Os06g0606800|mRNA|AK106565|CDS+3'UTR	AAACTGTGAAAAAGTAAAGCCTCAAAGGGTTGGCAGCACTCCTGCGTACGGATTTGCATT	Os06g0606800	AK106565	Targeting for Xklp2 family protein.
1841	22	56	Os09g0133600|mRNA|AK061477|CDS+3'UTR	TTTGATGTCCCTGAGCACCTGAGCTGCTATACTAGTATACATGTTATATATTGCAAAAGT	Os09g0133600	AK061477	PAP fibrillin family protein.
1842	22	57	Os09g0372200|COMBINER_EST|Os09g0372200|8	AGAGGCAACATGATTCACAAACAAAACAAATCCATAGACACAGTCGTCACCGGAAGGGAG	Os09g0372200		Hypothetical protein.
1843	22	58	Os03g0821100|mRNA|AK102784|CDS+3'UTR	TTGTTTTACTGCTGTATTACAATTGCAATTGATTATGCTAGGTGGGTTTGGCCCCCGGTT	Os03g0821100	AK102784	Similar to Non-cell-autonomous heat shock cognate protein 70.
1844	22	59	Os12g0456000|COMBINER_EST|Os12g0456000|8	AGAACTCACAACTTTAGATATTGCCACAGTTGAGGCCGAATGGCTTCGTGAGCTCCTGAT	Os12g0456000		Hypothetical protein.
1845	22	60	Os03g0324200|mRNA|AB074971|CDS+3'UTR	TCTAGTTTGGTTTTTTCCTAACTGAGCGTTTCAATAATAAATGTATAGCAAACTTATTTT	Os03g0324200	AB074971	EIL3.
1846	22	61	Os01g0729900|mRNA|AK120504|CDS+3'UTR	CTGTCTGGTGGCATTGTCAAACCCACATTGTTCTTGAACACATGCTGAGTGATTGCTGTT	Os01g0729900	AK120504	Conserved hypothetical protein.
1847	22	62	Os08g0109300|mRNA|AK061825|CDS+3'UTR	CCGAAGAAATGGTTAGGAATGTATTTGATATACAACCCTAATGAAAGGGTTGACTTCATT	Os08g0109300	AK061825	Similar to Adenylate kinase, chloroplast (EC 2.7.4.3) (ATP-AMP transphosphorylase).
1848	22	63	Os07g0667300|mRNA|AK120101|CDS+3'UTR	TTGCCATGATGTTGCTTTGTTCCAATTCTGATTTAAGACTCCTACTGGTTATTGCAGAAA	Os07g0667300	AK120101	Zinc finger, B-box domain containing protein.
1849	22	64	Os09g0416800|mRNA|AK065377|CDS+3'UTR	TAACAGTTAGCTTCACTGTGAAAAATGTCACCGTCCTAGTTCATGTTGAATGTAAAGGGC	Os09g0416800	AK065377	Similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1).
1850	22	65	Os11g0558900|mRNA|AK119422|CDS+3'UTR	TGTGTATATATCTGTTTGTACTGGTACAGTTGTGTAGTGTGTCAGAAATCACCCTTCAGA	Os11g0558900	AK119422	Leucine rich repeat, N-terminal domain containing protein.
1851	22	66	Os04g0558900|mRNA|AK100861|CDS+3'UTR	TTTTTTCCTGTTTCTCAAATAGATGCAGACGTGACACTCCTCTCAAATAGATGCTGGTGT	Os04g0558900	AK100861	Proteinase inhibitor I9, subtilisin propeptide domain containing protein.
1852	22	67	Os03g0859500|mRNA|AK070637|CDS+3'UTR	GACATACAGACGGTTTAGTTTGGGGATTGAATTGAAGATGATATTATCTTGTTGTCCTGA	Os03g0859500	AK070637	ABC transporter related domain containing protein.
1853	22	68	Os06g0708700|mRNA|AK067151|CDS+3'UTR	GTGCTTTCGTTGTGTCTGTCTAGTAATGATTCCGTTGCTTCATTTGTTTTATATATGTGA	Os06g0708700	AK067151	Similar to Nodulin-like protein.
1854	22	69	Os08g0332700|mRNA|AK109737|CDS+3'UTR	TAACTTTTGGAGCAATGTTCTTCTAAAACAGGTGTCCTGCCATTAACTGTGGAGGGACTC	Os08g0332700	AK109737	Pentatricopeptide repeat containing protein.
1855	22	70	Os03g0727200|mRNA|AB007625|CDS+3'UTR	TGTTTTTCCCCAAAGGGAAAGTCAGCTTGGACATTGGACCAATCAAGAAATGAAATCTCA	Os03g0727200	AB007625	Similar to HOS13 protein (Fragment).
1856	22	71	Os03g0198500|mRNA|AK104430|CDS+3'UTR	GACACGAACCGGGATGTATTTTGTATATTATTAATCCACTATTCTTTCAGCTGTTGTAGC	Os03g0198500	AK104430	Protein of unknown function DUF862, eukaryotic domain containing protein.
1857	22	72	Os03g0784000|mRNA|AK073469|CDS+3'UTR	CATGAGAGGAGCCTCCAAAATACTACGGTGTTTAAACTTTCCGTCAGGGTTGTGACTTGT	Os03g0784000	AK073469	FAD dependent oxidoreductase family protein.
1858	22	73	Os03g0152600|mRNA|AK109525|CDS+3'UTR	ATGTACAGACATGGTCACACCCCTGCATATAAGAAACTGTGAGTTAACAGCTCAACTTCT	Os03g0152600	AK109525	Conserved hypothetical protein.
1859	22	74	Os04g0649200|mRNA|AK103112|CDS+3'UTR	GCGGTATGTATTAGCGTGATTTGCAATGTTTCCGCAACCATTACACTGTTGCTTGAGCTT	Os04g0649200	AK103112	Protein of unknown function DUF869, plant family protein.
1860	22	75	Os06g0716800|mRNA|AK103968|CDS+3'UTR	TGGCTAGGCCTCAAGTTTTGATGTGAATCTCTTGTAAATACATCATGTATGAAATCTTTG	Os06g0716800	AK103968	Eukaryotic transcription factor, DNA-binding domain containing protein.
1861	22	76	Os12g0162500|mRNA|AF465825|CDS+3'UTR	GTTCATTCCTGGATTAATGCCTAGACTGAGTTAACTATGTTAACCATTTAACACTTGTCT	Os12g0162500	AF465825	Similar to BZIP-like protein.
1862	22	77	Os06g0663900|mRNA|AK059197|UTR	CGGCACAAGAAGCTTGCCTTGGAGCAGTGATACTTGAGTTGATTTTGACTGCCATCTTTT	Os06g0663900	AK059197	Protein kinase-like domain containing protein.
1863	22	78	Os02g0509600|mRNA|AK111075|CDS+3'UTR	AAATGTGCACCTTTTTAAGGATTGAAAGCAAGTGCACGTTTCTTCACTTGTTGTAAAGAT	Os02g0509600	AK111075	Conserved hypothetical protein.
1864	22	79	POsControl0009|genome		
1865	22	80	osa-miR164c|Os05|Mature	TGGAGAAGCAGGGTACGTGCATGGAGAAGCAGGGTACGTGCATGGAGAAGCAGGGTACGT			miRNA
1866	22	81	osa-miR164b|Os05|3'seq	GGCCGCCGGCCGCCATTGCCATGGATGGTTCTTCATGTGCCCGTCTTCTCCACCGAGCAC			miRNA
1867	22	82	Os05g0560000|mRNA|AK060254|CDS+3'UTR	CCCCTGTTTATGATGTTGATATAATTGTACTATTCCTATGGCTATATAAGTTGTAAAGGA	Os05g0560000	AK060254	Photosystem I reaction center subunit VI, chloroplast precursor (PSI- H) (Light-harvesting complex I 11 kDa protein) (GOS5 protein).
1868	22	83	DarkCorner		
1869	22	84	DarkCorner		
1870	22	85	DarkCorner		
1871	23	1	DarkCorner		
1872	23	2	DarkCorner		
1873	23	3	DarkCorner		
1874	23	4	Os03g0708000|mRNA|AK105828|CDS+3'UTR	GCCTTCAACTTCACAGTTCACGTGGGCTCCCCCTTGACAGAGGCCCAGACTTACGACAAA	Os03g0708000	AK105828	Phospholipase A2 family protein.
1875	23	5	Os05g0400400|mRNA|AK062745|CDS+3'UTR	TGGTGCGCTCTGGAATCAGTTGAAAACTATACAAACTCCTCGGAATGAAAGTTATTTTGA	Os05g0400400	AK062745	Similar to Ubiquinol-cytochrome c reductase complex 8.0 kDa protein (EC 1.10.2.2).
1876	23	6	Os06g0598800|mRNA|AK101377|CDS+3'UTR	TTGGAGTCTTCATGTGACGTTTATTCATCGTTGCCTGATTGTGATTGCCCTTGTAGCACT	Os06g0598800	AK101377	Similar to Fatty acid elongase 1-like protein.
1877	23	7	Os01g0654400|COMBINER_EST|CI046497|0	GTTGTTGTACGTGCGCCTAGAGTGTTCTTCTGTTTGTAAGAGCACCATGTGTGTGAGCCT	Os01g0654400	CI046497	Conserved hypothetical protein.
1878	23	8	Os06g0171900|mRNA|AK100886|CDS+3'UTR	TGGACCAATACTCTCTCTGGGCAATAATGCAGAAGTAATCTATATCTTCGGTTGTTGGTT	Os06g0171900	AK100886	Similar to GAMYB-binding protein (Fragment).
1879	23	9	Os06g0700100|mRNA|AK119443|CDS+3'UTR	AGGCTATCCCCAAGGGGTTTCTATAAGGACTAGCCCATAAAGAAATATAAAACAAAAAAC	Os06g0700100	AK119443	Protein prenyltransferase domain containing protein.
1880	23	10	Os06g0625200|COMBINER_EST|Os06g0625200|8	TCACGCTCTCAGCGGTGTACAACCTCACGGTTGATTGGGATCCTCAGAATTACAGCGCAT	Os06g0625200		Peptidoglycan-binding LysM domain containing protein.
1881	23	11	Os05g0470900|COMBINER_EST|CB634005|7	TATATGCAAGAAGTACTTAGGTCTCTCAGCAGTACAGGAGGGTTCAGCTGTTGCATGTAG	Os05g0470900	CB634005	Conserved hypothetical protein.
1882	23	12	Os07g0417300|COMBINER|CI039135|6	CACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAATGAAGAAA	Os07g0417300	CI039135	(No Hit)
1883	23	13	POsControl0038|art		
1884	23	14	Os05g0135100|COMBINER_EST|Os05g0135100|8	GACTCTGTCTCTGGAAGTTACAGCTTGGAGCAACAATTTTCTTCATCAATCAATTTGCCA	Os05g0135100		Protein kinase-like domain containing protein.
1885	23	15	Os01g0642200|mRNA|AK105174|CDS+3'UTR	TCTTGACGGTGTGTGCAGCCCATGTGATGAATATTACAAATAAGATGGTACAGTTGTGAC	Os01g0642200	AK105174	Conserved hypothetical protein.
1886	23	16	Os02g0709400|mRNA|AK064381|CDS+3'UTR	TGCCTGTATGTAATCGAAATCTGATCTCATTCAATGGAAGCTATTTTTTGGTACCCTTTG	Os02g0709400	AK064381	Dek1-calpain-like protein.
1887	23	17	Os11g0252400|mRNA|AK065745|CDS+3'UTR	CAACACTACATATAAGTTCATGCAAAATGTATGTTGTAATATATACATTTTATTTTGGTG	Os11g0252400	AK065745	Ankyrin repeat containing protein.
1888	23	18	Os08g0493100|mRNA|AK108678|CDS+3'UTR	ATTTATCTCTTTATTTAAGTCTTGAATGCATAAAGACTACAAATAAAAATAACTTATTTG	Os08g0493100	AK108678	Cyclin-like F-box domain containing protein.
1889	23	19	Os01g0693900|mRNA|AK066034|CDS+3'UTR	AGCCTTTTTGTCTTGGTAATCTATACTTTGGAAATCGTCAGCATACTGTTAAACAGGATT	Os01g0693900	AK066034	Peptidyl-tRNA hydrolase family protein.
1890	23	20	Os04g0396800|mRNA|AK070195|CDS+3'UTR	ATAGAAGTAACTAACGTTTGTTACGGAGAGTACTCCCTCCGTCCAATAAAAAACCAACCT	Os04g0396800	AK070195	Peptidase S10, serine carboxypeptidase family protein.
1891	23	21	Os01g0975900|mRNA|AK111768|CDS+3'UTR	GGGATGTACGTAGAAAATGAACCATCATGTTCTCAATAATGGTTGTAACTTATTTGAAGC	Os01g0975900	AK111768	Similar to Tonoplast membrane integral protein ZmTIP1-2.
1892	23	22	Os08g0419200|COMBINER_EST|Os08g0419200|8	AGGTTTATCAAGGAGGAGGAGGTACTTTCCCTTTTTGAACTGGGGATCCTGAACTTGACT	Os08g0419200		Conserved hypothetical protein.
1893	23	23	Os07g0179500|COMBINER_EST|Os07g0179500|8	CTTTCGCTTAACATCACAAATGAGGAACACTTGCTTCAGTTGAGACACCTATTATCTTCT	Os07g0179500		Conserved hypothetical protein.
1894	23	24	Os07g0102900|COMBINER_EST|CI524655|5	TGTTATGTGTAATATTCTAAGGCATTGTATTGCCAGACTTGAAGTTCCTGTGATGTTTTG	Os07g0102900	CI524655	Zinc finger, SWIM-type domain containing protein.
1895	23	25	Os03g0441500|mRNA|AK060827|CDS+3'UTR	TAAGAGGTTCCAGGATGAGTCTGATAAATATGTTTTCTATGATTTTGCTGCCAATTACTC	Os03g0441500	AK060827	ABC transporter related domain containing protein.
1896	23	26	Os01g0238800|mRNA|AK062940|CDS+3'UTR	GAAACCATTGGAGGACCAATGTATGCGTTGCTAGCTACTGTAAAATGTTGCAGAATTTTT	Os01g0238800	AK062940	Conserved hypothetical protein.
1897	23	27	Os03g0266900|mRNA|AK119243|CDS+3'UTR	TCGAACTACTCCGCTATGTAAAACGGTAAAACCTGTTGTCTCATTATGAAAGTGAACTAT	Os03g0266900	AK119243	Low molecular mass heat shock protein Oshsp17.3.
1898	23	28	Os06g0612200|mRNA|AK059094|CDS+3'UTR	AGCAGGAAACGAACATGTGAACACTGATACTCCCTTTGGTAGTAGTATGGACATTAGTCT	Os06g0612200	AK059094	RNA polymerase Rpb1, domain 5 containing protein.
1899	23	29	Os06g0162600|mRNA|AK066755|CDS+3'UTR	TCTTTTGAAAGTGGTCGTTTAACATTTTGATGATGCGTAATAATAGTCCATCTCTCTGAG	Os06g0162600	AK066755	Similar to Ribosomal protein L11 methyltransferase (EC 2.1.1.-) (L11 Mtase).
1900	23	30	Os01g0368900|mRNA|AK107858|CDS+3'UTR	AGGCTCTTTTGAGATGTAATAATGACACATATCCGTTTAATGGAGTATACCTCTTTTGTC	Os01g0368900	AK107858	Similar to GLUTAREDOXIN.
1901	23	31	Os04g0520000|mRNA|AK102988|CDS+3'UTR	ACTGCATACTCCCTTTCTTGAAAATTCTAGTAATCTATATCCTGAGATTTTGATGGTGTC	Os04g0520000	AK102988	Nucleic acid-binding, OB-fold domain containing protein.
1902	23	32	Os12g0608600|mRNA|AK120712|CDS+3'UTR	GCCTTTTCGTTGTAAATGGTTTTGAAAATAGACATACACTGTGAATTATTATGAGCTGTT	Os12g0608600	AK120712	Similar to Thiosulfate sulfurtransferase (EC 2.8.1.1) (Mercaptopyruvate sulfurtransferase Mst2/Rdh2) (EC 2.8.1.2).
1903	23	33	Os02g0200900|mRNA|AK061400|CDS+3'UTR	GATCCCTGTTTTTACCGGCATATTGTTGAGGACTGTAATCTTTGCAACCTTCTCAGAATA	Os02g0200900	AK061400	Leucine-rich repeat, cysteine-containing containing protein.
1904	23	34	Os01g0217300|COMBINER_EST|Os01g0217300|8	GGGGGCCCTGCTCCGCCGAGAGGGTGAACCACGCCGTCGCCATCGTCGGCTACTGCGAGG	Os01g0217300		Peptidase C1A, papain family protein.
1905	23	35	Os01g0185200|mRNA|AK062984|5'UTR+CDS	CAAGGATGAAATTGACAAGAAGCTTGCAGAGATATTAGGTCCAAAGACAGATGCTGACAA	Os01g0185200	AK062984	Glutamyl-tRNA synthetase, class Ic family protein.
1906	23	36	Os02g0166500|COMBINER_EST|Os02g0166500|8	CACGCATGCCAGGCGGCCCTGCCTGGAGCGCTGGAGCTAGGTGCAGCAGCATGGCACCCC	Os02g0166500		Conserved hypothetical protein.
1907	23	37	Os01g0228600|mRNA|AK101390|CDS+3'UTR	CATTTTATCGGCCTTATGGCTGTCATTCAATCAACCATGACAAATAAGATGATCAGTTCC	Os01g0228600	AK101390	Similar to 2-hydroxyacid dehydrogenase (AGR_L_379p).
1908	23	38	Os08g0436000|mRNA|AK067548|CDS+3'UTR	TGTAAACTGTCCGGCAATTAGAAATTCCCATCCTTAGCATGCCTGGTATTGTTCAGCTCG	Os08g0436000	AK067548	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
1909	23	39	Os02g0564200|mRNA|AK059007|CDS+3'UTR	TGTACTTTTATATCAATGTTCTGTGCTTATAATCCAGCATTTGGAAATTGGAAGTGACAC	Os02g0564200	AK059007	Conserved hypothetical protein.
1910	23	40	Os03g0371400|mRNA|AK107816|CDS+3'UTR	TGTGCCGTGTTTGCGTGAGATTGAAATCGGTAAATGATGTGTCATGGTTGTATGAGATTT	Os03g0371400	AK107816	Cytochrome P450 family protein.
1911	23	41	Os05g0458100|mRNA|AJ557547|CDS	ATTCCACCCAATGCAACACTCATTTTTGAGGTGGAGTTAGTGGCTTGTAGGCCTAGGAAA	Os05g0458100	AJ557547	Similar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59).
1912	23	42	Os06g0539700|COMBINER|CI092390|6	TGTTTCGATTCGTCACCTTCTCGGCTTCTCCCCTGTTCTTGAATTTGTAAAAAGGCGGAA	Os06g0539700	CI092390	(No Hit)
1913	23	43	Os01g0673600|mRNA|AK122067|CDS+3'UTR	CAGTATCTGTGGTAGAACTTGGTGCTCCTCCAATATATTTATTACTTTATGTTGGAAAAC	Os01g0673600	AK122067	Similar to Ubiquitin-conjugating enzyme E2.
1914	23	44	Os02g0617800|mRNA|AK059678|UTR	CAAATGTTTGCTTGTGTGTTGCTTGGGAATATTTTATCCGAGATGCTCATATTTACCTTG	Os02g0617800	AK059678	Non-protein coding transcript, putative npRNA.
1915	23	45	Os03g0221200|mRNA|AK068002|CDS+3'UTR	GAGGCCTGGGGATGTGATTTATCTTCTTTATCCTTGTAATATAAGGAAAGTAGCAGCCAT	Os03g0221200	AK068002	Similar to Homocysteine S-methyltransferase 1 (EC 2.1.1.10) (S- methylmethionine:homocysteine methyltransferase 1) (SMM:Hcy S- methyltransferase 1) (ZmHMT-1).
1916	23	46	Os03g0207300|mRNA|AK120259|CDS+3'UTR	GCTTGCTGCTGAGCGGTGCCTAACATCCTTAAATTTTGAAACACATCATAAAGTGCCGAG	Os03g0207300	AK120259	Similar to Casein kinase II alpha subunit.
1917	23	47	Os03g0119600|mRNA|AK108623|CDS+3'UTR	ACGCGCATGAGCTGAGCCCTCTCGCATGTCAGTGTCACAAAGGTGTGTACTCCCTCCGTT	Os03g0119600	AK108623	Conserved hypothetical protein.
1918	23	48	osa-miR435|Os03|3'seq	TCGTTGATAGTTTAGGGACATGTTTTATCCGGTATTGGAGTTGAGGGATGAAAATTGGAC			miRNA
1919	23	49	Os11g0209400|COMBINER|CI407110|x	ATCACCAGATTAATTGAAAAGAAAATGGAAATGCTGCATGACATTTCGTGGGAGTCGGAA	Os11g0209400	CI407110	Hypothetical protein.
1920	23	50	Os01g0953400|mRNA|AK107454|CDS+3'UTR	AAGCCTTTCAAACAGGTTCTTTGTTTTTTGGTCTGTTTGCTGAGGGGACCAAGTTTATTG	Os01g0953400	AK107454	NB-ARC domain containing protein.
1921	23	51	Os04g0205900|COMBINER_EST|Os04g0205900|8	CTTCACCGGCCGGCCGCCGCATCCGCCACTGACTGATGTCACCGCTAGCACGGCTGGCCT	Os04g0205900		HGWP repeat containing protein.
1922	23	52	Os09g0425700|mRNA|AK066836|CDS+3'UTR	AAGTTGAGGGTCCTTCGGTGTACTTTTTCTAACACTGGAATTGGATGCTACGAACAGCTG	Os09g0425700	AK066836	Similar to N-myristoyl transferase (EC 2.3.1.97).
1923	23	53	Os03g0272900|mRNA|AK063186|CDS+3'UTR	GAAGATGGCCAATTAGGTGAAGTATGTATAGATCAGAGAGTTTGATTATTAGGAGCCCTT	Os03g0272900	AK063186	DVL family protein.
1924	23	54	Os01g0621900|mRNA|AK103381|CDS+3'UTR	ATGTCGTTGAACTGCCCTTCTGTCAGAATTCATGTAATCTTGGTACTTCGTGTTTATTTG	Os01g0621900	AK103381	Conserved hypothetical protein.
1925	23	55	Os01g0944000|mRNA|AK120633|CDS+3'UTR	TTCATTGTGTAAAATAACTCGTAAATTCATTGTGCCAGAATTGATCACTGATCAGGTGTG	Os01g0944000	AK120633	Conserved hypothetical protein.
1926	23	56	Os11g0157400|mRNA|AK066482|CDS+3'UTR	TTGCTTATTGCAGTGAGACTGTACTATTGGGATCGAAAGGCATAATAAAGGGGACAAGAC	Os11g0157400	AK066482	Exo70 exocyst complex subunit family protein.
1927	23	57	Os07g0192700|mRNA|AK109791|CDS+3'UTR	GTTCGAACTTCGAAACGAAATTTAAATGTAGCTGGTGTTTGGTTCATTTCCTGTAAATTC	Os07g0192700	AK109791	AAA ATPase domain containing protein.
1928	23	58	Os01g0839700|mRNA|AK104148|CDS+3'UTR	AATGGAGCAATACTCGGTGCTGTACAAAAATACTTGCTGGAGTTTACTCATTCATCAGTT	Os01g0839700	AK104148	Similar to Ubiquitin carrier protein.
1929	23	59	Os02g0249000|mRNA|AY429650|CDS+3'UTR	CTAACTGAAGGCCTCTCTTTAATCGGCATGTAAAACTTATAGATTATGAGTACTATGCAA	Os02g0249000	AY429650	Similar to Glutelin type-B 2 precursor.
1930	23	60	Os03g0685500|mRNA|AK062080|CDS+3'UTR	TAAATATTATGGAATTAAACCCGTTATTTCTCGAAACGCTCCGTTGTTTCATGTTTCGTG	Os03g0685500	AK062080	CHCH domain containing protein.
1931	23	61	Os01g0893500|COMBINER|CI240833|6	AATGCCGAGATGAGCGAGAGAAATGCACTTGGCTAGGCGAGTGCATATGTAGTCAAAAGA	Os01g0893500	CI240833	Conserved hypothetical protein.
1932	23	62	Os03g0843000|mRNA|AK064669|UTR	AGGCTATAAAAGCCGGTCAAGTCCCTATAGCTAGAGGAGACATTTTTTAATACAAAAAGT	Os03g0843000	AK064669	Non-protein coding transcript, uncharacterized transcript.
1933	23	63	Os04g0685900|mRNA|AY224496|CDS	AGCAGCCATTGATCCTACTCTGGATCAATCTGATGAGACTTTTGAGAGCATCTCCGTGAT	Os04g0685900	AY224496	Similar to Receptor-like protein kinase-like protein (Fragment).
1934	23	64	Os04g0510000|mRNA|AK109180|CDS+3'UTR	ATGTAATATGTGTTCCGATGTAATATGTCTATCAGTCAATTCTAGTGGTATGGTTTGCAT	Os04g0510000	AK109180	Conserved hypothetical protein.
1935	23	65	Os05g0543400|mRNA|AB021979|CDS+3'UTR	TTGTATGTTGCAATTTGCTGATCTTGGATAATAATGTTATTTCGGGTGTGATGGACCGCT	Os05g0543400	AB021979	Similar to Farnesyl diphosphate synthase (Fragment).
1936	23	66	Os01g0720500|mRNA|AK103946|CDS+3'UTR	TTGTGTAAAACAATGTTATCTGGTTGGTTGATGAAAGAAGTACAATGGACCTGATTGTGT	Os01g0720500	AK103946	Similar to Type I chlorophyll a/b-binding protein b (Fragment).
1937	23	67	Os03g0105600|COMBINER_EST|CI390494|0	ATAGGCACAATACCCTGTTGCCTTGTACTCGTAGGAGTATGTGCTGTTACTGTCTAACTG	Os03g0105600	CI390494	Similar to Tubulin beta-2 chain (Beta-2 tubulin).
1938	23	68	Os03g0185500|mRNA|AK106310|CDS+3'UTR	TGCTCTCTGAATGACATGTATTATTTTTCTCTCGAAATTCATAAGCATGTAACCACACAC	Os03g0185500	AK106310	Conserved hypothetical protein.
1939	23	69	Os06g0220000|mRNA|AK061401|CDS+3'UTR	TGTCTGTATGTATGTATGTGATGTGAGTACGTGACCATGTTGTGTACATAAGTTCGTGTC	Os06g0220000	AK061401	Similar to Phi-1 protein.
1940	23	70	Os03g0263500|mRNA|AK106060|CDS+3'UTR	TTGTCGATTTTAAGAAATTTTCCACCTTGATACTTTTGATACTTCTATTCAAAGCACTTG	Os03g0263500	AK106060	Similar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66).
1941	23	71	Os01g0936900|COMBINER_EST|CI136596|6	TCTGTAGTATCGTCGGCCATCCGTCTGTCCTATTTCAAATCGATGAATAAAAGTGTCCTC	Os01g0936900	CI136596	Peptidase A1, pepsin family protein.
1942	23	72	Os06g0489700|COMBINER|CI447660|x	GTAATCCTTCCTTATCTCCTCCTTATGTACAATCAATCCACGTTACGCAGTATTCCTCTC	Os06g0489700	CI447660	Conserved hypothetical protein.
1943	23	73	Os07g0106700|mRNA|AK060004|CDS+3'UTR	CAATAATCCATTTGGCCACACAATTTGTCACAATGCCCTTAATCATTGTGCTTTTCAATA	Os07g0106700	AK060004	Similar to Aminotransferase-like protein.
1944	23	74	Os04g0286300|mRNA|AK067467|CDS+3'UTR	TACCTTCAATATACTGCACGTTTTAATTTGAAGTACACTTGTAATAAGGCAAAATACTGT	Os04g0286300	AK067467	EGF-like calcium-binding domain containing protein.
1945	23	75	Os05g0408900|mRNA|AK059821|CDS+3'UTR	TACTACGAAATGCGCCAAATTTTTAACGGGTTTTAGAATGAAACCGTCTAGTTTTTACCT	Os05g0408900	AK059821	Similar to 1-D-deoxyxylulose 5-phosphate synthase.
1946	23	76	Os05g0466700|COMBINER_EST|CI479396|0	CCATATTTGGGCAAATGTTTAGTTAGAAATCAGGTTTCTGATGATGTTCAGTGGTGTGTA	Os05g0466700	CI479396	Conserved hypothetical protein.
1947	23	77	Os01g0907300|mRNA|AK103626|CDS+3'UTR	AGAGCGCTTGACAAACTCCCCGCAGACCAATGTTGGATTAGCAGTTAACACGAACTTTTA	Os01g0907300	AK103626	Conserved hypothetical protein.
1948	23	78	Os01g0953400|mRNA|AK101164|CDS+3'UTR	CTCTGTTACTGTTAGTCCAAGTCCATATCAGCAAAATGAATAACAAAGAAGCAGATGTTA	Os01g0953400	AK101164	NB-ARC domain containing protein.
1949	23	79	Os12g0288000|mRNA|AK100993|CDS+3'UTR	GTCGCTTGTTTATTGATGAGGTATATGTTGATTCTTCTATCGTCAATAGAGAAAGATAGG	Os12g0288000	AK100993	Protein of unknown function DUF6, transmembrane domain containing protein.
1950	23	80	Os03g0214600|mRNA|AB070262|CDS+3'UTR	ATTCTTTTCCTCATATATGCTGGACATGGATGGAGGAAAATCTTACTGATTTTCGTTATG	Os03g0214600	AB070262	Similar to 26S proteasome subunit-like protein (26S proteasome subunit RPN9a).
1951	23	81	Os06g0136700|mRNA|AK065081|CDS+3'UTR	AGATGAAATTACCTGATGGCACAACACTTCTATTTTGTTGCCTAATGTACTTTGCATAGG	Os06g0136700	AK065081	Steroid nuclear receptor, ligand-binding domain containing protein.
1952	23	82	Os10g0525400|mRNA|AK063207|CDS+3'UTR	AGTCTGTAATTTTGCTTGTAAGACTTCTCTCTGAGTCTTTTATTACTACTTCTCTCAGTC	Os10g0525400	AK063207	Similar to Glutathione S-transferase GSTU31 (Fragment).
1953	23	83	Os12g0129900|COMBINER|CI543163|6	GAGCTAAGCCTTGATTAGAACTGCAGCGGGAACACCACTCCACAGGCATCCTTGACGGCA	Os12g0129900	CI543163	(No Hit)
1954	23	84	DarkCorner		
1955	23	85	DarkCorner		
1956	24	1	DarkCorner		
1957	24	2	DarkCorner		
1958	24	3	Os07g0127100|COMBINER|CI544959|0	ACGTTCATGTATGTATAACATATACAGTACCATATTCGTACTTACTATAATAAGTAAGGC	Os07g0127100	CI544959	(No Hit)
1959	24	4	Os07g0236300|mRNA|AK065983|CDS+3'UTR	GCTCGCCGCGACGCCGCCGCTGAGTCACCGATGCGGGTCGCCGCCGAGCCCGCCACGCCG	Os07g0236300	AK065983	Non-protein coding transcript, putative npRNA.
1960	24	5	Os02g0647900|mRNA|AK060824|CDS+3'UTR	GGTGCTTTGGATCCTCAGCAAGGCCAATCCTAGCATTGTCTAGCAGGTTAAGTGTTTAAT	Os02g0647900	AK060824	Similar to Fatty aldehyde dehydrogenase 1.
1961	24	6	Os08g0182400|mRNA|AK059491|CDS+3'UTR	TGCCTGCTACTGTGTGAGACTGAAGTTTTCAAATACTGAGTGGTAACTTTTTAAATTCTG	Os08g0182400	AK059491	Conserved hypothetical protein.
1962	24	7	Os07g0577600|mRNA|AK104177|CDS+3'UTR	ACTATGATGTAACCGATGTAAAAAACAAGTTGATACTCTTTTAGAAGTGAAGTTCTCTTC	Os07g0577600	AK104177	Similar to Type II chlorophyll a/b binding protein from photosystem I precursor.
1963	24	8	Os12g0174200|mRNA|AK063010|CDS+3'UTR	TTAATTGTACATGAAACTGAACTGCTTGTATGATGAGTGATTGTAGCAGATTAATTGATT	Os12g0174200	AK063010	Conserved hypothetical protein.
1964	24	9	Os03g0132000|mRNA|AK105769|CDS+3'UTR	TCATCAGTCATGTGCATTTCTTCTATACATGATCTGGTAGAGTTACACTGTATCCATTCT	Os03g0132000	AK105769	Similar to 4-coumarate-CoA ligase-like protein.
1965	24	10	Os09g0556400|mRNA|AK059357|CDS+3'UTR	TGATGGAGTTCATTACGACGTGATCCTTGACCATGTATTTAGTGAATTCTTGCCAGTTCG	Os09g0556400	AK059357	Major facilitator superfamily MFS_1 protein.
1966	24	11	Os05g0514500|COMBINER_EST|Os05g0514500|8	AAGGACATGGAGGTCTACGAGCTGAAGGCGAAGCTGATTGCGATGGACGCCGAGGCGGAC	Os05g0514500		Prefoldin domain containing protein.
1967	24	12	Os07g0204500|mRNA|AK102805|CDS+3'UTR	AGCTCTTACTATTTATAACTACAGTTCCACAATAATTCTTTGGTATTATATTTTTCTGAG	Os07g0204500	AK102805	Survival protein SurE family protein.
1968	24	13	Os08g0511000|mRNA|AK107578|CDS+3'UTR	TATAGTTTCCTCTAGCATCTGTCTATGGAACTTTTTGAAGTGAAAGGAGGAGAATTTGTT	Os08g0511000	AK107578	Protein prenyltransferase domain containing protein.
1969	24	14	Os11g0701200|mRNA|AK073800|CDS+3'UTR	ACAAGGATGTGGTTTTGTCAATGATGTGCTTCTATGCTCATAAATAAATACACGGACTTA	Os11g0701200	AK073800	Glycoside hydrolase, family 18 protein.
1970	24	15	Os07g0557500|mRNA|AK067121|CDS+3'UTR	GTACATAGGCCTAGGTCTTTGTTTACCCCTCCTTAGTTAAAATCTGGTTGGAGCTTGCAT	Os07g0557500	AK067121	Zinc finger, RING-type domain containing protein.
1971	24	16	Os01g0773700|mRNA|AK060438|CDS+3'UTR	ACTTTCTCCATGGGGGATTGTGCACGCATCTGGCAACTTAACAAGATAAATTTGCAGAAC	Os01g0773700	AK060438	Similar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment).
1972	24	17	Os09g0416600|mRNA|AK101668|CDS+3'UTR	TCTATCTTCTTCGGATTGTTGTAAGTTGCAATTGTTATCCGAGCAATGTTCTTGTGCAGT	Os09g0416600	AK101668	Protein of unknown function DUF868, plant family protein.
1973	24	18	Os03g0858400|mRNA|AK058362|UTR	TAGAGTGGAACTTGGAAGTAACTTATCGAGTTCTCTTGCATTCAGTATGCATATGTTAGT	Os03g0858400	AK058362	WD40-like domain containing protein.
1974	24	19	Os04g0599800|mRNA|AK103675|CDS+3'UTR	TGTGTAGTAACTTGTAATTTGATTGATTTTACTCTCGAGCCAATTGAGATGTCTGGTAAC	Os04g0599800	AK103675	WD40-like domain containing protein.
1975	24	20	Os01g0686100|mRNA|AK064922|CDS+3'UTR	TGGTTGCCGATTGCCGTGTGGATTTCGAAGCTTGACAATTGCTTATTTCTTTAGAGTGAA	Os01g0686100	AK064922	Conserved hypothetical protein.
1976	24	21	Os01g0690800|mRNA|AK073248|CDS+3'UTR	TAAGAAGAGATTTGGAATGTGAAACCAAATTCACTACAATGTCGACCCTCTTTTGCCCAG	Os01g0690800	AK073248	Protein kinase-like domain containing protein.
1977	24	22	Os07g0617700|COMBINER_EST|CI137713|6	TGTGTGCATGATTTTGTTGGGTGATTTGAGGATTATTTTCATGGGAATCAAAGCCACCCG	Os07g0617700	CI137713	Cyclin-like F-box domain containing protein.
1978	24	23	Os10g0336400|COMBINER|CI540319|6	TGACTCCTCTCTGTGATCGACCTGGAAATACCAAAAAGTCTAGTTTAGCATGAAACTTAA	Os10g0336400	CI540319	(No Hit)
1979	24	24	Os07g0220200|COMBINER|CI179797|6	TATGTCCAGTTACTCACATTGCTCCAAGCTGCTCATAAATGCCAATGTAACAAATAATGC	Os07g0220200	CI179797	(No Hit)
1980	24	25	Os01g0827200|mRNA|AK073922|CDS+3'UTR	GAAACTAGATTAGCTGGAATTTTCTGGTTCCTGAGAGAACCACATACATGAAGATTTCTT	Os01g0827200	AK073922	Phox-like domain containing protein.
1981	24	26	Os10g0185100|mRNA|AK065091|CDS+3'UTR	TTGCATTTTCAGACTTGTGGAGTGTGAAATGCATATGACATTGCAATCATTTGTGGAATG	Os10g0185100	AK065091	Hypothetical protein.
1982	24	27	Os06g0722200|COMBINER|CI556732|x	TATGAACTACCTCTGCAGTTAGAAATGTGTTAGATCTTGTCTCTGCAAAGATGAACACCT	Os06g0722200	CI556732	Hypothetical protein.
1983	24	28	Os11g0264700|mRNA|AK110777|CDS+3'UTR	CCCTGTTCTTCTCCCATAAAAGCATTTTGAAATCTAAAAGTTTGGCTGGTACTGAGTGCA	Os11g0264700	AK110777	Cyclin-like F-box domain containing protein.
1984	24	29	Os02g0656500|mRNA|AK062239|CDS+3'UTR	GCCTCACTACAATTATTACAGCCTGCCGTATTATATACCAAAATGAGCTAATCCTCGACA	Os02g0656500	AK062239	DnaJ-like protein.
1985	24	30	Os05g0495900|mRNA|AB027432|CDS+3'UTR	GTTTCGGTTCGATCTCATGTCACCGGTGCTCTGATTTGGATTCATTGTTCATTTGTTGTC	Os05g0495900	AB027432	Similar to Beta-1,3-glucanase precursor (Fragment).
1986	24	31	Os02g0787600|mRNA|AK071978|CDS+3'UTR	CTTGACCGATGAAGCATTGGCAGTGGCTTTGTAAAGTGTAATATGGCAACAATAATATGT	Os02g0787600	AK071978	Ionotropic glutamate receptor family protein.
1987	24	32	Os07g0108300|mRNA|AK067732|CDS+3'UTR	AACTATTTCTATGTTTTGATACTGTGAACAAGTTGCTTGGCAAGTCACTTGTGCTGGCTG	Os07g0108300	AK067732	Similar to Alanine aminotransferase.
1988	24	33	Os05g0185800|mRNA|AK065050|CDS+3'UTR	TTGGCTTGTACTTATTCAGTGTATTGTTCATGTATTGCTCTATGCATACTTCACTCCAGC	Os05g0185800	AK065050	Conserved hypothetical protein.
1989	24	34	Os04g0475600|mRNA|AK105400|CDS+3'UTR	TGGAAGGTGGAGTTTGTGAGTAAATTCCCACCTTTTTAATATAGAGGACTATAATTGGGA	Os04g0475600	AK105400	2OG-Fe(II) oxygenase domain containing protein.
1990	24	35	Os07g0124400|mRNA|AK111259|UTR	CTGCACAAACTCGCCCATTAGTAAAAACATTTGTATTGACGGCTTGCAATGTTAAATCTC	Os07g0124400	AK111259	Non-protein coding transcript, unclassifiable transcript.
1991	24	36	Os09g0426800|mRNA|AK060786|CDS+3'UTR	AGTATATATACTTTGATTTGGCGTTGGATACATAAAGAGATGAGCTGTATGAACGTGTAG	Os09g0426800	AK060786	Similar to Glossy1 protein.
1992	24	37	osa-miR169m|Os08|3'seq	GCTGCTTGCAGGCTCATGCATATATATGTACAGGCAGTCTCCTTGGCTAGCCCGGCTACC			miRNA
1993	24	38	Os11g0152900|mRNA|AK109321|CDS+3'UTR	AATTTTCTGAGAAGATTTAGACGAAAGATGAGAGCTTAGCTCAAAGTGTCCAAGAGTGAG	Os11g0152900	AK109321	Conserved hypothetical protein.
1994	24	39	Os02g0208900|mRNA|AJ575233|CDS	TTTGGGTTCCCTCAACATGGGCTTTGATCAACAAGCTGCTCCCAGGTACCCCCAGCCAAG	Os02g0208900	AJ575233	Similar to ZIGA2 protein (Fragment).
1995	24	40	Os06g0633100|mRNA|AK107791|CDS+3'UTR	TTGCAACTGACAAAAGGCAAAGCTTTGTGCTTCCAATAAATGCATCAAGGCTTTTCTTCC	Os06g0633100	AK107791	Conserved hypothetical protein.
1996	24	41	Os12g0121300|mRNA|AK099644|CDS+3'UTR	TTAGATGGCATTGTAATCTTTACTTAAAGGGCCAGTATGGCGCATGGAATAAACAAGCAA	Os12g0121300	AK099644	Similar to Phosphoethanolamine cytidylyltransferase.
1997	24	42	Os11g0598500area|Combiner_EST|BI118703 |3'UTR	AGCTCACAGGCTGATCTATTCTCAAAAGTGATATTAGTCAAGTTAAAGCCCTCAATAAGA		BI118703	(No Hit)
1998	24	43	osa-miR162a|Os02|5'seq	GATGCCTGGGCGCAGTGGTTTATCGATCCCTTCCCTGCCTTGTGGCGCTGATCCAGGAGC			miRNA
1999	24	44	Os08g0453200|mRNA|AK058233|UTR	AAACAAAATAACCAATCGAGCAGAGGAATATCTATGACAAAGGAAGCTAGCTAGCTGACG	Os08g0453200	AK058233	Dormancyauxin associated family protein.
2000	24	45	POsControl0026|random		
2001	24	46	Os02g0801200|COMBINER|CI028837|3	CTGCAGTGAGTATGTATTATGTACTACTTATTATATAGTAATAAAATTTGAAAAAGTAAT	Os02g0801200	CI028837	(No Hit)
2002	24	47	Os02g0591200|COMBINER|CI246067|6	AGGATGTTCGGTTTTATGGTTTAGAGGGGTAATTCGGACGACCATAATAGTTCGAGGGGT	Os02g0591200	CI246067	(No Hit)
2003	24	48	Os09g0130800|mRNA|AK066693|CDS+3'UTR	TGTGAATGTTTGTAATTTGTATATTCCGCTACAGAGATGTACAGCAGCTTGAAATCCCAC	Os09g0130800	AK066693	DEAD/DEAH box helicase, N-terminal domain containing protein.
2004	24	49	Os07g0156900|COMBINER|CI336654|6	GCGCCATCAACCACAGCAAGAGGCTAATTCGGCCACTTATGCAGGGGGTTACGTACATGC	Os07g0156900	CI336654	(No Hit)
2005	24	50	POsControl0041|art		
2006	24	51	Os07g0413800|mRNA|AK061478|CDS+3'UTR	CACACCTCAAGAATGATAAGTTCTATATATTGTTGATCATATGGTTAAATATTACTTTGA	Os07g0413800	AK061478	Conserved hypothetical protein.
2007	24	52	Os04g0482800|mRNA|AK068497|CDS+3'UTR	TGGAATTTTTGTAATTAGCTGGCGATGGGCTTCCAGCTTCTGAAGCTCCGTCATTGTGAA	Os04g0482800	AK068497	Similar to Topoisomerase-like protein.
2008	24	53	Os02g0702700|COMBINER|CI542921|6	AATAGTGCCAAGTCAAACTGTTTTAATTTTGACTATTAATAGCGATAAATTAAGAAAGAT	Os02g0702700	CI542921	Conserved hypothetical protein.
2009	24	54	Os02g0317200|COMBINER_EST|CI142165|6	GCGCAATACGTTTGAGTACCATGAATCCTTGTTGCTATTTTTTCCATTGCTATGATGCCT	Os02g0317200	CI142165	Cyclin-like F-box domain containing protein.
2010	24	55	Os11g0176300|COMBINER_EST|Os11g0176300|8	GACAACAATTGGATTAGAAACCATTTTTATCTCCATGCGACTTCCTTCAACTCAGACACC	Os11g0176300		Protein of unknown function DUF246, plant family protein.
2011	24	56	Os02g0679500|mRNA|AK067772|CDS+3'UTR	ACTATTCATTTCTGACCAATCAACTTGTACGATGCCATCATTACTTTCGGTTGTTAGTTA	Os02g0679500	AK067772	Similar to Rac GTPase activating protein 1.
2012	24	57	Os03g0444600|COMBINER|CI225423|6	CCGTTGCTGTTTATTTTTGATTGTCAGGCGCTGAAGTGCCTTTGTAATAATGTAAATATT	Os03g0444600	CI225423	(No Hit)
2013	24	58	Os06g0582300|COMBINER_EST|AU161121|7	TGTTGTAGATTATTTTAGATTTGGGGATAATTTTGTGAATTACTTGTGGATTGCGGATGA	Os06g0582300	AU161121	Hypothetical protein.
2014	24	59	Os05g0459300|mRNA|AK062312|CDS+3'UTR	GAAGGGAGTTGTATAGATCTACTGAGCAAAATCTTTCGAAGATGATAGGTTTTTTGTTTC	Os05g0459300	AK062312	Conserved hypothetical protein.
2015	24	60	Os07g0101200|mRNA|AK073590|CDS+3'UTR	AGGTCTGTGGCTATTCTTTGTACTTCATATTCTAAGGACACTAGGCTAGAGTCTTCTCTA	Os07g0101200	AK073590	Protein prenyltransferase domain containing protein.
2016	24	61	Os08g0201700|COMBINER_EST|Os08g0201700|8	ATCAGGAGTGAGAATGATGGCTTCATAGCAGGCTACTTCTCAGGATCATCGATACAGCAA	Os08g0201700		Protein kinase-like domain containing protein.
2017	24	62	Os07g0523600|mRNA|AK059906|CDS+3'UTR	ACTATGACTATGATGATGTAGAGAGGTGGATCTGCCTAAATAAAGCTGTTAGATTTTTTG	Os07g0523600	AK059906	Similar to Glucose-6-phosphate/phosphate-translocator precursor.
2018	24	63	Os01g0205500|mRNA|AK067763|CDS+3'UTR	GCTCAGATCTATTTACTCTCTTAGCAGAGATAGATATATGATTTGACATATGCTACGAAC	Os01g0205500	AK067763	Similar to 60S ribosomal protein L11-2 (L16). Splice isoform 2.
2019	24	64	Os05g0527800|mRNA|AK060997|CDS+3'UTR	GCTATTCCAAGAAAAACGTACTACCTCCGTTTTTTAATAGATGACACCGTTGACTTTTTC	Os05g0527800	AK060997	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
2020	24	65	Os02g0161900|mRNA|AK061956|CDS+3'UTR	TTATGAAACAGTTTCCTGTGGGACAGCAGTATGCTTTATGAATAAGTTGGATTTGAACCT	Os02g0161900	AK061956	Polyubiquitin.
2021	24	66	Os03g0161200|mRNA|AK066932|CDS+3'UTR	TGCATTGGAGCTACTTCTTTGAAGTATTGACTCAAGATCATACCTTTTTTCCAAATATCC	Os03g0161200	AK066932	Similar to Sulfate transporter 3.1 (AST12) (AtST1).
2022	24	67	Os01g0655400|mRNA|AK068171|CDS+3'UTR	TCCCCAGAAAGTACACATTGAAACTCCTTTCATTTCATTTTTAATTCCTTTCTCATTTTC	Os01g0655400	AK068171	Conserved hypothetical protein.
2023	24	68	Os10g0195600|mRNA|AK100207|CDS+3'UTR	CACCCCTCCCTTTAATGTATGCGCACATACTTTTAACTTGTAAAGTTACCTCGCTCATTA	Os10g0195600	AK100207	Transferase family protein.
2024	24	69	(+)E1A_r60_1		
2025	24	70	Os03g0856700|mRNA|AK099111|CDS+3'UTR	TATTATCCATCCATCCATCCATCTTACACTACTATACCATTAGCATCGATCGATCATCCA	Os03g0856700	AK099111	Gibberellin 20 oxidase 1 (EC 1.14.11.-) (Gibberellin C-20 oxidase 1) (GA 20-oxidase 1) (Os20ox).
2026	24	71	Os07g0680000|mRNA|AK072667|CDS+3'UTR	TTCAGCGAGATACTCCTATATGTTAAAAGCTTGTAAATACTGTTGTTCAGACAATAGTCC	Os07g0680000	AK072667	Similar to Vacuolar sorting receptor 1 precursor (AtVSR1) (Epidermal growth factor receptor-like protein 1) (AtELP1) (AtELP) (BP80-like protein b) (AtBP80b) (Spot 3 protein).
2027	24	72	Os11g0235400|COMBINER_EST|AU101285|7	AGATTGGCTATGCAATATGTCGATTTCAACAGATCTAGGGAACTTCACAAATTAGTGTCG	Os11g0235400	AU101285	Conserved hypothetical protein.
2028	24	73	Os02g0716500|mRNA|AK061506|CDS+3'UTR	AACGCTTGTGGTGTTCATGGCGGAATAACTAAACGTCGAATGGAATGACAACTTTTTTGC	Os02g0716500	AK061506	Similar to Delta-12 fatty acid desaturase (Fragment).
2029	24	74	Os03g0215400|mRNA|AK070981|CDS+3'UTR	CCGTTTTGGATGTGGTAACAAGTTAATTGGCACTTAAATTTATATTTGTGATGATCTGGG	Os03g0215400	AK070981	Box protein (MADS box protein MADS1).
2030	24	75	Os01g0730300|mRNA|AK109542|5'UTR+CDS	AGAGTGTGTCGTTGTAACTGCAGTGAGGGATGGGATGAACCTCACACCATATGAGTATAT	Os01g0730300	AK109542	HAD-superfamily hydrolase subfamily IIB protein.
2031	24	76	Os01g0117900|mRNA|AK099425|CDS+3'UTR	CCTCACTCACCAGTGATATACTATATATAATTGCTACGAATCAGTCTGTGTATATCTCAA	Os01g0117900	AK099425	Similar to Nodulin-like protein 5NG4.
2032	24	77	Os09g0112400|mRNA|AK109186|CDS+3'UTR	CTACTGAAGCCTGTAGGCACACGTTATATGGTCATCTTCCTTGATAATTTCAGCTTGATT	Os09g0112400	AK109186	Similar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein).
2033	24	78	Os05g0353400|mRNA|Y15226|CDS+3'UTR	CGTGGGTGGATTCTGGCATTGAATGTCTTGAACAGCTAAACCTGTTAATGTTAATGTATT	Os05g0353400	Y15226	Armadillo-like helical domain containing protein.
2034	24	79	Os07g0652800|COMBINER_EST|Os07g0652800|8	ATCAGCTAGTAGAGTTCATGCCCTTAATGAGGAGAATGGTGCATCATCTTCAGCACCCAA	Os07g0652800		Conserved hypothetical protein.
2035	24	80	Os03g0703400|mRNA|AK100023|CDS+3'UTR	GAGCTTAAGCCATTGTAAATTTTTGACTTCATCATTATTTTGGTTTGTTGCTCCTGAAGC	Os03g0703400	AK100023	Similar to MAP3K beta 3 protein kinase (EC 2.7.1.37) (Fragment).
2036	24	81	Os11g0194800|mRNA|AK108801|CDS+3'UTR	ATGTGTATTGACAGCTTGAAAGCCAACTTTATTCTGAATGTCATCTCGTCATTTCACGGC	Os11g0194800	AK108801	Similar to DNA-directed RNA polymerase II 7.6 kDa polypeptide (EC 2.7.7.6) (RPB10) (RPB7.6).
2037	24	82	Os04g0681500|mRNA|AK105582|CDS+3'UTR	AATTATGACAAACAATATGAACGTGTACATATGGGTAACTACACGCGTAAGTAATCTGAC	Os04g0681500	AK105582	EF-Hand type domain containing protein.
2038	24	83	DarkCorner		
2039	24	84	DarkCorner		
2040	24	85	DarkCorner		
2041	25	1	DarkCorner		
2042	25	2	DarkCorner		
2043	25	3	Os05g0267100|mRNA|AK062790|CDS+3'UTR	GTATGAGGGTAGGAGAGCATATATAGCTGACTACCTTGATGCCAAAGGAAGATCTATACT	Os05g0267100	AK062790	Cellular retinaldehyde-binding/triple function, C-terminal domain containing protein.
2044	25	4	Os01g0788400|mRNA|AK109763|CDS+3'UTR	AGGAAATAAAAGCAATAAAGCATGCTAATGGCGCAGATCAGATCAATCTGATCGGAGGTG	Os01g0788400	AK109763	Similar to Pectinesterase (EC 3.1.1.11) (Fragment).
2045	25	5	Os03g0391700|mRNA|AK065674|CDS+3'UTR	CATATATGCTACTGTATACTGTACTCCTATGTATGAATACTGCATGTGTTTGTGTTTGTG	Os03g0391700	AK065674	Helix-loop-helix DNA-binding domain containing protein.
2046	25	6	Os05g0100600|mRNA|AK100999|5'UTR+CDS	TCAAGTGGACACGATCCTTACGGATAAAACTGGGACTCTGACTTGCAATTCCATGGAGTT	Os05g0100600	AK100999	Similar to Potential phospholipid-transporting ATPase 7 (EC 3.6.3.1) (Aminophospholipid flippase 7).
2047	25	7	Os07g0510800|mRNA|AK063640|CDS+3'UTR	GAAGATGATAAGGATCTGCCCTGATGGCATGATCAATGCCTTCCAGTTAATTTCTTGCGT	Os07g0510800	AK063640	RNA-directed DNA polymerase (Reverse transcriptase) domain containing protein.
2048	25	8	Os04g0652700|mRNA|AK059436|CDS+3'UTR	CTACAGAACATTGTAATTCCTGTAAGCAAGTGGTGATTTATCAATATTGCACTGTCTTTT	Os04g0652700	AK059436	Similar to Nuclease I.
2049	25	9	Os10g0491100|COMBINER|CI468859|3	CCAGCACCGTGACTCAGTTCGACTGGTTCATATGCTTTAACACATAAGCTACGTGGTAAA	Os10g0491100	CI468859	Non-protein coding transcript, uncharacterized transcript.
2050	25	10	Os03g0300900|mRNA|AK119594|CDS+3'UTR	ACTCTACAGGTTTGGAAGGCTTGCAGCCTCAGCATCATCATAAATAAAAAGCACAGAAAA	Os03g0300900	AK119594	Glycosyl transferase, family 8 protein.
2051	25	11	Os05g0584600|mRNA|AK107350|5'UTR+CDS	CTTGCAACAATGACCGAAGGATACAGTGGAAGCGACCTTAAGAATCTTTGTGTGACAGCT	Os05g0584600	AK107350	AAA ATPase domain containing protein.
2052	25	12	Os02g0667000|mRNA|AK058849|CDS+3'UTR	AGAACAGGACTGAAGGTTTTTCCAGTTTTGAGCTAATTGGTTTTCAATTGTACTATCCTT	Os02g0667000	AK058849	Complex 1 LYR protein family protein.
2053	25	13	Os02g0580100|mRNA|AK072442|CDS+3'UTR	TTGACTTAGGTCTTTTGTAACTGACTGAGCCTGCTGCCAGCCTCGTGAATGGAAACATTT	Os02g0580100	AK072442	Protein of unknown function DUF580 family protein.
2054	25	14	Os08g0377400|mRNA|AK105467|CDS+3'UTR	GAATCTCATATTCTCATGTAATGTTACTCCATACAAACCTCCAAGCTTTGCAGCAAACAT	Os08g0377400	AK105467	Exonuclease domain containing protein.
2055	25	15	Os03g0251700|COMBINER_EST|Os03g0251700|8	ATCGCCAAGTCGCCGTCCATCAAGTGAGGAGGTGCTTGAAATGCTCTCTGGTGAGGGTGA	Os03g0251700		Protein kinase-like domain containing protein.
2056	25	16	Os03g0849800|mRNA|AK069826|5'UTR+CDS	AAGGACTACCTCGAGATGATGTGGGGTCGCAACAAGTTTCAGCAGACCATCCTTGAGCTC	Os03g0849800	AK069826	Conserved hypothetical protein.
2057	25	17	Os01g0803800|mRNA|AK064306|CDS+3'UTR	TTGCTCCCGCTTAACCCGAGAAATAAAAGAAATTGGTGTGCTTGTTTTCTCCGAGTGGCG	Os01g0803800	AK064306	Cytochrome P450 family protein.
2058	25	18	Os02g0802500|mRNA|AK064361|CDS+3'UTR	TGATGTACGGCTTGTATAAAGTGACCAGATGGTTTTCATCTGCAGTTTATGTGCATATTT	Os02g0802500	AK064361	Similar to H(+)-translocating (Pyrophosphate-ENERGIZED) inorganic pyrophosphatase beta-1 polypeptide (EC 3.6.1.1) (Fragment).
2059	25	19	Os12g0106000|mRNA|AY324879|CDS+3'UTR	TAAGTCGAGTCTGTGTATTCATCAAATTAAGCACGCAGTAGCAATGGAGTGAATGAACCA	Os12g0106000	AY324879	Similar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1).
2060	25	20	(+)E1A_r60_a135		
2061	25	21	Os04g0298200|COMBINER_EST|AU101195|6	TTGCCATGTAAGAATGATAAGCTTATAACTTGTTGCAGAGAAAGGGAGTAGTTGAGCGCG	Os04g0298200	AU101195	Cation efflux protein family protein.
2062	25	22	Os12g0500500|mRNA|AK101058|CDS+3'UTR	CTTGTGGATTATTTGTGATGACTTAGTAAAGTAGGCTATGTAATACTGTTCACTGCAGAT	Os12g0500500	AK101058	Disease resistance protein family protein.
2063	25	23	osa-miR441a|Os03|3'seq	TTACCATCAATATAAATGTGGGAAATGCTAAAATGACTTACATTGTGAAACGGAGGGAGT			miRNA
2064	25	24	Os01g0326100|mRNA|AK062793|UTR	ATGACCAGTTTCGGTTGAGCTCCAGTAGCTGCTCACTTCTCAAGGAAAAATGAGTGTACA	Os01g0326100	AK062793	Similar to Peroxidase component PR-2 and/or 4 (Fragment).
2065	25	25	Os10g0116100|COMBINER|CI139190|6	GGCACGTTAGGGCGCAGGGTAGGAGGGACAGGGGTAAGAGGCCTCGTCAGTAGTGTTCTA	Os10g0116100	CI139190	(No Hit)
2066	25	26	Os12g0269100|COMBINER|CI483959|x	GGCGATACAAATCTGAATGAAAATGTCATGCAAGTTTAAACATAATGCCTCTGTAAGGAT	Os12g0269100	CI483959	(No Hit)
2067	25	27	Os06g0302600|COMBINER|CI315240|6	AACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCAT	Os06g0302600	CI315240	(No Hit)
2068	25	28	POsControl0011|genome		
2069	25	29	Os03g0307400|mRNA|AK110558|CDS+3'UTR	TGTCAACAGGTATTTTGATTGGTGACTTGTATAACAGTCCAAGTTGATTCCATTTGCCAG	Os03g0307400	AK110558	Soluble quinoprotein glucose dehydrogenase domain containing protein.
2070	25	30	Os04g0401700|mRNA|AK119891|CDS+3'UTR	GTGTAAACGGCGTGTGCCAACTTGAGTAGAAGGTTTCTCACTGGTGGTGTGTTGTCCATG	Os04g0401700	AK119891	Potassium transporter 1 (OsHAK1). Splice isoform 2.
2071	25	31	Os04g0486600|mRNA|AK064960|CDS+3'UTR	CATCTCCGGCACTTTATAAATCGTGGTTTTTGAATTTGAAAGTTCAAGTGGCATTAGACG	Os04g0486600	AK064960	Similar to Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 3 (EC 1.2.1.12).
2072	25	32	Os01g0964000|mRNA|AK073599|CDS+3'UTR	TACTGTGTCAAAGCTATAATTAGTGATGAAATTGTGTACTGTCATCTTGACCCCCAACTT	Os01g0964000	AK073599	Similar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1).
2073	25	33	Os07g0460800|COMBINER|CI547924|6	AACTTCGAGATGATCTTGTGGAACATTTGTGGGCGCTTCATGGTGCTCGGTAGTTTGTTT	Os07g0460800	CI547924	(No Hit)
2074	25	34	Os09g0417600|mRNA|AY323479|CDS+3'UTR	AATTCTTCTTACAGGAAAAAACATAGAGGCGCATTTCAATAGAGATTAGAGCTTAATCTC	Os09g0417600	AY323479	WRKY transcription factor 76.
2075	25	35	Os03g0204700|COMBINER|CI212549|6	TTCTCGCCTGCATCGGCATCGCCAACCTCGTCTTCTACGTGGTCGTCGCTAACAGATACT	Os03g0204700	CI212549	(No Hit)
2076	25	36	Os07g0100300|mRNA|AK061192|CDS+3'UTR	GATTGTAAACACCCTCTAGTGGATGTTTGAATGGGAGGAACTTTGTAATTGTTAAATTCT	Os07g0100300	AK061192	Conserved hypothetical protein.
2077	25	37	Os03g0395100|COMBINER_EST|CI518943|0	TGAGGCTCATAGCTAACATACTTATTGTATTCATACCACAATGTTATAGCTGTATCACTG	Os03g0395100	CI518943	Hypothetical protein.
2078	25	38	Os02g0741100|mRNA|AK068712|CDS+3'UTR	ATCTTACTGGCGCTGTATCCGTTCACCCGGAACCAAGATGGTTAATGATGTGTGTATACA	Os02g0741100	AK068712	Similar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16).
2079	25	39	Os04g0434400|mRNA|AK063725|CDS+3'UTR	GACGTCCGTTGTTGGCTTGTTTTAGCTGGGATGAATGTAACTGGAAACCCCTAATCTGTT	Os04g0434400	AK063725	Conserved hypothetical protein.
2080	25	40	Os09g0379600|COMBINER|CI279311|6	TTTTTTACGATTTTTAGGGTGTAATCGAATGCAATATGGAAGGAAGATCACAATGTTTAT	Os09g0379600	CI279311	Homeodomain-like containing protein.
2081	25	41	Os07g0562700|mRNA|AF022738|CDS+3'UTR	GGGGTTTGCAACTTATGTGTCAGCTGCTGCTTTAAGCTTAGTTAACTCTTTTGATGTTTT	Os07g0562700	AF022738	Similar to Type III chlorophyll a/b-binding protein (Fragment).
2082	25	42	Os03g0329200|mRNA|AK102918|CDS+3'UTR	TTCCCCATGCCCAGGCTGTCCGAGCACGGGGCGATCGGGATGTAAAGTAGTCCACAATGG	Os03g0329200	AK102918	Zinc finger, CCCH-type domain containing protein.
2083	25	43	Os10g0564500|mRNA|AK059800|CDS+3'UTR	TGATCATTTGGCAAGGACTATTCAGTTTGCATGGTCATTTTCCCAGTTTATTCATTGAAT	Os10g0564500	AK059800	Serine/threonine-protein kinase SAPK3 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 3) (Protein kinase REK).
2084	25	44	Os01g0142900|COMBINER|CI124749|6	ACTTGTAAAGCAGTACTACTTTTGCTATTACTACTGCCAGTACTACTTGTGTTTGTCTCG	Os01g0142900	CI124749	(No Hit)
2085	25	45	Os07g0474600|mRNA|AK111684|CDS+3'UTR	ATTGATATATATATTTGTATAATATTCCATTTTCAATAGAAAAAACTATAGAGGTAAACT	Os07g0474600	AK111684	Similar to Mycolic acid methyl transferase-like protein.
2086	25	46	Os02g0686400|mRNA|AK119608|CDS+3'UTR	CATACTCGTATGCCTATATTTCCAAAAGATAAGGGATTATGGAAGGATGACATATTCAAG	Os02g0686400	AK119608	Similar to Aspartyl-tRNA synthetase (EC 6.1.1.12) (Aspartate--tRNA ligase) (AspRS).
2087	25	47	Os04g0577600|mRNA|AK107440|CDS+3'UTR	TGTAACTGTAGCATATGTACCGTGTACCCATCCGTTCGTGACGTGACATGCAACACCGTT	Os04g0577600	AK107440	Conserved hypothetical protein.
2088	25	48	Os04g0628100|mRNA|D12776|CDS+3'UTR	CTATTATCCATACTAGTACAATTTGCTTCACTGTGCATCGGTACCAATCGATGATATTAT	Os04g0628100	D12776	Similar to Polyubiquitin.
2089	25	49	Os12g0564400|mRNA|AK104548|CDS+3'UTR	GTACCTTATGTGTAAGATTATATATAGTACCTCTGTAAGATGCTCTGGTGAGGAGCAAAA	Os12g0564400	AK104548	Similar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor.
2090	25	50	Os04g0166200|COMBINER|CI262947|6	TAAGTTCATTTGAGGTCCCTTTTTATGCCAATGGTTTGGAACACGTGACGCCTACGTCTT	Os04g0166200	CI262947	(No Hit)
2091	25	51	Os06g0663400|mRNA|AK121201|CDS+3'UTR	AAATCTAAAATGTATCTGCCGGTTCCACTCCGGTTTTTGATTATCCAGGTAAATTATGCA	Os06g0663400	AK121201	Serine/thronine protein kinase-like protein.
2092	25	52	Os04g0462500|mRNA|AK071822|CDS+3'UTR	ACTGCTTGGTGGCACTTCCTGTTTTTCTGTTTGCCTTTTTATTGGTGTTTATTGTTATGG	Os04g0462500	AK071822	Similar to 14-3-3-like protein GF14-6.
2093	25	53	Os02g0765600|mRNA|AK101744|CDS+3'UTR	CATTTGTATGGTTTTACGAATAATGCTATGCAATAAAATTTGCACTGCTTAATGCTTATG	Os02g0765600	AK101744	Alpha-amylase precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase) (Isozyme 1B).
2094	25	54	Os02g0132100|COMBINER_EST|Os02g0132100|8	GACAGGATGGGGTCAAAGAGGCAACGTTTATGAGAATAAGCAGCAGCAGAATGATGACAT	Os02g0132100		Protein prenyltransferase domain containing protein.
2095	25	55	Os10g0564100|mRNA|AK069258|CDS+3'UTR	TTTTTGGTCACTGGAAGATCACTGAAAACGCCAGAGAATCCACAGTAAAAGCCTGTTTCA	Os10g0564100	AK069258	SOH1 family protein.
2096	25	56	Os03g0213600|mRNA|AK100407|CDS+3'UTR	CTTGCGAGGTGTAGCTAACGAGTAACCTGGTACCACCAAATATCAACGAAACCATTTGCT	Os03g0213600	AK100407	Conserved hypothetical protein.
2097	25	57	Os10g0160000|mRNA|AK111889|CDS+3'UTR	CATCTACTCATGTTCTTATTTTACTGGAATCATATCTGCTACATACTATAGGTCTTGACG	Os10g0160000	AK111889	Similar to Ubiquitin carboxyl-terminal hydrolase 12 (EC 3.1.2.15) (Ubiquitin thiolesterase 12) (Ubiquitin-specific processing protease 12) (Deubiquitinating enzyme 12).
2098	25	58	Os07g0174400|COMBINER|CI419275|0	TCCTATGGCCCGTTTGAATTAGACAAAGAAATGGATAATAGTTGATGGATGATATATTGC	Os07g0174400	CI419275	Plant lipid transfer protein/Par allergen family protein.
2099	25	59	Os05g0224300|COMBINER|CI121911|6	TTTGGCCCAACTACCAATGTAATAAACTTGCACTTCATCATATCTTTTCTGGGAATATAG	Os05g0224300	CI121911	(No Hit)
2100	25	60	Os09g0392800|mRNA|AK106872|5'UTR+CDS	CAACGCCATTAGACAAGCACAACGTCGGGAAGGGAAAAAACTGATGGAGAAAGCAAAGTT	Os09g0392800	AK106872	Non-protein coding transcript, unclassifiable transcript.
2101	25	61	Os06g0666800|mRNA|AK107710|CDS+3'UTR	GTGCTGATTTCTTGGAAATCCATGCACATTATTCCTGATATAAATCGTCCCATTAATTCC	Os06g0666800	AK107710	Conserved hypothetical protein.
2102	25	62	Os01g0105900|mRNA|AK066907|CDS+3'UTR	CCTGCACTGCACTACAAGTCTCGCTGATTATTCAATTTGCTCGAGAAAACTCATATATAT	Os01g0105900	AK066907	PfkB domain containing protein.
2103	25	63	Os05g0105600|mRNA|AK069692|CDS+3'UTR	AACTGGCAAGAACAAAGCACAAGTCTGTAGGCAATAATGCCATATTATCTGCGTGAACAA	Os05g0105600	AK069692	YT521-B-like protein family protein.
2104	25	64	Os06g0689600|COMBINER_EST|Os06g0689600|8	GAAATTCGGAATTGCTTATTGGAAGGATATGGGATACGTCGTTGCGACTTGCGAGTCGAA	Os06g0689600		Similar to S-receptor kinase-like protein 1.
2105	25	65	Os12g0626100|mRNA|AK059924|CDS+3'UTR	AGTCTACCTTGAATTGATATGTTCGTCAAAAGGATTTACTGATCAATCTCTGGGCTCTCA	Os12g0626100	AK059924	Armadillo-like helical domain containing protein.
2106	25	66	POsControl0005|genome		
2107	25	67	Os09g0332300|COMBINER_EST|Os09g0332300|8	ACTAGCAAAAGAACAAAAGCAAGATTAGCAACTCCCTCATGCGAAGAACATCGACCATGA	Os09g0332300		ABC transporter domain containing protein.
2108	25	68	Os01g0261500|mRNA|AK101899|CDS+3'UTR	CTATCAGCCTTTGTATTTCGTTTAGGTGGAATATATGGGCCAGGAAGAAGGTTTCAGTCT	Os01g0261500	AK101899	Conserved hypothetical protein.
2109	25	69	Os09g0546100|COMBINER_EST|CI408770|0	GAAAGAGGAAAATTGCCATGTAAGCCTGTCAATATTGCAAGCAATCAAAGAAAACGTCCA	Os09g0546100	CI408770	Auxin responsive SAUR protein family protein.
2110	25	70	Os10g0397200|mRNA|AK064927|CDS+3'UTR	TCCGGGAGCATAATCTGAGACGGTCAGCTTTGTAAAACATAAATCAATTCAAGAGCTTGA	Os10g0397200	AK064927	Winged helix repressor DNA-binding domain containing protein.
2111	25	71	Os09g0405900|COMBINER|CI343198|0	GCCCCAGCTGACAAGTTTAAGTTGATGGATGAATCCTTCAAAGTGGCTGTTATGCAGGTA	Os09g0405900	CI343198	(No Hit)
2112	25	72	Os07g0202000|COMBINER_EST|Os07g0202000|8	CAGGATCGCTACGTCGACGAGCTTGCCGAGCGGCTGCGTCGTCGCCGGAGTTTGAGCTGA	Os07g0202000		UDP-glucuronosyl/UDP-glucosyltransferase family protein.
2113	25	73	Os01g0185300|mRNA|AK065131|CDS+3'UTR	TAGACAGTTTAATATTTGTACCATTTGATATGGGAATAAAAGAAAAGATATACTCTCCAT	Os01g0185300	AK065131	Transferase family protein.
2114	25	74	Os08g0540300|mRNA|AK101429|CDS+3'UTR	TGTACTGACCAACCTGTGAAGCTGGAGAATGGTAGATGTAGCTCTTATCTATTGAGCGGT	Os08g0540300	AK101429	Zinc finger, RING-type domain containing protein.
2115	25	75	Os06g0238900|mRNA|AK106064|CDS+3'UTR	CTGTACAATATTGTAATGTTGTGATTTCAGATAGCACTTTCGGAAATAAAATTGACAGGA	Os06g0238900	AK106064	Protein of unknown function DUF716 family protein.
2116	25	76	Os10g0154000|mRNA|AK100212|CDS+3'UTR	GCTGTGGTATGCCCTTTCCTTAACTAAAGCGAATGGCATGTAATATTCTCAAGAGAATAT	Os10g0154000	AK100212	Similar to Vesicle-associated membrane protein 714 (AtVAMP714).
2117	25	77	Os02g0255500|mRNA|AK059303|CDS+3'UTR	TCCTCTTTGAGCCTCTGTTGCTGTTCTTTACCACCCTAGTATGTCACAAGGGCCTAAAAA	Os02g0255500	AK059303	Similar to Extensin (Fragment).
2118	25	78	Os11g0129800|COMBINER_EST|CI393886|6	AAATCAAGTAGTGCGCAGTGGTGGAAATGGAACGTGCAATTAGTAGTGCTCTATTGTATA	Os11g0129800	CI393886	Conserved hypothetical protein.
2119	25	79	Os03g0667700|COMBINER_EST|CI074010|6	TCTTTTGACTCTTCCTACAGGAGATGTAGGATGTTTCACGAATATGAAATTTGAAATTGC	Os03g0667700	CI074010	Hypothetical protein.
2120	25	80	Os04g0461400|mRNA|AK066992|CDS+3'UTR	TGATCCTTTTAAGAGGATTTAACACAGATTTAACAGGGTGTTCTGTATGCGAGCTGTGAT	Os04g0461400	AK066992	Hypothetical protein.
2121	25	81	Os05g0159200|mRNA|AK067837|CDS+3'UTR	ACTGTTGATGTACGTGTATAGACAATTTTATGGAAGCTGCAAGCTTCCAGACCTCAAGAA	Os05g0159200	AK067837	Lipolytic enzyme, G-D-S-L family protein.
2122	25	82	Os08g0326100|mRNA|AK120478|CDS+3'UTR	GTTCTGAACTTTCCTGTGGTAAAATTCTAACTGTACATCATCTGTGATGTTTTGTGATTC	Os08g0326100	AK120478	SMAD/FHA domain containing protein.
2123	25	83	Os03g0401200|mRNA|AK102662|5'UTR+CDS	GGGGTTATAAAAATTTATCCACAGAAAGGTAACATCTGGGCTGTGTATCGAAATTGGTCC	Os03g0401200	AK102662	Similar to DnaJ homolog subfamily B member 4 (Heat shock 40 kDa protein 1 homolog) (Heat shock protein 40 homolog) (HSP40 homolog).
2124	25	84	DarkCorner		
2125	25	85	DarkCorner		
2126	26	1	DarkCorner		
2127	26	2	DarkCorner		
2128	26	3	Os09g0488800|COMBINER_EST|CI464549|6	GGCCCATAATTGGGATAATCCTTAGATAATTATTGAAATGCTTATGTATTCCTCCAATGG	Os09g0488800	CI464549	Retrovirus capsid, C-terminal domain containing protein.
2129	26	4	Os08g0558200|mRNA|AK069761|CDS+3'UTR	TGTAAAAGAATTTATACTCCCTGTTTACTTGTTTTATAGTGAATGACACTGAAATGAGGC	Os08g0558200	AK069761	Glutathione S-transferase, N-terminal domain containing protein.
2130	26	5	Os03g0668000|mRNA|AK111705|CDS+3'UTR	ATGCATTACAGTAGGTGAAGGCTAAATGTATATTTGTTGCCAAAACTTGTTCCTGGTATA	Os03g0668000	AK111705	Cyclin-like F-box domain containing protein.
2131	26	6	Os05g0520600|mRNA|AK067487|CDS+3'UTR	GATACGATCGAGTGTGATCGAGTTGGTATATTTGATTTTGAGATGCATATATTTTGAGAG	Os05g0520600	AK067487	Conserved hypothetical protein.
2132	26	7	Os01g0805200|mRNA|AK104864|CDS+3'UTR	GCGGTGGATGTGGATCGTACGTCATACGAATGACCAGCTAATGTCTTCCATGTTTGTGCA	Os01g0805200	AK104864	Conserved hypothetical protein.
2133	26	8	Os11g0594800|COMBINER_EST|CI393727|0	CAGTATGTAACTGTATTTCGCACGGAGAATATGTGATATTGGATTTATAAATAAGTGTTG	Os11g0594800	CI393727	Protein of unknown function DUF538 family protein.
2134	26	9	Os02g0184500|mRNA|AK105238|CDS+3'UTR	ATACAAAGCATGAGAGGATCTGTTCATTGTATCGTACGTATCCACTGATATATTTATTCC	Os02g0184500	AK105238	Conserved hypothetical protein.
2135	26	10	Os01g0105300|mRNA|AK072732|CDS+3'UTR	GTTTTTAACGAGGCAGCATGTATCATGTAAACATCAATAAAGGTCATTACTCTTTTTTCC	Os01g0105300	AK072732	Zinc finger, BED-type predicted domain containing protein.
2136	26	11	Os07g0567600|mRNA|AK061242|CDS+3'UTR	GGAGCTCGCGACAGGACTCCCTGGAGCATCACGTCAGCCTAAACAATAATTTCCCGGTGA	Os07g0567600	AK061242	Hypothetical protein.
2137	26	12	Os02g0744000|mRNA|AK104827|CDS+3'UTR	TAGTGTAGGCTAAAAGAAGGAATGTACTACTCCATGTTAATCAAAGAACCTGTACCGTTC	Os02g0744000	AK104827	Conserved hypothetical protein.
2138	26	13	Os07g0439100|mRNA|AK110757|CDS+3'UTR	TTAATCCTTTTGTGCTCTTGCTGCTGGGGGAGGCCTTAATTGAGATGGATATCTGCCTAT	Os07g0439100	AK110757	KH, type 1 domain containing protein.
2139	26	14	Os04g0317500|mRNA|AK069922|CDS+3'UTR	GTACTCCAAAATATTGCTGTGGAGCCATATGCAAAGCATGGTTTTGAATATATGTTATTT	Os04g0317500	AK069922	Pollen allergen Lol p2 family protein.
2140	26	15	Os07g0160500|COMBINER_EST|CI439014|6	TGCTTGGGAGAAACTAGTTGATATTGTCAATTATGCAAATTAAATGGAGAAGTGAGAGGA	Os07g0160500	CI439014	Conserved hypothetical protein.
2141	26	16	Os12g0622900|mRNA|AK106674|CDS+3'UTR	AAATTAGGATCCGTATGTACGGTGACAAACAACTTTTGTGATCTAAAGTGACCAGTAAAC	Os12g0622900	AK106674	Mov34/MPN/PAD-1 family protein.
2142	26	17	Os02g0193100|mRNA|AK109089|CDS+3'UTR	CAAAGTAGAATGAACCAGTATATCATCCTCAAGTTTGGTTGTACTCACAAACAAAAAAAA	Os02g0193100	AK109089	Conserved hypothetical protein.
2143	26	18	Os03g0108100|COMBINER|CI493333|0	TGTTTTTGCTAGCTTCGTGTGGTGGGGTTCGTTAATTTAATTTGTAGAGAGCGCTGATGT	Os03g0108100	CI493333	(No Hit)
2144	26	19	Os05g0188100|COMBINER_EST|CI054211|0	TGTTGGAGTCTTCGGTTCGGTTCTTTGGCCTAAACCGATTTATCTTTTATCTCAGCCGTA	Os05g0188100	CI054211	Conserved hypothetical protein.
2145	26	20	Os02g0732900|mRNA|AK104342|CDS+3'UTR	TCTTTGTATGAGGCATGGATGTTTCTTACAGCAGTTCGAGATGCATTTGCTAATGCTGAT	Os02g0732900	AK104342	Protein of unknown function DUF794, plant family protein.
2146	26	21	Os07g0616900|mRNA|AK071047|CDS+3'UTR	CCACTGATAATCTCTCGGTACACATGTAAATATTATCATGATATTTCAGGCCCTGTTGTT	Os07g0616900	AK071047	Protein of unknown function DUF500 family protein.
2147	26	22	Os10g0447100|mRNA|AK120481|5'UTR+CDS	TGTGTTCGAAGTCTTCCTTCCACAACTTCTATTGTACCCAAATCCTTCTGACCCATTAAA	Os10g0447100	AK120481	Similar to Ubiquitin-conjugating enzyme E2-21 kDa 2 (EC 6.3.2.19) (Ubiquitin- protein ligase 5) (Ubiquitin carrier protein 5).
2148	26	23	Os03g0650000|mRNA|AK070479|CDS+3'UTR	GTGTATATGCATGAGTAACGTTACATGCAGCTAGTGTCGACGCACGTATGACAGACTGAA	Os03g0650000	AK070479	Similar to Yabby9 protein.
2149	26	24	Os03g0710600|mRNA|AK068746|CDS+3'UTR	TTATTCATGCTTGTTGTGCCTGAATGATTTGCATACTTCAACTGAAAGGGGCTCAGTCAA	Os03g0710600	AK068746	Conserved hypothetical protein.
2150	26	25	Os07g0568300|mRNA|AJ575241|CDS	AATGGCAAGAGGGGCGAAGTACAAGGCATGCCTGGTACTTCTGCATTGATGAACAGGCCT	Os07g0568300	AJ575241	Similar to ZF protein (Fragment).
2151	26	26	Os08g0419000|COMBINER|CI480309|0	GGTTTGAATTGGTGAAGAATGATGAGTTAGCAAATTAAGCGATTAGATTTTCGATTCGAC	Os08g0419000	CI480309	Conserved hypothetical protein.
2152	26	27	Os10g0389200|COMBINER_EST|CI479132|6	ACAATCAGATATATTGTGTGATTATAAATTTATAATTGCAAATACCATCAGATGTCATAA	Os10g0389200	CI479132	Similar to Red chlorophyll catabolite reductase [Oryza sativa (japonica cultivar-group)].
2153	26	28	Os03g0854200|mRNA|AK069107|CDS+3'UTR	TTTTGTAACTCAGGAAGAAGTCAAAGCAGTTGTGTAACAAACCACTTTGCCATGTTGCTG	Os03g0854200	AK069107	Exoribonuclease domain containing protein.
2154	26	29	(-)3xSLv1		
2155	26	30	Os03g0591700|COMBINER|CI401983|x	ATATGGATGACATCCAAACATGCCCTGTATTCTATAGGGGATACCTCAAAATTCTGTGCC	Os03g0591700	CI401983	Conserved hypothetical protein.
2156	26	31	PAtControl0002|mRNA|X64271|3'UTR		
2157	26	32	POsControl0047|art		
2158	26	33	Os01g0502700|COMBINER_EST|CI549395|0	CGGGATGTGTGTCTGTTAGTAGTCTGCTGATGCTGTTGATCTAATCTATAGTGGTGTCGT	Os01g0502700	CI549395	Similar to Histone H2A.
2159	26	34	Os07g0184600|COMBINER_EST|Os07g0184600|8	AGGGATGGCAGCGTGATCTCTTTGAAACAAGGGGCGCTTCCGGTTGTGTGCGTGCTTCAA	Os07g0184600		Non-protein coding transcript, uncharacterized transcript.
2160	26	35	Os04g0495800|mRNA|AK103154|CDS+3'UTR	GATCATATTCTCGCAAGAAACAATGCCATTAAGGTCTTAAGTTTGTTGAACACGAGTACA	Os04g0495800	AK103154	Similar to NIN-like protein 2 (Fragment).
2161	26	36	Os02g0685200|mRNA|AK111726|CDS+3'UTR	GTTGCCATAGGCTAACTACATGTAATCTAGGCTTGTATCTCTCCACAAAATGCAATGGAA	Os02g0685200	AK111726	Homeodomain-like containing protein.
2162	26	37	Os03g0419200|mRNA|AK064655|CDS+3'UTR	TATGAGCAGTGATGCACATTCTGAACGGGCACTCATGTGCAGAGCATTGGTGGAATAATT	Os03g0419200	AK064655	Conserved hypothetical protein.
2163	26	38	Os01g0612200|mRNA|AK071340|CDS+3'UTR	TCAGATCATGCAACAGTTTATTTTCAGTGCTCAGTGAGTCCCTGTTTGCAAGCAGCCACT	Os01g0612200	AK071340	Cytochrome c oxidase, subunit Vb family protein.
2164	26	39	Os04g0412300|mRNA|AK110902|5'UTR+CDS	TTTTTTCTCCTTCAAAATCTGCAAAACTGTTACAAACTTTCTGCTGCATGTCACGCATCA	Os04g0412300	AK110902	Glycoside hydrolase, family 17 protein.
2165	26	40	Os03g0719900|mRNA|AK070804|CDS+3'UTR	GAAGCTACTTGTGGAATGTAGCTTTGCTTCCAATGCGTCTACTTAATCTGGTATATCTGA	Os03g0719900	AK070804	Similar to Peptide transporter 1.
2166	26	41	Os04g0114200|COMBINER|CI081093|6	AACCTCTTGTCCTTGCCAATGATGTAACGAAAGTCTTTTTCGTGAAGGATATGTCTAGCA	Os04g0114200	CI081093	(No Hit)
2167	26	42	Os08g0382400|mRNA|AK058264|CDS+3'UTR	GACGTTCATCATTTGTCTCTTGCCATATGACCTAAAACTGAATATCAACCGTTTTGTCTG	Os08g0382400	AK058264	Peptidyl-prolyl cis-trans isomerase, cyclophilin type domain containing protein.
2168	26	43	Os03g0180400|mRNA|AK059929|CDS+3'UTR	CAGCTTTACTTGTTGGATCATCCTCTATCGTTGTGGTTGAATTTACTACGATTTACTTGT	Os03g0180400	AK059929	Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1).
2169	26	44	Os06g0663900|mRNA|AK071785|5'UTR+CDS	CTCAGATCTCAGATTTTGGACTTGCAAAGTGGCTTCCTGACAAATGGACTCATCATGTTG	Os06g0663900	AK071785	Protein kinase-like domain containing protein.
2170	26	45	Os12g0606900|mRNA|AK072659|CDS+3'UTR	GGGAAGTGTACAGTGTACAGGCCAAGCATATACGGAGTAGGTCAGAATGCTAGTTATGTA	Os12g0606900	AK072659	Conserved hypothetical protein.
2171	26	46	Os05g0279600|mRNA|AK070566|CDS+3'UTR	CTTGATCATACACGTTACATGTACTCCTGTAGTCCTGTGCAGAATCTGGGCCAATATTCT	Os05g0279600	AK070566	Conserved hypothetical protein.
2172	26	47	Os07g0409400|mRNA|AK106929|CDS+3'UTR	GAATAATTTATAGGTTGTAACTGATCTTGGCTTCGTTTATTCATGAGTGCATGGCTTTGA	Os07g0409400	AK106929	Mitochodrial transcription termination factor-related family protein.
2173	26	48	Os03g0382100|COMBINER_EST|CI444327|0	GGCCATGTGTTGTTTCAGTGGTCCATATATATGCAAAGAATAATGAAGTTCTTTCCGACT	Os03g0382100	CI444327	Very-long-chain 3-ketoacyl-CoA synthase family protein.
2174	26	49	Os03g0853700|mRNA|AK069032|CDS+3'UTR	GATCATGAGTTCCTCGTTCAATCCTGCATGATGTTATCCATACAAATTTTATGGGGGCTT	Os03g0853700	AK069032	GC-rich sequence DNA-binding factor-like family protein.
2175	26	50	Os03g0767900|mRNA|AK106933|CDS+3'UTR	TAGTCATTGTGGGTCTGAATGAAGAGTGGTGAAGTTACACTCCACATGAATACATGATCA	Os03g0767900	AK106933	Protein of unknown function DUF588 family protein.
2176	26	51	Os03g0700400|COMBINER_EST|CI110568|6	GGAGCATGTAGAGAGATTAGCGTTGTGTGGATACCGAATCAGTGTGCCACCTTATAATGT	Os03g0700400	CI110568	Similar to Lipoxygenase 1 (EC 1.13.11.12).
2177	26	52	Os02g0135800|mRNA|AK112028|CDS+3'UTR	TTGGATAGAGTAGAAAACCCTTTGTGTCGCAACTCTTTCATGTATTATGTGTTCCCTTGT	Os02g0135800	AK112028	Similar to Sec13-like protein (Fragment).
2178	26	53	ETG09_48764		
2179	26	54	Os09g0130300|mRNA|AK066394|CDS+3'UTR	GAGAGTAGAGTAGGAGTCAGAAGAATTCCGGAGTTGTCGGTAATCTTCTCCTATTTCTTT	Os09g0130300	AK066394	Conserved hypothetical protein.
2180	26	55	Os02g0676600|COMBINER_EST|Os02g0676600|8	CTGCTAGATTTTGGGATACAGAGACCCTATGGTACATAATGACAGCTTGTGTAATCATGC	Os02g0676600		Protein of unknown function DUF635 family protein.
2181	26	56	Os01g0222700|mRNA|AK101946|CDS+3'UTR	GATAACCTGGAGTATATGGATTATCGAGATTGGAGAACATGAAACTGAACTTTTGATGGC	Os01g0222700	AK101946	Zinc finger, BED-type predicted domain containing protein.
2182	26	57	Os04g0317300|COMBINER_EST|Os04g0317300|8	CTGCAAGTCCTTTCCTGCTGGTCTACATCATGGAGTTGAAGGTGACCATATCTACTTTGT	Os04g0317300		Protein of unknown function DUF295 family protein.
2183	26	58	Os03g0274000|mRNA|AK119251|CDS+3'UTR	AAGTGATGGTGTATTCGATGTAGTCCATATACTGTCGTTGTTAATCTAGCGAAAATTACA	Os03g0274000	AK119251	Oxysterol-binding protein family protein.
2184	26	59	Os05g0355100|COMBINER_EST|AU085852|7	CTTAATTTTCCAACGTAGGATCCTAATTAACTGTATAGTTCATGGTAACAGGAATTGTGC	Os05g0355100	AU085852	Conserved hypothetical protein.
2185	26	60	Os01g0327600|mRNA|AK120216|CDS+3'UTR	TCTCTGCAATAGCTCAGTGTTGTATACTACTTTCTTTTCTGTTGTAATGAAGCTGAAGCT	Os01g0327600	AK120216	Conserved hypothetical protein.
2186	26	61	Os03g0252800|mRNA|AK065537|CDS+3'UTR	TGGTAGTGGTTTCCCGGTAGAATTCATTCTATATCTTTAATTTTGTCCTCTATTCATCAC	Os03g0252800	AK065537	Aminotransferase, class I and II domain containing protein.
2187	26	62	Os02g0124400|mRNA|AK108718|CDS+3'UTR	TGTACCCGATTTTATCTCCCTTATTAAAATCAAACTATACATTAATAAGAAATCAAATCA	Os02g0124400	AK108718	Conserved hypothetical protein.
2188	26	63	Os07g0175400|COMBINER|CI119849|6	ACATCCGACGGTGCATACCACGAGAGCTGGTTCAGTTGTACAAGAAATACTACAAATTCT	Os07g0175400	CI119849	Cation channel, non-ligand gated family protein.
2189	26	64	Os03g0150800|mRNA|AY332471|CDS+3'UTR	GCGATCGCCCAAGCGTGATGTCATAAACATGCCGTCTCGACGTGAGTGACTGAAAAAAAA	Os03g0150800	AY332471	Similar to High affinity phosphate transporter 2 (Phosphate transporter).
2190	26	65	Os08g0162800|mRNA|AK059406|CDS+3'UTR	CTCTGGCTGTGTACTGCACAATAGAAAAATAATGGTTGTCAAGCCAGTTACATGCCCCAA	Os08g0162800	AK059406	Similar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment).
2191	26	66	Os02g0831300|mRNA|AK101449|CDS+3'UTR	TAGCGTTGGTTGCGTTGCAGGGTATTCTTTTTGTAAACTAGTAATATAACTAGCTGGGTG	Os02g0831300	AK101449	Armadillo-like helical domain containing protein.
2192	26	67	Os03g0128700|mRNA|BT014683|CDS	ATGATGCAAGGCAGCAACGTTGGACTAGGGTGGCAAACAATGGAAAGCAGTTTGAATGTA	Os03g0128700	BT014683	Calcium-dependent protein kinase, isoform 11 (EC 2.7.1.-) (CDPK 11).
2193	26	68	Os07g0639600|mRNA|AK067207|CDS+3'UTR	ATAAAAATCGACAGATCGTCGAAATGGATGCATTGCATCCAGTACGGTTGTTGATGTTGC	Os07g0639600	AK067207	Peptidase C15, pyroglutamyl peptidase I family protein.
2194	26	69	Os05g0212200|COMBINER_EST|AU096243|6	TAGCTGATCGAACCAGCAGTTTTTCCAGCAATTTTCTTGGTTACTTTCATCTTGTATTGT	Os05g0212200	AU096243	Conserved hypothetical protein.
2195	26	70	Os01g0889000|mRNA|AK103621|CDS+3'UTR	TTTGCTGGCCACATCCGAGTCTGTACTGTTGCCAATTCTGTTAAACTGATGCAGATCTGA	Os01g0889000	AK103621	Tetratricopeptide-like helical domain containing protein.
2196	26	71	Os03g0828100|mRNA|AK062799|CDS+3'UTR	GTATATCACCCCACTATCAGCTCACCAGTTATTGAGTTTGTCTGCTTCATGAAGTTTCTT	Os03g0828100	AK062799	Similar to 50S ribosomal protein L18.
2197	26	72	Os12g0540900|mRNA|AK102417|CDS+3'UTR	ATGTTACAACAGTTTTGAGCTTAATCAGAACAATCAAGAAACAAACAGCTTTGTCGTCTG	Os12g0540900	AK102417	Similar to Tryptophanyl-tRNA synthetase (EC 6.1.1.2) (Tryptophan--tRNA ligase) (TrpRS).
2198	26	73	Os03g0342800|mRNA|AK109914|CDS+3'UTR	GTGCCTCGCCGTCGGTGAGAGAGAGAAAGAGGAGAGGAGGAAAGAGTGAGAGGCTGAGAG	Os03g0342800	AK109914	Conserved hypothetical protein.
2199	26	74	Os11g0307500|mRNA|AK069871|CDS+3'UTR	TAGTATTTCATTTCATGTTTCCGTGATATGAAACGTGGAGTTCCTCCTATACCTTGACTT	Os11g0307500	AK069871	Conserved hypothetical protein.
2200	26	75	Os05g0217800|mRNA|AK104492|CDS+3'UTR	GACACTACACGTGTTTTATTTTGTTAATTAATAAGTCTGGACAACCAGGTCATCTTGTAC	Os05g0217800	AK104492	Virulence factor, pectin lyase fold family protein.
2201	26	76	Os03g0577200|mRNA|AK061735|CDS+3'UTR	ATTGCAAAGAACGATCTATTAATCCAATCGTGAGTTGCAATTGTTGCTTCCTTTTCCCAG	Os03g0577200	AK061735	Similar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A).
2202	26	77	Os01g0118400|COMBINER_EST|CI551307|0	CACTTGCAACTATATACTATTACACTGTAATTAAGATAGAATTTTAATGGGCGAATACAA	Os01g0118400	CI551307	Protein of unknown function DUF563 family protein.
2203	26	78	Os07g0422100|mRNA|AK063592|CDS+3'UTR	TACATGTGTGTATGTGACCGTACCTAGTACGTACTTTGATCGTAGTAGCTAGGTGTGCAC	Os07g0422100	AK063592	AWPM-19-like family protein.
2204	26	79	Os08g0527700|COMBINER_EST|Os08g0527700|8	CGCCGTCCTCGCCGACTCCTTCTCGGCCGCTACCCATTCATCCTCCTCGCCTGCACCCTC	Os08g0527700		TGF-beta receptor, type I/II extracellular region family protein.
2205	26	80	Os07g0406800|mRNA|AK101812|CDS+3'UTR	GTTAAGTTGCGCTGTAATGTTTCTGTAATCGAAAACTTGTTCGACAAAACAATTGCGCTT	Os07g0406800	AK101812	Eukaryotic-type DNA primase, large subunit family protein.
2206	26	81	Os01g0711900|mRNA|AK108302|CDS+3'UTR	TTCTTTTGTGAACTCAGCATAATTTTGCTTCTTCTAATTAATATAATAACATTTCGTATT	Os01g0711900	AK108302	Conserved hypothetical protein.
2207	26	82	Os06g0274600|mRNA|AK069024|UTR	TTCAAAATTAACTTGCAAACAAATTGTGACGACGACAGACGCCATTGATGTGCTTCCGTT	Os06g0274600	AK069024	"Non-protein coding transcript, unclassifiable transcript."
2208	26	83	Os05g0101200|mRNA|AK062021|CDS+3'UTR	TTATACTACACTACGTCAAATAACAAGTGTTGCTACTAGCTGTGACTGTGAGTAATACCG	Os05g0101200	AK062021	Peroxisomal membrane anchor protein (Pex14p) domain containing protein.
2209	26	84	DarkCorner		
2210	26	85	DarkCorner		
2211	27	1	DarkCorner		
2212	27	2	DarkCorner		
2213	27	3	Os12g0563400|mRNA|AK067785|CDS+3'UTR	TTTGCAGCCACCTTCCACTACTTTGAACCCCTATTGATTTATGATATATGCAATTTATGC	Os12g0563400	AK067785	Rhodanese-like domain containing protein.
2214	27	4	Os04g0657300|COMBINER_EST|Os04g0657300|8	ATCGACGCCGAGACTGACCGTGCAATTCGGGATATTTTGAAGTCGTTTCTGAAGAAGATT	Os04g0657300		Similar to Farnesyl diphosphate synthase (Fragment).
2215	27	5	Os03g0622000|COMBINER|CI281757|6	GTCGATGACTTATATGTACCGTGGCTTATCTGTATGAGACACTTTGTAATGCTTGCTATA	Os03g0622000	CI281757	(No Hit)
2216	27	6	Os07g0102500|mRNA|AK100796|CDS+3'UTR	GCTGTCTGCTATATCATATTCAAATACTTCAAGGTTATAATATTTTTTTTGTTACCCCAG	Os07g0102500	AK100796	Lupus La protein family protein.
2217	27	7	osa-miR171e|Os03|Mature	TGATTGAGCCGTGCCAATATCTGATTGAGCCGTGCCAATATCTGATTGAGCCGTGCCAAT			miRNA
2218	27	8	Os03g0800000|mRNA|AK064790|CDS+3'UTR	TACAAGCAACAGTAAGCTGCAAGCTAGAGTAAAATACTGTCACTGTAAGAAGTTGGGTGA	Os03g0800000	AK064790	Similar to Nitrate and chloride transporter.
2219	27	9	Os04g0583000|mRNA|AK065769|CDS+3'UTR	TTCGGCAAATGTAACTTTTGCATCAGTACTGAACTTTGTACATTTCTTCAGCGCTTAACA	Os04g0583000	AK065769	Cyclin-like F-box domain containing protein.
2220	27	10	RC10		
2221	27	11	Os03g0822300|mRNA|AK060050|CDS+3'UTR	GCCTTGGTATCAGGCAAGCAGTGTATACTTTTCCGGTAATCTTTTCAAGAAAGGCCATTT	Os03g0822300	AK060050	Ribosomal RNA methyltransferase RrmJ/FtsJ domain containing protein.
2222	27	12	Os01g0977200|COMBINER_EST|CI522906|0	AAGTTACTGTCTGTGGAGTTGGAGTTTGTATGTTTGTTTGTTTTAGGAACGCTGATAAGC	Os01g0977200	CI522906	Heat shock protein DnaJ, N-terminal domain containing protein.
2223	27	13	Os03g0556100|COMBINER|CI440432|6	GTTACTCTGTAAGAACGTTTGTTATAATTGGCATGAGTCTATCTTTTGATAGATGAAGCC	Os03g0556100	CI440432	(No Hit)
2224	27	14	Os05g0583100|mRNA|AK062631|UTR	ACCTGATTGAATTCATATTATATTTCTGCTTGATTGTATTGTTTAATGCTAGACTGATGT	Os05g0583100	AK062631	HAT dimerisation domain containing protein.
2225	27	15	Os03g0729900|mRNA|AJ575244|CDS	ACCAAGGATGGTAGCAAGACCCCAAATGTTTTGCAAGAAAGCTTTGATGATGACATAGAT	Os03g0729900	AJ575244	BSD domain containing protein.
2226	27	16	Os01g0231000|mRNA|AK066156|CDS+3'UTR	CAGAGCAGCATCCACTACTAGTAGTACCTAGTGATGCCTACCAAGGCACTGGAATAATAA	Os01g0231000	AK066156	Similar to Auxin-responsive protein (Aux/IAA) (Fragment).
2227	27	17	Os01g0848700|mRNA|AK071303|CDS+3'UTR	TCCGCTTGTATACTTTGGGGGAATTGAAGAGCATTGTACTATGTAACACTGATTCTTTCC	Os01g0848700	AK071303	Similar to Ras-related protein Rab11C.
2228	27	18	Os07g0102000|mRNA|AK070220|CDS+3'UTR	TTATTGATCTAGTTGTATTTCCGTTGGATCAATGAATTAAAACCCCAATTTTAGCTGGGC	Os07g0102000	AK070220	Tetraacyldisaccharide-1-P 4'-kinase family protein.
2229	27	19	Os11g0438000|mRNA|AK071696|CDS+3'UTR	ATAACGTGCCTTGCACGTGTATGATTACTAGTATTAGTACAACATGAACGGTTTCCTTTA	Os11g0438000	AK071696	Similar to Short chain alcohol dehydrogenase-like.
2230	27	20	Os09g0367900|mRNA|AK061601|CDS+3'UTR	TGTATCACCTGATCAGTACTTGGATCGATCGAGATGTTAATTAGTTGCAGAGTTCTTGCC	Os09g0367900	AK061601	Hypothetical protein.
2231	27	21	POsControl0044|art		
2232	27	22	RC5		
2233	27	23	Os01g0885000|mRNA|AK060676|CDS+3'UTR	TAATAAGCAGTGGCCTCGTGGAAGAGACGATGTGCAGCTCATCCACTTGGGCAGCTGCGA	Os01g0885000	AK060676	Similar to Cytochrome c.
2234	27	24	Os06g0626200|mRNA|AK119654|CDS+3'UTR	GGGTCAAAGCTGGTCAAAACCTGTAGCTACTTTGTGATGTGATCTATCTTATAATTTTGA	Os06g0626200	AK119654	Conserved hypothetical protein.
2235	27	25	Os03g0593200|COMBINER_EST|Os03g0593200|8	AGATGATAAAGAAAGAACTCAGGCTTATGAACTTGAGCAGGGTCAGACACTAGGTCTCTA	Os03g0593200		Protein of unknown function DUF21 domain containing protein.
2236	27	26	Os07g0668600|mRNA|AK108315|CDS+3'UTR	TTATGATATTGTCGTCGGGCTAGCTCCGAGCCTATATATCAAGTGGTATCATTTTCTTTA	Os07g0668600	AK108315	Conserved hypothetical protein.
2237	27	27	Os04g0379500|mRNA|AK066817|CDS+3'UTR	AGGTGCATTTGTTGATCCAAGGAAACACCGTGAGGTATGCGGTGATTGTAGTTCATGTAA	Os04g0379500	AK066817	Conserved hypothetical protein.
2238	27	28	Os01g0229200|mRNA|AK106136|CDS+3'UTR	GTAGCATTTGAATGTATAATCTTGTTCCGGTTTTGTACGATGCCCGGCCCCGATTGATTT	Os01g0229200	AK106136	VHS domain containing protein.
2239	27	29	Os07g0171200|mRNA|AK071075|CDS+3'UTR	ACTCCATATGTAACACTGGCTCTATTATGGATGAAAGGGGTATTTGTTCGATGTCATGTA	Os07g0171200	AK071075	Galactose-1-phosphate uridyl transferase, class I family protein.
2240	27	30	(-)3xSLv1		
2241	27	31	PZmControl0003|mRNA|X12539|3'UTR		
2242	27	32	Os03g0298800|mRNA|AK103337|CDS+3'UTR	TCAGTTTTCTAACACTGTATTTTTGGAAAGCAATTGCTTAGTTTAGAAGTCTTTGTTGCT	Os03g0298800	AK103337	Similar to Spliceosomal protein.
2243	27	33	Os01g0250900|mRNA|AK065179|CDS+3'UTR	TTCATCTGATCATCTCAGCATCTGTCTAAACTCTGGACTGTCACTTGAAACAGTTAAATT	Os01g0250900	AK065179	HAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein.
2244	27	34	Os08g0136100|mRNA|AB101650|CDS	AGCGCACCCAGATGAAGACGCAGCATGAGAGACACGAGAACAATGCGCTGCGCGCAGAGA	Os08g0136100	AB101650	Similar to Roc1.
2245	27	35	Os04g0582700|COMBINER_EST|Os04g0582700|8	CTTCAACTTCAACTGGCATTGGTGGTTTCCCCGGGGATACAGAAGAAAATGTAGAGGATA	Os04g0582700		Hypothetical protein.
2246	27	36	Os09g0378300|mRNA|AK068860|CDS+3'UTR	TGCATGAATTTTTTGGTCACAAATTTTAGCCTCTTCATTGTAAACATTCTGGAGACTTCC	Os09g0378300	AK068860	Similar to Leucyl-tRNA synthetase, cytoplasmic (EC 6.1.1.4) (Leucine--tRNA ligase) (LeuRS).
2247	27	37	POsControl0020|genome		
2248	27	38	Os05g0491100|mRNA|AK121606|CDS+3'UTR	GTTGGGGTTTCATCATTTTTCTTGGATCGTTGTGCAGATATGCATTGCCTGGTTCCTTTC	Os05g0491100	AK121606	Similar to Calmodulin.
2249	27	39	Os07g0142900|mRNA|AK060737|CDS+3'UTR	AGAAAATGAGTCAGAAATTTCTGCCTGCATGAATAGAAAAGGTTTATATGACTTTGAGCC	Os07g0142900	AK060737	Aldo/keto reductase family protein.
2250	27	40	Os05g0346200|mRNA|AK071850|CDS+3'UTR	GTTAATTTGATAACGCTTGCTTGTTTGTGTGTGTATATCGATCTCTTTTGAAGCAATGAG	Os05g0346200	AK071850	Similar to Ethylene response factor 1.
2251	27	41	Os02g0234000|COMBINER_EST|Os02g0234000|8	AGGAGCAACTGCAACGGCAAGAACAGGTGGACATGACTGACGGCACGGACGAAACCTTCT	Os02g0234000		Conserved hypothetical protein.
2252	27	42	Os10g0575200|mRNA|AK066761|5'UTR+CDS	AAGCAATTGGATGGCAAGGTGGAAGTATACTGGCACTAGAGACACTAAAGCGTGTTGTTG	Os10g0575200	AK066761	Similar to Rme-8 homologue (Fragment).
2253	27	43	Os04g0367400|mRNA|AK100139|CDS+3'UTR	TTGTGTCCAAAGGGACAAAACAGTGTGCAGATTTTGGTTTCTTTTGGCCTTCGATCACTA	Os04g0367400	AK100139	Reticulon family protein.
2254	27	44	Os04g0126500|mRNA|AK106103|CDS+3'UTR	TTGCAGTCAGCCTCTGCCGGCTCAGGGTGATCTCATAATCAACTGCGACAAAGGGAATAG	Os04g0126500	AK106103	Hypothetical protein.
2255	27	45	Os02g0143200|mRNA|AK070600|CDS+3'UTR	TGGGAAGGAACATCGCATTCTCCCTGCTTTTGTTTGTGCAACGGTAGAGGAATAGTTTGA	Os02g0143200	AK070600	Armadillo-like helical domain containing protein.
2256	27	46	Os08g0473300|COMBINER_EST|Os08g0473300|8	GATGCTGCCAAAGATGCAATTTCAAGTATGAAAGCTATTATGGAAGAACCTGTACCTGAT	Os08g0473300		Conserved hypothetical protein.
2257	27	47	Os04g0656800|mRNA|AK058886|CDS+3'UTR	GAAAGAAAAACACGTAGTAGTAGTACTACGATTAATTAATTTCGGCCGCAGATGCAGGGT	Os04g0656800	AK058886	Similar to Peroxidase precursor (EC 1.11.1.7).
2258	27	48	Os10g0453900|COMBINER_EST|CI542950|1	TTTTTTCTTTATTTGTACTCTTTTATGTCTAGCAAGAAATAAAGGGCTCTATTATTTTGG	Os10g0453900	CI542950	Eggshell protein family protein.
2259	27	49	Os03g0779000|mRNA|AK108586|CDS+3'UTR	TAGTTAATTATTTGTATTTCCAACTTTAGTAAGCTATATATATGAAACAGTATTATTGGT	Os03g0779000	AK108586	Protein of unknown function DUF295 family protein.
2260	27	50	Os04g0692100|mRNA|AK102150|CDS+3'UTR	TTGGACATGGTCCTCTAGGGATACCCATATTCAGAATTGCTCCCGTTAAAATCTTTCGCC	Os04g0692100	AK102150	Similar to Tubulin folding cofactor B.
2261	27	51	Os01g0883900|mRNA|AK119636|CDS+3'UTR	GGTTGTATTGGAACCTGGAAGTGTCACAAGTGTGACAAGTGTCACAGGCAAATTATGTTC	Os01g0883900	AK119636	Protein of unknown function DUF248, methyltransferase putative family protein.
2262	27	52	Os07g0670300|mRNA|AK061154|CDS+3'UTR	ATCGACTTGTTGTATATATTTTGTTACTGGTTATGATGTAATATATGGCCACGAAAATCC	Os07g0670300	AK061154	C2 calcium/lipid-binding region, CaLB domain containing protein.
2263	27	53	Os02g0802500|mRNA|AK102146|CDS+3'UTR	TTCTTTTAGCTGATGTACGGCTTGTATAAAGTGACCAGATGGTTTTCATCTGCAGTTTAT	Os02g0802500	AK102146	Similar to H(+)-translocating (Pyrophosphate-ENERGIZED) inorganic pyrophosphatase beta-1 polypeptide (EC 3.6.1.1) (Fragment).
2264	27	54	Os08g0206900|mRNA|AK071409|CDS+3'UTR	ATAATACATCTCTGTAAGACTGGTCTATGCACAATTGTTAATTCAACGTGCTCTAAAGTG	Os08g0206900	AK071409	UTP--glucose-1-phosphate uridylyltransferase family protein.
2265	27	55	Os03g0176300|COMBINER|CI077154|0	TATGCGCTAGCTCCACCGGAAGCATACGATTTCTCCGGATTTTTACTGTATTTTATGATG	Os03g0176300	CI077154	Similar to WRINKLED1 (Activator of sporamin LUC 1).
2266	27	56	Os02g0506400|COMBINER_EST|Os02g0506400|8	GGGCGCAGCGGCGAGTGCAAGCCGCCGGGCCCGCACATGTGCCTCCTGAGCGACTACGGG	Os02g0506400		Similar to Ubiquitin-specific protease 15.
2267	27	57	Os09g0524500|mRNA|AK119967|CDS+3'UTR	ATCCGGTATCTGGTTTTGCGATTGGGGACGATTTTGTGTCTCGATAACAAGTTGAGGGAC	Os09g0524500	AK119967	Conserved hypothetical protein.
2268	27	58	Os04g0650500|mRNA|AK104273|CDS+3'UTR	TTGTAACCAGTCACTGTTGGCTGAATGAATCACATTACTGATGCTTTCATTTGTAAGATC	Os04g0650500	AK104273	Conserved hypothetical protein.
2269	27	59	Os04g0420900|mRNA|AK101902|CDS+3'UTR	AAGATCTGTAGGTATTAGTGTACCGTATACATTTTTCATGTTGCCAATTGAGATGTTTCC	Os04g0420900	AK101902	Similar to Receptor-like protein kinase.
2270	27	60	Os03g0692700|mRNA|AK069038|CDS+3'UTR	GTAAATGGCAAGTACCTGGCTACCTGCTCCCATGTTTTAAGGAGAAGAGTTGGATCTTGA	Os03g0692700	AK069038	Similar to Pherophorin-S precursor.
2271	27	61	Os08g0558100|mRNA|AK099458|CDS+3'UTR	ATGTAATTGCCTTTTGATGCTAACAGATAATATGGGAGAGTAAACTCAGCATCTATGTTC	Os08g0558100	AK099458	Calcium-binding EF-hand domain containing protein.
2272	27	62	Os01g0911900|COMBINER_EST|Os01g0911900|8	GTGCATTTAAACCAGTTAAGACGAGGAGAACCATCATTCCTTGGCTTCGGATTGCTAGGA	Os01g0911900		Hypothetical protein.
2273	27	63	Os01g0351800|mRNA|AK073503|CDS+3'UTR	GGAAGATTCAGGCACACAAAAATTTCAGACAAATGTTCGTAAGATATCTGTAGGGATCAG	Os01g0351800	AK073503	2OG-Fe(II) oxygenase domain containing protein.
2274	27	64	Os02g0137000|mRNA|AK111719|CDS+3'UTR	ATTGCGGTGTTGTATTGTACTAGTAGGTGAGGACGCTTGGCACTGGCAATACTTTTCTGT	Os02g0137000	AK111719	WD40-like domain containing protein.
2275	27	65	Os03g0770000|COMBINER_EST|Os03g0770000|8	GCGGGCGCGGAAGCAGCAGCGGCTGGAGGAGCTGCGTGGGGAGAGCGCCCGCCTCCGCGC	Os03g0770000		Eukaryotic transcription factor, DNA-binding domain containing protein.
2276	27	66	Os03g0815300|COMBINER|CI328448|6	CCTGGCAACTTATTTAATGATATGAACACCATCCTAATCATTGGGTTGGGAATGCCCTCA	Os03g0815300	CI328448	(No Hit)
2277	27	67	Os05g0420600|mRNA|D10421|5'UTR+CDS	GCCAACAAGAACATGGCTGTGATCTGGGAGGAGAACACACTTTATGACTACCTGCTTAAT	Os05g0420600	D10421	Cytochrome c.
2278	27	68	Os05g0490200|mRNA|AK071895|CDS+3'UTR	GATGTCTCAGTGAGACTCTTTTTGAGTGGCCAAAACTGGCGAAATGAGATGGATAGATTA	Os05g0490200	AK071895	Protein of unknown function DUF1692 domain containing protein.
2279	27	69	Os01g0957600|mRNA|AK059235|CDS+3'UTR	TAAACCATTGCCAATTAATGTTTGCCTAAATTTGTTTCTATCAGAACTGAAGGATAATTC	Os01g0957600	AK059235	Similar to Elicitor-inducible cytochrome P450.
2280	27	70	Os02g0817700|mRNA|AK069768|CDS+3'UTR	CCCAAATCAAATCTGGCCTGGCCTGATCGTTGTCCAAAATACTTAGTACTACTTTCTCTG	Os02g0817700	AK069768	Similar to 3-ketoacyl-CoA thiolase (Fragment).
2281	27	71	Os05g0476000|mRNA|AK073548|CDS+3'UTR	GATCCAGTGTCTGCTGCTGTGTCCTGATAATGTACAACATATAAGAAATTCTCAATATTA	Os05g0476000	AK073548	Conserved hypothetical protein.
2282	27	72	osa-miR399c|Os05|Mature	TGCCAAAGGAGAATTGCCCTGTGCCAAAGGAGAATTGCCCTGTGCCAAAGGAGAATTGCC			miRNA
2283	27	73	Os07g0196200|mRNA|AK070765|CDS+3'UTR	AATTGCTATATGTACAGTTGGAATCTTAGTGTGAATTGGCACTATGAAACAAACGATTCG	Os07g0196200	AK070765	Conserved hypothetical protein.
2284	27	74	Os03g0857900|mRNA|AK061341|CDS+3'UTR	CTATATATATGTATATATACTCGATCGTACTATATTGTATACATCATCAATTACTTGTAA	Os03g0857900	AK061341	Similar to Lysine decarboxylase-like protein.
2285	27	75	Os08g0483300|COMBINER_EST|AU094743|7	CAATCCTCTGTTTCTGGTCGAATTGTACATCGAGAGCTCGACATCGACGACAGAGCCGTG	Os08g0483300	AU094743	Hypothetical protein.
2286	27	76	Os11g0143500|mRNA|AK102697|CDS+3'UTR	GCAGAAATAAAGTGCGTGAAATAACAATTTGATGCGCTTCAAGAAATTAAAGATTTGGCC	Os11g0143500	AK102697	Similar to L-Galactono-1,4-lactone dehydrogenase.
2287	27	77	Os12g0124400|mRNA|AK071024|CDS+3'UTR	GCACACGTCTCATGGTTTCATGAACATAATCGGACAGATTAGCAAGGAACAGTGAGATGT	Os12g0124400	AK071024	Exostosin-like family protein.
2288	27	78	Os03g0753100|mRNA|AY551922|CDS+3'UTR	TCCTCTTCAATTTGTTGCTAATTAAGTGCTTGCCAAACTTTTCTCAGTGTAATGTACTAC	Os03g0753100	AY551922	Transcription factor, MADS-box domain containing protein.
2289	27	79	POsControl0007|genome		
2290	27	80	Os10g0577800|mRNA|AK121290|5'UTR+CDS	ATGCTGTGGATGAAATGATGTTGAATGGTGTCATGCACTTTGAGAAGACTGTTAAGTGCC	Os10g0577800	AK121290	Poly(ADP-ribose) polymerase, catalytic region domain containing protein.
2291	27	81	Os06g0708400|COMBINER_EST|CI363475|6	TTGTTGTAAAATGAGAGTGTTCTCTCAATATTTTCCCATGGCAATTCAGATTGGATATGC	Os06g0708400	CI363475	Cyclophilin.
2292	27	82	Os03g0272300|mRNA|AK060183|CDS+3'UTR	TTTGAACTCAAATATCCCGTATATGAACATCTGGGAAAAGGATAAAGAAATGGCGATACT	Os03g0272300	AK060183	Zinc finger, RING-type domain containing protein.
2293	27	83	Os01g0672300|mRNA|AK107129|CDS+3'UTR	AAACAACCGGGTAGTGTGAAGCTGTACTTTGCTGGTTTAAGGTGTTGGGATTGATGCGTA	Os01g0672300	AK107129	Conserved hypothetical protein.
2294	27	84	DarkCorner		
2295	27	85	DarkCorner		
2296	28	1	DarkCorner		
2297	28	2	Os03g0405500|mRNA|AK069583|CDS+3'UTR	TGTGTTGATGAACATTAGTTGAGACCAGAGCTTTGGATTATTCATTATTATGTGCAAACC	Os03g0405500	AK069583	Similar to PDI-like protein.
2298	28	3	Os10g0138300|COMBINER_EST|CI469496|3	AACTGGTGCTGCGCCGTTCAAATCTTCAGCTAGTATAAGTTTAGACGACAGCAGGGATAT	Os10g0138300	CI469496	Conserved hypothetical protein.
2299	28	4	Os03g0339300|mRNA|AK104395|CDS+3'UTR	CAACGTGATATTGAATTTATGTAAGGGCTTGTCCGGTTTATTGCCATTTTCAACACTATC	Os03g0339300	AK104395	Similar to Peroxidase (EC 1.11.1.7).
2300	28	5	Os01g0744000|mRNA|AK101026|CDS+3'UTR	TATAAGTTTCGCTGGTCGACTCAACAACGTATCTTGGTTAAAGATTCATGATGAGCAGCG	Os01g0744000	AK101026	Similar to Kinesin heavy chain (Fragment).
2301	28	6	Os02g0134300|mRNA|AK120292|CDS+3'UTR	GCTTTGGAAGTTGGATAGTGGTGCAGTATAACAGAGTAGGATCATGATGCATCAGCTATT	Os02g0134300	AK120292	Protein of unknown function DUF701, zinc-binding putative family protein.
2302	28	7	Os11g0109700|mRNA|AK072035|CDS+3'UTR	TTGTAATCCGTTCCCAGCTGCAATTGCACCTTGGAAATAGTGAATCTCTAATGCAATTAT	Os11g0109700	AK072035	Protein of unknown function Cys-rich family protein.
2303	28	8	Os12g0278700|mRNA|AK068027|CDS+3'UTR	GATGTAGATACAATAGGCCTTTGATACTAGTCTTAAAACAATGTTTGTGATTATGTAAGT	Os12g0278700	AK068027	Similar to Cystinosin homolog.
2304	28	9	Os07g0264000|mRNA|AK107969|CDS+3'UTR	TGTATGGGAGCAAATTTGCCCCTGCAGAAGTTTGGTTTTGTCTCCAATGCAATCTGAGTG	Os07g0264000	AK107969	Conserved hypothetical protein.
2305	28	10	Os12g0211000|mRNA|AK101792|CDS+3'UTR	CAACCAAGGCTTCATGTGTCTGTGTCAATTGTCAGGGCAAATCTTGTAGACCCAACCATA	Os12g0211000	AK101792	Conserved hypothetical protein.
2306	28	11	Os01g0118700|mRNA|AK070385|CDS+3'UTR	TTTGCATTGAGTGTGTTGTTGTTGTAAACAAGTAGCAGAGGTTGGTAGAGTTTGGTTGTC	Os01g0118700	AK070385	Similar to HGA4.
2307	28	12	Os03g0608000|mRNA|AK111073|CDS+3'UTR	ATCACCTTTACGTGTGTGTATGTTCAGATGTGTACTACTACTGTAATTCTTTTTGCCGAC	Os03g0608000	AK111073	Hypothetical protein.
2308	28	13	Os04g0191600|mRNA|AK069445|CDS+3'UTR	ACCTGGATTGTAGCGTTCGTTTTCTGTACAATAAGAGCATGTTTAGTTCGCGAAATAAAA	Os04g0191600	AK069445	F-box associated type 1 domain containing protein.
2309	28	14	Os08g0440200|mRNA|AK121617|CDS+3'UTR	TTAAGAACGGTCTGAAGAAGAAATATTTGTGCTCTCAGAGCATGAGCACTCCAGAAAAGA	Os08g0440200	AK121617	Ribonuclease CAF1 family protein.
2310	28	15	Os05g0565200|mRNA|AK067090|CDS+3'UTR	AAATTGGTCATGGGAATGCTATTGTCAGCTACTAGCAGTATATAGGTTCCAAATGTCGCC	Os05g0565200	AK067090	Similar to Urease accessory protein G.
2311	28	16	Os05g0381500|mRNA|AK061992|CDS+3'UTR	TGTTGCTTTGAGAAAATCCTTCCAGTTATAAAAGTCAGGAAGCATATGCTTGAATGCTTC	Os05g0381500	AK061992	Conserved hypothetical protein.
2312	28	17	Os11g0151500|mRNA|AK102457|CDS+3'UTR	ATGGCACGGTATTACAAAAGTGTGCCTGCACTTTATAGTTGCAACTGACTGAACCAAGGC	Os11g0151500	AK102457	Major facilitator superfamily protein.
2313	28	18	Os02g0541000|mRNA|AK107551|CDS+3'UTR	TTTCTTGTTTTATCATCTATGTTCTCTTTCTCAGATTTTAATGAAGAATAATTGTGATTC	Os02g0541000	AK107551	Conserved hypothetical protein.
2314	28	19	Os01g0899800|COMBINER_EST|CI075296|0	GCCATACTTAAATTAGGGTTCATGAGATGACCATTAAGCAGGTTATATCATTAATGATGT	Os01g0899800	CI075296	Pathogenesis-related transcriptional factor and ERF domain containing protein.
2315	28	20	Os05g0129800|COMBINER_EST|Os05g0129800|8	CTTGCCAAGCTTATCTTTCATGGTCCAAGAGTGCAGCTTCTCTGATGCAAGAACACTGTT	Os05g0129800		DNA-binding WRKY domain containing protein.
2316	28	21	Os07g0293000|COMBINER_EST|Os07g0293000|8	TCGCCGGAAAGTGGAACTTTTTATTGTGCCTGTGAAACATGAACAATATCAGCTTATGGG	Os07g0293000		Cytochrome P450 family protein.
2317	28	22	Os03g0596900|mRNA|AK099029|CDS+3'UTR	AGAGCATCATGTAATGAATCATGTTCGTCATAGGTTTGAATAACAAGTGGACGTATTAGG	Os03g0596900	AK099029	GTP-binding signal recognition particle SRP54, G-domain containing protein.
2318	28	23	Os03g0759500|mRNA|AK063449|CDS+3'UTR	CATTTGGCTAGAATGTAAGCGTATGTTCTTCAAATCTAAATGTAATGGCAACTATCGTTG	Os03g0759500	AK063449	Origin recognition complex 5.
2319	28	24	Os02g0525600|mRNA|AK069214|CDS+3'UTR	AGTAGCTGCTACTTCTCCTCCCTCTATTATTATAATCTATTGGATGATGATAAGCTGATA	Os02g0525600	AK069214	Conserved hypothetical protein.
2320	28	25	Os08g0515700|mRNA|AK067628|CDS+3'UTR	TGCTGTAGTGGTACAACTCACTTGGGCATTTCAACTGAGAAGAGCATGCCGACAAGAAAA	Os08g0515700	AK067628	Protein of unknown function DUF547 domain containing protein.
2321	28	26	POsControl0037|art		
2322	28	27	Os03g0119500|mRNA|AK069531|CDS+3'UTR	GCTACTGTTGTTTTGTAGCTTTAGTTGTGGAGTTAGCTTTTCATGTTTGCTAATACAACT	Os03g0119500	AK069531	Similar to Callose synthase 1 catalytic subunit.
2323	28	28	Os02g0526000|mRNA|AK058905|CDS+3'UTR	TATGATTGACGCGCTCTGTGATTCAGATGAATATATATAGTACATATTCTGACGGATACT	Os02g0526000	AK058905	Conserved hypothetical protein.
2324	28	29	osa-miR168b|Os02|Mature	AGGCTTGGTGCAGCTCGGGAAAGGCTTGGTGCAGCTCGGGAAAGGCTTGGTGCAGCTCGG			miRNA
2325	28	30	Os04g0106400|mRNA|AK068763|CDS+3'UTR	AATACCAAATATATAAATATGTAGTCAAGTGTCAAAATATATATAGTTTTCTACAGCTTG	Os04g0106400	AK068763	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein.
2326	28	31	Os05g0459000|mRNA|AK106756|CDS+3'UTR	TTTTTTCCTTTATATCATCGTGGACTCTTATGAGCCTTGAAATGAGATGATTGGTCATGT	Os05g0459000	AK106756	Similar to Gag/env/c-myb protein (Fragment).
2327	28	32	Os03g0342900|mRNA|AK104744|CDS+3'UTR	GTGTGATTTTGCTTGATGTATTATCTGAATTCTCAAGTAGTAGATGCTTTGCTTGAACCT	Os03g0342900	AK104744	Dormancyauxin associated family protein.
2328	28	33	Os08g0288000|mRNA|AK099411|CDS+3'UTR	TAAACCTCTATTACACTATATACCCATGTAAATGTCCCTTAACCATGTAAATTCCCCTGT	Os08g0288000	AK099411	Hypothetical protein.
2329	28	34	Os04g0486300|mRNA|AK063256|CDS+3'UTR	AATAATGAGGCTAGTCCTTCCTCCCTTGTTTTCTGTACCAATACGTGATGCACCGGTCTT	Os04g0486300	AK063256	Protein of unknown function DUF295 family protein.
2330	28	35	Os04g0435500|mRNA|AK104121|CDS+3'UTR	CATGTCTTGAGTACCTTGTATTCTGTTCTATTTTCTGCTATCAAAAGGGGTAATTTTCAC	Os04g0435500	AK104121	Glutathione S-transferase, N-terminal domain containing protein.
2331	28	36	Os03g0243600|mRNA|AK072916|CDS+3'UTR	ATATGTCGATACGATGCAGTTTGGAAGGAGAAATTGAAGTGGTTGGAAAACCAGTTGAAA	Os03g0243600	AK072916	Acyl-coA-binding protein, ACBP family protein.
2332	28	37	Os02g0461600|mRNA|AK105240|CDS+3'UTR	GGGATCTCTCTTTTTTCATCAATTGCTCTGTCGACATTCCAGGGATACAGAATTTGGTGG	Os02g0461600	AK105240	Conserved hypothetical protein.
2333	28	38	Os09g0534900|COMBINER_EST|C99016|6	GGTGATTGAACACGAAGTATCTCTATCAAGCAATATGGTGTGGTAGCCGACATCTGTGGA	Os09g0534900	C99016	Hypothetical protein.
2334	28	39	Os09g0314300|mRNA|AK071933|CDS+3'UTR	TGACCAGGGTTTCAATGGTTTATGTAAAGTGTGATATACATGTTACTATTTCTTTGCTCC	Os09g0314300	AK071933	Peroxin-3 family protein.
2335	28	40	Os02g0154300|mRNA|AK111975|CDS+3'UTR	ATAAAAAAGAAACACAGGTCAAGAACTTTATAAAAAAGAACTGCTATAGCAGCTTCTTGG	Os02g0154300	AK111975	Conserved hypothetical protein.
2336	28	41	Os03g0390000|mRNA|AK061827|CDS+3'UTR	GCAGTTGCTATGTATTCTGATGATATAACTTGTGCCTACTATTTTCTTGGTTTTTGTGTC	Os03g0390000	AK061827	Similar to Ribosomal protein s6 RPS6-2.
2337	28	42	Os10g0135700|mRNA|AK119991|5'UTR+CDS	AAATAGGCTATAGCTACCCTAGAGAATTCAGAAGATGTGTTGGAGGCCGCTCGGCCACCT	Os10g0135700	AK119991	Non-protein coding transcript, unclassifiable transcript.
2338	28	43	Os07g0633600|mRNA|AK061698|CDS+3'UTR	TTTGTGTAATTTATGTATTACTCTTGAGAAGTTTCTTGTAACTTGTTACTGGCCCCTTCG	Os07g0633600	AK061698	Conserved hypothetical protein.
2339	28	44	Os11g0687900|mRNA|AK103659|CDS+3'UTR	AGAGTGTGGAGGATGTTGCGGAGGCATGCTTCTGTTGGAAATATAGTCATTAATCGGCAT	Os11g0687900	AK103659	Similar to MLA10.
2340	28	45	Os02g0610400|mRNA|AK102477|CDS+3'UTR	CCTTGTTCCAAGGTATACTTCCGTAATGATTAGCCTTTAGTAACGGCTTTGCCGTTTACT	Os02g0610400	AK102477	Lupus La protein family protein.
2341	28	46	Os11g0265900|mRNA|AK064889|CDS+3'UTR	ACTGTAGTCCTAATGCTCTTTTTAGGTGAGGATAGTTGTACTCTAACTCTTGTATATTAC	Os11g0265900	AK064889	Disease resistance protein family protein.
2342	28	47	Os10g0411800|mRNA|AK059434|CDS+3'UTR	CATGTGTTTTGGTGGACATGATTATCTTTTTCTATCGCACTGGTGAAATCTTGAGTGATT	Os10g0411800	AK059434	Similar to 40S ribosomal protein S17-3.
2343	28	48	Os05g0519700|mRNA|AK105433|CDS+3'UTR	TTGTGAAATTTCTGATGAACTGAAGAAGTGTAAAAACGTTTACGTTCTGGTTGAGTTGAG	Os05g0519700	AK105433	Heat shock protein 101.
2344	28	49	Os01g0294700|mRNA|AK068755|CDS+3'UTR	TTGTAATTTGTTCTCTGTAATTTCTCAGCCATGTTAATCTGTTACATAAGTTAATCATAC	Os01g0294700	AK068755	Haem peroxidase, plant/fungal/bacterial family protein.
2345	28	50	Os06g0498100|COMBINER_EST|CB658082|7	TATATCAGCAAAATCCAATGAAAATGAGTTTGATCAGTCGATGAGCTCCAAGATCGTCTC	Os06g0498100	CB658082	Conserved hypothetical protein.
2346	28	51	Os03g0595600|COMBINER_EST|Os03g0595600|8	TGAAGCTGTGTTTGCCCAACAGAGAGCGCATCGCCGCCTTCTTCACGCCAAAGGACAAGT	Os03g0595600		Similar to Glutathione S-transferase GST 20 (EC 2.5.1.18).
2347	28	52	Os01g0881500|mRNA|AK067457|CDS+3'UTR	GGTAGAATTATCTTGTCGACTCTGCTTCATGTATAAAATTATGTGTTGCTAGAATATGCC	Os01g0881500	AK067457	Similar to Scarecrow-like 1 (Fragment).
2348	28	53	Os04g0679800|mRNA|AK060662|CDS+3'UTR	AGAGAACTTGTGAATTCTGACTAGATCCAATGCTGTGGTCAGATGTTGTAAATGCTTGTA	Os04g0679800	AK060662	Similar to RNA-binding protein-like protein.
2349	28	54	Os06g0655500|mRNA|AK069365|CDS+3'UTR	TTTCGTTCACTAAGGCAAAGTACTTACCAATAAGATGGTGAAGAAAGAATGTTTTGTTCC	Os06g0655500	AK069365	Cyclin-like F-box domain containing protein.
2350	28	55	Os06g0232200|COMBINER_EST|CI276999|6	AAAGGCCTCGCAGCACCACGTTGTTAGAATAGGTTTATTTGTTCGTGCAATTTGGTGTGA	Os06g0232200	CI276999	Ribokinase family protein.
2351	28	56	Os02g0755400|mRNA|AK106338|CDS+3'UTR	TTCATATTCTTTTCCAATTTTCACAATGCATTTCTTCGGTGAATCCATTGTATGGCCCAA	Os02g0755400	AK106338	Similar to RNA recognition motif-containing protein SEB-4.
2352	28	57	Os01g0604100|mRNA|AK099765|CDS+3'UTR	ACTGCTAGCTAGGTTAAGGTGGCAAATTTAATCTTTATTAATTGTTGCGGGAACATTGTT	Os01g0604100	AK099765	UspA domain containing protein.
2353	28	58	Os01g0850900|mRNA|AK102887|CDS+3'UTR	TCTTTATCCTTTTGACTTTGTTCTGTACTGATGTATGTTTGGATCAACGAATAATGGACA	Os01g0850900	AK102887	SOUL heme-binding protein family protein.
2354	28	59	Os07g0588000|mRNA|AK099482|CDS+3'UTR	TTTCTGTTGTCCGGTCGCTCAGAGTGCCTTTACATGTGGAAACAAACGTGCTGAAATGAA	Os07g0588000	AK099482	Interferon-related developmental regulator domain containing protein.
2355	28	60	Os08g0386200|mRNA|AY676931|CDS	TGAGCTACTGCTTCGACTTCGACCCGGCGGTGTACGGCGGCATCGTCGGCACGCCGAGCT	Os08g0386200	AY676931	WRKY transcription factor 69.
2356	28	61	Os05g0567100|mRNA|AK098911|CDS+3'UTR	TCTGTTCGAATTCTCGTACTGATATGTGAACTTCTGATAACATGTGCACTGTGTTTTGTG	Os05g0567100	AK098911	Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
2357	28	62	Os02g0320100|mRNA|AK103173|CDS+3'UTR	CCATCACTGTTATGGTTTGCGAAGCAAAGTGGTGCAAACTGTCAGCTATGCGAATCTAAA	Os02g0320100	AK103173	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein.
2358	28	63	Os01g0949500|mRNA|AK068769|CDS+3'UTR	CATTCTTGTTTCGATTGTTCACCATCTGGAATTCTGGATGTCAGTTAATCTGATCTTAAT	Os01g0949500	AK068769	Similar to Calmodulin (CaM).
2359	28	64	Os08g0126500|mRNA|AK110941|CDS+3'UTR	TAGGCTGAATTCTGTGATAAGAGACAGAAGTTTTGGCTGTCTTCGTTGCTGTCATTCCGA	Os08g0126500	AK110941	Protein of unknown function DUF295 family protein.
2360	28	65	Os09g0453700|mRNA|AK068857|CDS+3'UTR	GAAGTCTGAAACTTGTATATGTGTAAATACCCCTTTTCTTAAGTAAATTTGGTCCGCCTA	Os09g0453700	AK068857	Peptidase S9A, prolyl oligopeptidase family protein.
2361	28	66	Os02g0631200|mRNA|AK072947|CDS+3'UTR	AGGTAACCTGTCTCTGTCTGTAATGCAAGTGCTTACTCTCTGGAATCACTCTCCACTGTA	Os02g0631200	AK072947	Homeodomain-like containing protein.
2362	28	67	Os02g0759400|mRNA|AK067456|CDS+3'UTR	GAGAGGGGATTGAGAAGATTGGAAAGATACGTAAAACGAGGTGAGTCATTAGTGCATGAT	Os02g0759400	AK067456	Zinc finger, RING-type domain containing protein.
2363	28	68	Os10g0180800|mRNA|AK099018|CDS+3'UTR	AGTCATGTATGTTGAAATGAGAAATTATACTATATGCCATCAACAAGGAGCTAATTCTGC	Os10g0180800	AK099018	EGF domain containing protein.
2364	28	69	Os10g0414700|mRNA|AK099068|CDS+3'UTR	GGGTAAGTGATGTACAAGATATGTGCCCTCAGATGTTTGAGAGACAGTTTGTATTACATG	Os10g0414700	AK099068	KH domain containing protein.
2365	28	70	POsControl0045|art		
2366	28	71	Os02g0327000|mRNA|AK073631|CDS+3'UTR	CAGGGGTTGTAACTATTGAAACTTTGTCTGTCTTTCTTCTTGTACGCCAAAGACCAATGC	Os02g0327000	AK073631	C2 domain containing protein.
2367	28	72	Os08g0562500|mRNA|AK063515|CDS+3'UTR	CTTAATTATTAAGCCCATGCATCATATCTGGCCTGTTGCTTGATTGGAAATGTAACCTAT	Os08g0562500	AK063515	Transferase family protein.
2368	28	73	Os10g0498200|mRNA|AK059099|CDS+3'UTR	TTGTCCTGCTGGTGTTACTAGCAATGTAAAGACTAAACCCATTGCTATACTTCTACCATG	Os10g0498200	AK059099	Epoxide hydrolase family protein.
2369	28	74	(+)eQC-42		
2370	28	75	(-)3xSLv1		
2371	28	76	Os02g0105200|mRNA|AK063525|CDS+3'UTR	AGCCTGTATACGATTTGTCCCTTTTCTTTTTCCCCTTCATAGTGCAAAACCAAGAGGCGC	Os02g0105200	AK063525	Similar to Dihydrolipoamide S-acetyltransferase (EC 2.3.1.12).
2372	28	77	Os03g0203200|mRNA|AK070827|CDS+3'UTR	ACCGAGAGTGTACTGTAGCATTAGTGCTCGATTTTTACCTACCTTACTCTATTGGAAAAA	Os03g0203200	AK070827	Esterase/lipase/thioesterase domain containing protein.
2373	28	78	Os03g0390400|mRNA|AB025187|CDS+3'UTR	TGGTTGCTCGCTTGGGAAAATGTGTTGACATAAATCTTAAGTTCTTTACTTTCTCTGTTT	Os03g0390400	AB025187	Similar to Cytochrome c oxidase subunit 6b.
2374	28	79	Os02g0255700|mRNA|AK067390|CDS+3'UTR	CTTGTTATTATGTACTGGACCATCTGTCGACATAACACATGTGAACTTATTTTTACTCTG	Os02g0255700	AK067390	Conserved hypothetical protein.
2375	28	80	Os01g0261900|COMBINER|CI102770|6	TGCTCAGTATGTCCAAATCATGGTGCTGCACTTCTCAAAGGTTGATCATAGCTCAGGCAA	Os01g0261900	CI102770	(No Hit)
2376	28	81	Os07g0676200|mRNA|AK100834|CDS+3'UTR	AAGTAAGTAGGACATGCTGCTAAATGAGGATCACAGTGTTTTGTCCTGACTAGTGGCGGA	Os07g0676200	AK100834	Similar to Ferredoxin-dependent glutamate synthase, chloroplast precursor (EC 1.4.7.1) (Fd-GOGAT).
2377	28	82	Os01g0235400|mRNA|AK105595|CDS+3'UTR	TCGGTCATCACCCTTTGTTAGGTCGGGTTACAAAAAATATTGCGAACCTCGATTGGAGCT	Os01g0235400	AK105595	Similar to Importin-alpha re-exporter (Cellular apoptosis susceptibility protein homolog).
2378	28	83	Os01g0265800|mRNA|AK099896|CDS+3'UTR	GATCTTTTCTACATCGTTTTGGCTAAATAAGTGCAGATTTTCAGCATAAGATCAGGTTAC	Os01g0265800	AK099896	Similar to Sulfated surface glycoprotein 185 precursor (SSG 185).
2379	28	84	DarkCorner		
2380	28	85	DarkCorner		
2381	29	1	DarkCorner		
2382	29	2	DarkCorner		
2383	29	3	Os06g0239600|mRNA|AK062674|CDS+3'UTR	GCAACTAGTTCTCTTCTATTCTTTAGTTGATTGAGTAGTCTTGTATTATACGAGCCGTAC	Os06g0239600	AK062674	Protein of unknown function DUF246, plant family protein.
2384	29	4	Os10g0113900|mRNA|AK107387|CDS+3'UTR	CATCTGCGCCAATTAGCAAAACCGGCGGTGGTGGTAGGATGGCGGAACCATCACCATCAT	Os10g0113900	AK107387	Similar to NADPH-dependent codeinone reductase (EC 1.1.1.247).
2385	29	5	Os01g0249300|mRNA|AK066274|CDS+3'UTR	GCTACGGCCTATTTGTCAATGGATATTTTTAAACAAGTTTGTATTGTACAAAACAGTGGC	Os01g0249300	AK066274	Lg106-like family protein.
2386	29	6	Os05g0241100|mRNA|AK120403|CDS+3'UTR	ATAACAGAACACTCAGGTTGCTCCTAACTTGTCTTATGCAGATACCACTCATGCTGCCTT	Os05g0241100	AK120403	Similar to Leucyl-tRNA synthetase, cytoplasmic (EC 6.1.1.4) (Leucine--tRNA ligase) (LeuRS).
2387	29	7	Os10g0534100|mRNA|AK120472|CDS+3'UTR	GAAATGCTTCACCTAGTGAACCAGGAGCTTCTTACCCCTGTTGTATTTTTTCCCCTCTGT	Os10g0534100	AK120472	Conserved hypothetical protein.
2388	29	8	Os03g0657000|mRNA|AK061103|CDS+3'UTR	ATATGTACTGTGGATGCGTTGCGTTTTACAGTAGAATGTCATGGACTGTTTGGATGGTGG	Os03g0657000	AK061103	TATA-binding protein TBP2.
2389	29	9	Os08g0544500|mRNA|AK059291|CDS+3'UTR	CCTCCTCTGTTGCTACATGAATTAGCAATGTGCTAGTTGTATGTCTGTTAATGTAAATGG	Os08g0544500	AK059291	Similar to ARP2/3 regulatory protein subunit NAPP.
2390	29	10	Os08g0421400|mRNA|AK099935|CDS+3'UTR	CTCACAAAGTGTACCTAGATTTTTAAATTCTATTTCAATACAAATATCCCGCAGCAACGC	Os08g0421400	AK099935	Conserved hypothetical protein.
2391	29	11	(-)3xSLv1		
2392	29	12	Os12g0601600|COMBINER_EST|Os12g0601600|8	TACGGATACGTGATACGGCGATACCGGGATACACCATCTTCCCAAAAACATGGATACGGG	Os12g0601600		Conserved hypothetical protein.
2393	29	13	Os12g0605800|mRNA|AK121511|CDS+3'UTR	GCTCCCAACCCACCCCCTGTTGTTGTTGTCGCAAACCTGAAACTGTACAGTGTACATTAC	Os12g0605800	AK121511	Similar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment).
2394	29	14	Os08g0119700|COMBINER_EST|Os08g0119700|8	CTTCCATTATTTGTAAAGAACCAGTAATGCCTTATTTGGGGAATTCGAGATTTGGACAGG	Os08g0119700		CCT domain containing protein.
2395	29	15	Os12g0484600|mRNA|AK121736|CDS+3'UTR	TGTGATGAGGTAAATTCGCATGGCTCGGATAGTTTTCAAATTTTCCTTTGAATTTATAGG	Os12g0484600	AK121736	Nodulin-like domain containing protein.
2396	29	16	Os04g0446500|mRNA|AB118009|5'UTR+CDS	AAAGTTCAGTTGTTATTGAGGAAATTCAAGAGGATGACAAGCCTGCTGCTGGTGGAGCAC	Os04g0446500	AB118009	Similar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15).
2397	29	17	Os03g0712700|mRNA|AK121196|CDS+3'UTR	ATTTGAGCCCGAGCAGATACCGAAGGTAGATAGTGACTGTGTGCCCTCTGGCTTAGGATC	Os03g0712700	AK121196	Similar to Phosphoglucomutase, cytoplasmic 2 (EC 5.4.2.2) (Glucose phosphomutase 2) (PGM 2).
2398	29	18	Os01g0935600|mRNA|AK105604|CDS+3'UTR	AGCTCTTTGAGCCGCCTCGGTTGTGTGTAGATATTTTTCTCTTAATAAAAGCACTGTTTT	Os01g0935600	AK105604	Six-hairpin glycosidase domain containing protein.
2399	29	19	Os02g0318400|mRNA|AK064642|CDS+3'UTR	TTTTGTGGACACGTTCAGTAATCTGTTAATTCAGGGATGGTAACGCTTTTAGATTTCCCA	Os02g0318400	AK064642	Conserved hypothetical protein.
2400	29	20	Os03g0404500|mRNA|AK061614|UTR	TATACGCAAATTACTTTGTTTACAGAGAGCGGTTAGTAAATGGATCTCGTTTTGAGCGAT	Os03g0404500	AK061614	Non-protein coding transcript, unclassifiable transcript.
2401	29	21	Os03g0626700|mRNA|AK068484|CDS+3'UTR	ATCAGCTGGAAATTATTGTACTACTGAGGTTCATTTTCACATTGAGGTGATTTTTTGAGC	Os03g0626700	AK068484	Multi antimicrobial extrusion protein MatE family protein.
2402	29	22	Os11g0482400|mRNA|AK066023|CDS+3'UTR	CTTAGGATCAGATCTAAGATTTTATTGTTTAAACTCACAATGCAATATGGCAGTAACCCC	Os11g0482400	AK066023	Tetratricopeptide-like helical domain containing protein.
2403	29	23	Os02g0209300|mRNA|AK063719|UTR	AGTGGGTTAATTAACTGGATGTACTCTTCTGCATATTTTGGTGTTCATTGGTAACAGTTT	Os02g0209300	AK063719	Non-protein coding transcript, unclassifiable transcript.
2404	29	24	Os05g0159100|mRNA|AK103137|CDS+3'UTR	CGACAATTTTCTGTAATTTTATGCATTCTCGCAAAATGCCCGTACATGGTTACGTGATTG	Os05g0159100	AK103137	Protein of unknown function DUF846, eukaryotic family protein.
2405	29	25	Os03g0681700|mRNA|AK111767|CDS+3'UTR	GCATGCGCAAGGTGGACAATTGATATGATTTATTAAGCGTCTCGGTTTTTAACAAAGTGC	Os03g0681700	AK111767	Similar to Yarrowia lipolytica chromosome E of strain CLIB99 of Yarrowia lipolytica.
2406	29	26	Os09g0555700|mRNA|AK101950|CDS+3'UTR	TCTTTTGATGTGAAGTCATCATGTGAAGGCCTGACCCCAGACTAGAATCAATTCAAGCGC	Os09g0555700	AK101950	Zinc finger, C2H2-type domain containing protein.
2407	29	27	Os04g0663400|COMBINER_EST|Os04g0663400|8	ATCTCCGTCCAGATTGCTCAAGAATCCAATCCAACGGCTGGAACGCGCAGCCGCAGGAAT	Os04g0663400		Hypothetical protein.
2408	29	28	Os05g0451200|mRNA|AK073037|CDS+3'UTR	TAGCACGTTCATGTGTTGGGAACCACCTGTTTTGTGTTCAAAGTGAGATTGAAAGCCCGA	Os05g0451200	AK073037	Conserved hypothetical protein.
2409	29	29	osa-miR169j|Os09|5'seq	TCGCATCTGGTAGCCAAGGATGACTTGCCTGTGTCTCTGCTCATGTGCAGTAGAAGAAGA			miRNA
2410	29	30	Os02g0772500|mRNA|AK100349|CDS+3'UTR	AAAGCCTGGAGTATGTCTTCATTTATCATCTTTCTGCGATTAAACGATGCTTGTCCTTTT	Os02g0772500	AK100349	Protein prenyltransferase domain containing protein.
2411	29	31	Os03g0369200|COMBINER_EST|Os03g0369200|8	AGGCAACGATCCCACGGTGGTGCAGGACGTCGAGACGCCGAACAAGCTGGACAACCAGTA	Os03g0369200		Similar to Peroxidase 1.
2412	29	32	Os09g0567100|mRNA|AK069269|CDS+3'UTR	AAAGCCCAAGCATTATGGGCAAGAATATGTAGTACATTTTGATTTTCTATACTCACTGTG	Os09g0567100	AK069269	Hypothetical protein.
2413	29	33	Os01g0841000|mRNA|AK103342|CDS+3'UTR	GCTGGCATCCTCTTTGTGATGACCCTTTTGTAATCGTCGTCCTTAATTTCAGTTCTGATT	Os01g0841000	AK103342	ENTH/VHS domain containing protein.
2414	29	34	Os02g0229400|mRNA|AK120560|CDS+3'UTR	AATTTTCTGTGTCACCTTGCAAGCTTTTGCACTTTGTTGTAAATTGTATGGGGAAGTTTA	Os02g0229400	AK120560	Similar to Hexose transporter.
2415	29	35	Os05g0557200|mRNA|AK062090|CDS+3'UTR	GAGATGATGGATGTACCACCTGTGTTCCTGGTGCGCTAAACATGTCTTTGACGACCGAAG	Os05g0557200	AK062090	Armadillo-like helical domain containing protein.
2416	29	36	Os10g0371200|mRNA|AK107154|CDS+3'UTR	AATTTAGTTACTAAGAGACATTGAGAACCATCAGTGATAGTAACTTGGTTACTAAGAGAT	Os10g0371200	AK107154	Conserved hypothetical protein.
2417	29	37	Os01g0702500|mRNA|AY333185|CDS+3'UTR	CCAGAGTCAGATCTCTTTTAATTATCCTTTATAACGAGTCACGAGTGCTTTACGTTTCGC	Os01g0702500	AY333185	Similar to Dehydrin DHN1 (B8).
2418	29	38	Os07g0592200|mRNA|AK099740|CDS+3'UTR	AAGCACAGCAGCCATGGACGGAATGTTGTATTATCTAGTATCTGATAAGTGCTGAGGATA	Os07g0592200	AK099740	Peptidase A1, pepsin family protein.
2419	29	39	osa-miR167f|Os10|3'seq	TGATGATTTACAAAACCTAGAGACATGCATCAGATCATCTGGCAGTTTCATCTTCTCATG			miRNA
2420	29	40	Os02g0504700|COMBINER|CI424131|x	ACTGGCGACAATTTTCAGTCATAAATTTGCCAGTTGTAAGATACTTTGTGAGAAATGAGT	Os02g0504700	CI424131	Conserved hypothetical protein.
2421	29	41	Os02g0776400|COMBINER_EST|Os02g0776400|8	TGATGCAAAGCCTGTTAGCACTCCTATTACACCTCATTTTAAATTATCAGCTTTACAATG	Os02g0776400		Reverse transcriptase.
2422	29	42	Os01g0787600|mRNA|AK061058|CDS+3'UTR	TCCCACCAAATTTGTTTCGGGACTTCTCTTATATTCAGAGAATTGCAATAATGGTAAATG	Os01g0787600	AK061058	Similar to Salicylic acid-binding protein 2.
2423	29	43	Os11g0172800|COMBINER_EST|Os11g0172800|8	AGGAAAAAGAAATGGAGTGTCTACGTTCTGTGTTAAACATTGGACTTTGCTGCACAAAGC	Os11g0172800		Protein kinase-like domain containing protein.
2424	29	44	Os10g0197200|COMBINER_EST|Os10g0197200|8	CGCCGCCGACTGGATCCAGATCCAGATATGCATAAAAGTGATTCACAGCTTTAAGCTTAT	Os10g0197200		Similar to Transposase (Fragment).
2425	29	45	Os07g0685400|mRNA|AK107323|CDS+3'UTR	TTTTTGGACCCCCTATTTCTTTCAACAAGAGATAGATGAGCAGTGCGCATGCATGATCAG	Os07g0685400	AK107323	Conserved hypothetical protein.
2426	29	46	Os02g0205400|mRNA|AK101434|CDS+3'UTR	GGGGGGTGAAATTTTGTATGAGGCCTCCTAACTCCAATAGTCACTGCCAATATCTAATGC	Os02g0205400	AK101434	WD40-like domain containing protein.
2427	29	47	Os11g0303800|mRNA|AK068654|CDS+3'UTR	TTCACCTCGAGTTAACATCTATTCAGTTATCTAAACTTTGCTATGTAGTGAACTTGGTTG	Os11g0303800	AK068654	Conserved hypothetical protein.
2428	29	48	Os03g0701000|mRNA|AK100005|CDS+3'UTR	CTCTGCTTCACAGCAAGTGAAGTTGTAAAGCAATATGTTCATTTTACTAGGAATTAGTTG	Os03g0701000	AK100005	Armadillo-like helical domain containing protein.
2429	29	49	Os04g0206200|mRNA|AK067629|CDS+3'UTR	GTATATGACAATACGTCTCTGATTTGGATCTTGTAAACTTATTTGATTTGGGAAGGACTG	Os04g0206200	AK067629	Similar to Helicase-like protein [Oryza sativa (japonica cultivar-group)].
2430	29	50	Os03g0246900|COMBINER_EST|Os03g0246900|8	TCAGGCGCTCGCAAGGGAGCTCCTGGATCGCCACAGGTCCGCAGTGAAGCTCGAGCAGCC	Os03g0246900		Similar to LOB domain protein 16.
2431	29	51	Os04g0658100|mRNA|AK065495|CDS+3'UTR	TCCCTTGATGTGTTTGTCTGCTTGGGAGTGGGTAGATGTTTCCATCTTCACTCCAGATAT	Os04g0658100	AK065495	Histone-fold domain containing protein.
2432	29	52	Os06g0651200|mRNA|AK107748|CDS+3'UTR	CACGATTTTTCTACCTGTTCGTCTCTGTATGTAAGTAACGGAATGTCAGAATCTAGCTAC	Os06g0651200	AK107748	Conserved hypothetical protein.
2433	29	53	Os06g0708200|mRNA|AK068246|CDS+3'UTR	ACTGCTCTCTGAGACTGTTTCCTGCCTCGTGTAAACAAAATTCAGACATTGTTACGTCAA	Os06g0708200	AK068246	Hypothetical protein.
2434	29	54	Os03g0299700|mRNA|AK100929|CDS+3'UTR	CTCAGCGCGCCCGTCTCCACCGTCGGGATGTAGATGGGTATGAAGTCCATCAGCCGCATT	Os03g0299700	AK100929	Conserved hypothetical protein.
2435	29	55	Os01g0168100|mRNA|AK121992|CDS+3'UTR	TGGTACCCTATGGTGCGTGTATTGTAATCGAGGAACCGAGTCTGAACAAACTTCTTTTTT	Os01g0168100	AK121992	t-snare domain containing protein.
2436	29	56	Os03g0446100|COMBINER_EST|Os03g0446100|8	ATGAAGACCACCCCAAGGCTGCTGTTATCCCAGGACGATATCCGATCGTGGTCGAACCCA	Os03g0446100		Conserved hypothetical protein.
2437	29	57	Os01g0978100|mRNA|AK099217|CDS+3'UTR	AACAAATGTTTCGAAGAGCCGTGAAACATTATCAATTAGCATGAAGCACTTTAAAAGTGC	Os01g0978100	AK099217	Similar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C).
2438	29	58	Os04g0616900|mRNA|AK104906|CDS+3'UTR	TATCACTCCATATCCTTTAATAGACCGTCAGTGATGAATACTGCCACTCACAAAATTACT	Os04g0616900	AK104906	Conserved hypothetical protein.
2439	29	59	Os01g0850800|COMBINER_EST|AU162435|6	GTTCGAAGTTCGCCACTTTTTAAGATTTCAGTACTGAATAAAGGATGGGCTTCTGGAGCC	Os01g0850800	AU162435	Cupredoxin domain containing protein.
2440	29	60	Os08g0520100|mRNA|AK120052|CDS+3'UTR	TTCTGAACAATAATTACTGTACGTTGCAGCATTTTACTACTAATGAAATGCCACTGCTAG	Os08g0520100	AK120052	Pseudouridine synthase domain containing protein.
2441	29	61	POsControl0018|genome		
2442	29	62	Os11g0202300|mRNA|AK066860|CDS+3'UTR	CAGTGCTTGAGAGGATGCCATCATTAGTTGATGCATTTGTTGGAGTCCTCAACTGGACTA	Os11g0202300	AK066860	Conserved hypothetical protein.
2443	29	63	Os01g0589500|mRNA|AK061874|CDS+3'UTR	AGCTTTTGTATTTTCTATTTTTGTTGAAGCCTGATTGGAGAGAAATCAAGTTGTTCGTGG	Os01g0589500	AK061874	Conserved hypothetical protein.
2444	29	64	Os02g0728300|COMBINER_EST|CI406536|0	TCGGTCTTGCGACCATACTCCCCATACTGTATAGTATGTACGCAGTACTTAATGGAAAAA	Os02g0728300	CI406536	Longevity-assurance protein (LAG1) domain containing protein.
2445	29	65	Os03g0804300|mRNA|AK067295|CDS+3'UTR	GACGTACAGTTATTAGAGCATGACATGTTGATAAGATAACCTGTGTTAATTAGAGAACTG	Os03g0804300	AK067295	Zinc finger, DHHC-type domain containing protein.
2446	29	66	Os02g0260700|mRNA|AK061699|CDS+3'UTR	ATTGTGGAAGAAGCTTATGCTGCTCCAGTCGATTGTGAAAAGGTTACCATACCAGCTGAA	Os02g0260700	AK061699	Similar to GAMYB-binding protein (Fragment).
2447	29	67	Os04g0483000|mRNA|AK121996|CDS+3'UTR	CTCTAAAAGCTTAATTCCTGTCTGGAATTGACCTGATGTATGGTGATTTTTTACTGTTGC	Os04g0483000	AK121996	Ubiquitin domain containing protein.
2448	29	68	Os11g0592900|COMBINER_EST|Os11g0592900|8	GAGGGACGCGACCGTGCTGGAGTTCTACTCGCCCCGGTGCCGCCTGTGCTCGTCGCTGCA	Os11g0592900		Thioredoxin domain 2 containing protein.
2449	29	69	Os12g0118400|mRNA|AK111804|CDS+3'UTR	TACTAGTTCTCTGTAAGCCGTTAAATTTTATTTGCTAAAAATAATATCATTAAGTTAACA	Os12g0118400	AK111804	Similar to Inwardly rectifying potassium channel subunit.
2450	29	70	Os10g0534100|mRNA|AK101036|5'UTR+CDS	CGCCATGGCCATCATCATCATCTGTTCAATCCTTGTCACTTTGTGCTCCAGAAATGTCAT	Os10g0534100	AK101036	Conserved hypothetical protein.
2451	29	71	Os07g0255300|COMBINER_EST|CI207133|6	GTGTGTCAAGTGCTAAGCAATCACACTCTTGTTTTTTGGTCTGAAGTGATTATTTGGTTT	Os07g0255300	CI207133	Conserved hypothetical protein.
2452	29	72	Os03g0271900|mRNA|AK105994|CDS+3'UTR	TGTGCTTCACATCACTGCTGGCGTGTGTAGTAGTGTACGGAGTAGTTAAAGGGTGTGTTT	Os03g0271900	AK105994	Peptidase A1, pepsin family protein.
2453	29	73	Os11g0110100|mRNA|AK060105|CDS+3'UTR	AGCCTATCTGTACAAAACTGAAAGGTTTGATGCTTGTGAATGCACTACCTTGATGGGTAG	Os11g0110100	AK060105	Conserved hypothetical protein.
2454	29	74	Os08g0509400|mRNA|AK098938|CDS+3'UTR	TTGCCATGTGCATGGAAAATGATTGTGTTTTCTCATGGATATTGATTTGATTACTGGTAC	Os08g0509400	AK098938	Similar to Amygdalin hydrolase isoform AH I precursor (EC 3.2.1.117).
2455	29	75	Os11g0311100|mRNA|AK106180|CDS+3'UTR	GTGGTCAGTGACTTGTACTAGTGATGTATTATATCTGGTCAGTGAACCTGTGATGTAATT	Os11g0311100	AK106180	Conserved hypothetical protein.
2456	29	76	Os03g0390600|mRNA|D29713|5'UTR+CDS	ACCACTGGAGGAGTTAAGAAGCCCCACCGTTACCGCCCTGGAACTGTTGCCCTCCGTGAG	Os03g0390600	D29713	Similar to Histone H3.3.
2457	29	77	Os04g0465000|mRNA|AK102302|CDS+3'UTR	CCTTGGGAGCGTTGGCAATTGAGTTTACTGGAACATACTAGTGTTAAGATTGTGTACAGA	Os04g0465000	AK102302	Sterile alpha motif homology domain containing protein.
2458	29	78	Os07g0253000|mRNA|AK065968|CDS+3'UTR	GCTTTGCGTGTATGAAGACATATGTATGGAGTTTGTTTGGCAGAATGTGTGGTTTATATG	Os07g0253000	AK065968	Conserved hypothetical protein.
2459	29	79	Os09g0444200|mRNA|AK100079|CDS+3'UTR	ATTAAAATGTACAGATGTATTCATGGGAATTGTGTTACGATTTGAAGTTGAGTACTCCCC	Os09g0444200	AK100079	Lecithin:cholesterol acyltransferase family protein.
2460	29	80	Os09g0266000|mRNA|AK120937|CDS+3'UTR	TTCTCGTTATGTGCACTGTACTTTAGCTTATAAAAGAAATTGAAAGATTGAAGAATTTGG	Os09g0266000	AK120937	Nuclear transport factor 2 domain containing protein.
2461	29	81	Os03g0832800|mRNA|AK120398|CDS+3'UTR	GTTGTACTCATCCAAATGCTCATATCAAGTTATAATGAACTGCGAAATTCGATTGCTGCT	Os03g0832800	AK120398	Phospholipid/glycerol acyltransferase domain containing protein.
2462	29	82	Os04g0631100|mRNA|AK121883|CDS+3'UTR	TAATTTCTTCCTTTCTCATTCAGGAGCTAGTAATGAAAACGCTGAACCGATCAGCCTCCA	Os04g0631100	AK121883	Major facilitator superfamily protein.
2463	29	83	Os04g0692200|mRNA|AK059342|UTR	CAAAGTAGCTTGAACTAGGGACTCATATTAAGCTGCTTCTCTCCGATGAAGCTTGCAAAC	Os04g0692200	AK059342	Conserved hypothetical protein.
2464	29	84	Os06g0727200|mRNA|AK100019|CDS+3'UTR	TGAAAATATGCCTTGCTGTGTCTTGGGAAAGAGATAATAAAGACTGATACAGTGGGTGCT	Os06g0727200	AK100019	Catalase isozyme B (EC 1.11.1.6) (CAT-B).
2465	29	85	DarkCorner		
2466	30	1	DarkCorner		
2467	30	2	Os05g0370200|mRNA|AK070493|UTR	AATTGGAGGAGATGAAGAACTTCATCAAGACAATGCATAGCACTTATCATGCTATTAGGA	Os05g0370200	AK070493	Conserved hypothetical protein.
2468	30	3	Os02g0127200|COMBINER_EST|CI171805|6	TACTCTATCCGTACTAATAAAGAAAGTCGTTTAGGATAATGTTTAAGTCAAATCTTGGAA	Os02g0127200	CI171805	Similar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p47 subunit) (eIF3f).
2469	30	4	Os07g0162500|mRNA|AK106142|CDS+3'UTR	CATGGTGGCAGGCACTGTGTCCTTGCAACAATAATTGAGACAAGCTTAATTACTTCGTAC	Os07g0162500	AK106142	Esterase/lipase/thioesterase domain containing protein.
2470	30	5	Os07g0677900|mRNA|AK106293|CDS+3'UTR	ATTGCAGTCCTTTCTATAAATTTGCAACTATGCTTAACATGAGTGAGGCCACAAGATGAG	Os07g0677900	AK106293	Protein of unknown function DUF827, plant family protein.
2471	30	6	Os02g0821800|mRNA|AK071291|CDS+3'UTR	GCAATCCATGTGTACCGCGAACAGAGAAGTTGAAATTGGTTGAATCGACGCTACCGATTA	Os02g0821800	AK071291	Similar to Fibrillarin (Fragment).
2472	30	7	Os01g0718900|COMBINER_EST|CI416955|6	GATTTGTTGTGTTTGATATTTTGCATGCTTTATGTGGTTATGTTGAACTAGCATCCAAGC	Os01g0718900	CI416955	Conserved hypothetical protein.
2473	30	8	Os05g0475700|mRNA|AK105733|CDS+3'UTR	CCAGCGACTAACTTAGGAGATGATAACAAGGGACCAGAACCAGAAGTTTCTAGTACAGCA	Os05g0475700	AK105733	Nodulin-like domain containing protein.
2474	30	9	Os07g0224900|mRNA|AK099214|CDS+3'UTR	AACTATTATCGCCACTGAAATTTTGGCTGTCATCCAATCGATATACTCTGTTGTGCCGCG	Os07g0224900	AK099214	WD40-like domain containing protein.
2475	30	10	Os11g0544300|COMBINER_EST|CI527593|3	ATGATGGCGCTCTTGCAGATGATACTGAGATGGATGTAGGGGATCTAAGTGATTGTTGCA	Os11g0544300	CI527593	Protein of unknown function DUF860, plant family protein.
2476	30	11	Os08g0473600|mRNA|AK064300|CDS+3'UTR	ATTAACTAGCTACTGTTCGTTTCGATCCTCAAGAAAGACTTGCAAGATCTTGTCAGTTGA	Os08g0473600	AK064300	Alpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase).
2477	30	12	Os03g0824300|COMBINER_EST|Os03g0824300|8	AACACCACCAACTGCTGATGGGAATCAAACTCTGTCAAGTAAACATAATCAGGCAGGCAC	Os03g0824300		RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
2478	30	13	Os11g0415400|COMBINER|CI396069|6	CTTCATGGTTAATTATACTCTCTGGAACTTTCTCGGATTTTTCGGAGCTCAATTCCTAAT	Os11g0415400	CI396069	Conserved hypothetical protein.
2479	30	14	Os08g0140500|COMBINER_EST|CI191108|6	AAACATGTCATAAGTCATGTGTAGTACGGGTAAAAAGGAACAGGTGATTTGTTTGGCCTT	Os08g0140500	CI191108	Similar to Tryptophan decarboxylase (EC 4.1.1.28).
2480	30	15	Os04g0644400|mRNA|AK104623|CDS+3'UTR	TTGTACATGTAGTGGCTCCGGAAATTGTCATCAATTGTACTGTATGCATGTATTGTAAAA	Os04g0644400	AK104623	Similar to Proline-rich-like protein.
2481	30	16	Os07g0124100|mRNA|AJ276693|CDS+3'UTR	GGTTGGTTGGTTGATTTGAGAGTTGAGACAGATCGATCTCTGCTTGAATGGTACCTGTCC	Os07g0124100	AJ276693	Phytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)].
2482	30	17	Os11g0180600|COMBINER_EST|CI442593|4	ATGTATGTATGTGCATACATCCCGTACATATTTATACACCCTGTATCACACTAGTTTTCT	Os11g0180600	CI442593	"Type III restriction enzyme, res subunit family protein."
2483	30	18	Os03g0604200|COMBINER_EST|CI467129|3	TTTTTTACGTTAGATTTATATGTGATATCCATTGCACATTCAACCTTCTAGCGTCTTCCG	Os03g0604200	CI467129	Similar to UDP-glucose dehydrogenase.
2484	30	19	Os11g0516100|mRNA|AK072109|UTR	AATTCCTGTAAGATGGCATCGTTTGGCTTGTCATGCTACGTCTCTTTTAGCTTATATAAA	Os11g0516100	AK072109	Non-protein coding transcript, unclassifiable transcript.
2485	30	20	Os08g0129800|mRNA|D50573|UTR	GAAAAAGAAGAAGAAGCCGACGAGGAGGCGACCATGAGGGCCAAGTGGAAGAAGAAGCGC	Os08g0129800	D50573	Hypothetical protein.
2486	30	21	Os01g0263300|mRNA|AK061583|CDS+3'UTR	CGTTGCAAAACGTGTATGTTTAATAATTCAATATATAAAATGAGTTCATTTGGTTGTTCT	Os01g0263300	AK061583	Similar to Peroxidase 72 precursor (EC 1.11.1.7) (Atperox P72) (PRXR8) (ATP6a).
2487	30	22	Os03g0180100|mRNA|AK108326|CDS+3'UTR	GGGAAACAACATTCTGGAGGACAATGAGAGATTGAGAGCTAAGGTGGAAAAAAGAATTCC	Os03g0180100	AK108326	Protein of unknown function DUF1677, plant family protein.
2488	30	23	Os02g0194800|mRNA|AK058976|UTR	GTTTGATGTATTTCTCCAATTCTTTTCCCATTTGCTGTGGCGTCAGTCGTTGGGATGTCA	Os02g0194800	AK058976	Cyclase-associated protein domain containing protein.
2489	30	24	Os05g0582300|mRNA|AK101790|5'UTR+CDS	ATGATATTCTTGACTTTACCCAATCAGCTGAGCAACTTGGGAAACCAGCAGGGAGTGACT	Os05g0582300	AK101790	Solanesyl diphosphate synthase.
2490	30	25	Os07g0635500|mRNA|AK121733|CDS+3'UTR	CATTTTGTACGAAATTGGGGTGTAAATATATCTAGTTTGCTTGTTGATTGGATTTAAGAA	Os07g0635500	AK121733	Similar to Cytochrome P450.
2491	30	26	Os12g0545600|mRNA|AK060319|UTR	CTCCCTGGTCCAACCGCTTGTTCACCGGTTTAACCGTCGGTTCAATAAATAACTACATTA	Os12g0545600	AK060319	Non-protein coding transcript, putative npRNA.
2492	30	27	Os06g0235500|mRNA|AK121472|CDS+3'UTR	CCCTGTGGTCGTTCTCTCATCTTCTTATACCTTTAGCCGCCACAAAGAACAATTGGGTTT	Os06g0235500	AK121472	Hypothetical protein.
2493	30	28	Os06g0625900|mRNA|AK107132|CDS+3'UTR	GCCGTCACCATCCCTCACGCCTCCACCCTCGAGGTCGGCATGATTTACTATGTCTAATAC	Os06g0625900	AK107132	Potassium transporter 10 (OsHAK10).
2494	30	29	Os03g0122400|mRNA|AK059934|CDS+3'UTR	TTTCATAAACTTCTTCGGATAATTACTCAGTAGCATACCCTTCGAATGAATCATGACAAA	Os03g0122400	AK059934	Conserved hypothetical protein.
2495	30	30	Os10g0545500|COMBINER_EST|CI282137|6	TATGCAATGCGTCAGTTGTATCATAATGTGGTTGCAGTGACTTAAGTAGCACCATAAGAT	Os10g0545500	CI282137	Similar to Cellulase (EC 3.2.1.4) (Fragment).
2496	30	31	Os05g0157000|mRNA|AK109809|CDS+3'UTR	ACATAGACAGGGATGTGAGTGTGGTATTATCTGTGCACGTGTGTCTCCCGTGTAATTGTA	Os05g0157000	AK109809	Conserved hypothetical protein.
2497	30	32	Os09g0452900|mRNA|AK068378|CDS+3'UTR	TCTGAACTTCTTGTGGCGACCATTTTAAGTACATGCGGAGACCGAAAATATATGCTACAA	Os09g0452900	AK068378	Glycosyl transferase, family 31 protein.
2498	30	33	Os01g0615500|COMBINER_EST|Os01g0615500|8	GCTTCGTCGTCGGCTACAGGCTGCTCTGCTTCGTCTTCCTCTGGTTCAGATGCCACCGCA	Os01g0615500		ABC transporter related domain containing protein.
2499	30	34	Os09g0280800|COMBINER|CI481238|x	AAGCTTCGCCGGAGCACACACGACCTCAAATTATTGCATTGACAGTGAAGGAGTGAATTA	Os09g0280800	CI481238	(No Hit)
2500	30	35	Os06g0613100|COMBINER_EST|Os06g0613100|8	ATATCCCTTAGGGACAAAAATCGATTTCATCTACTTACACACGGAAACTGCACCTGTGGA	Os06g0613100		Protein prenyltransferase domain containing protein.
2501	30	36	Os04g0457800|mRNA|AK099777|CDS+3'UTR	GTAATTTTCAAGTAGGCTCTGCACTTGGTTGTCGTTAGAAATGCATGGGCGGGCGGAATT	Os04g0457800	AK099777	Similar to SERK1 (Fragment).
2502	30	37	Os12g0111500|mRNA|AK061388|CDS+3'UTR	AGTACATGCATATCTCTGGAATTAATGTGATCAATATATACAATTTAGATTCTTTGCACG	Os12g0111500	AK061388	BTB domain containing protein.
2503	30	38	Os03g0667500|mRNA|AK107681|CDS+3'UTR	GGTTGTTCAGGTTTTGTTCTTCGTGACTGATGATGTACTTCAATACGAGCATCTACATAT	Os03g0667500	AK107681	Similar to Metal transport protein.
2504	30	39	Os01g0880300|mRNA|AK101962|CDS+3'UTR	GTGCAAACGCATTGTGCCGTGCATAATGTTTAATGAAAGGGTGGCCAAAGCCTTTTCCTT	Os01g0880300	AK101962	Similar to Pectin methylesterase-like protein.
2505	30	40	Os01g0885200|mRNA|AK059113|CDS+3'UTR	CCTTTTCTTCTTCCTCTTTCTTCCTCTTACTACCTTAATGATAACAGTTTTGTGGCAATC	Os01g0885200	AK059113	Conserved hypothetical protein.
2506	30	41	Os03g0576700|mRNA|AY323130|CDS+3'UTR	TCATCATACCCCTTCTGTTTGATATCTGGTACTGATTTGCATGCTCTGCTATCGAATGAA	Os03g0576700	AY323130	Similar to 60S ribosomal protein L13 (BBC1 protein homolog).
2507	30	42	Os08g0437300|COMBINER_EST|Os08g0437300|8	GGACCCCTCGCCGCCGGCCAAGCCGCTGGACTCGTCGTCGGGCGCCACGGCGCCGCCGTC	Os08g0437300		Conserved hypothetical protein.
2508	30	43	Os01g0963000|mRNA|AK061131|CDS+3'UTR	ACACTTGCGTGTATTTTGTAGCTTATTTTTTATTTGCAAATAAAGTTGAATATATGAAAA	Os01g0963000	AK061131	Similar to Peroxidase BP 1 precursor.
2509	30	44	Os01g0295700|mRNA|AK070333|CDS+3'UTR	TTATCGGGTTCACCCGTTCATGTATTGTTACCGTGCCCCCTCAGTGAAAATTTGCAGTAC	Os01g0295700	AK070333	Similar to Protein phosphatase-2C.
2510	30	45	Os08g0417000|mRNA|AK068735|CDS+3'UTR	GTCTTTATGGGTTGTTTGAATGTTTGTTCTCTTACGTTTCTGAAAAATTCAACGGCTTCA	Os08g0417000	AK068735	2OG-Fe(II) oxygenase domain containing protein.
2511	30	46	Os04g0606800|mRNA|AK072824|CDS+3'UTR	TTGTTTCTAATGCGGCATGAGTATATGACTTGCTGGGAGTTACCACTTTCACTATCTAGA	Os04g0606800	AK072824	Conserved hypothetical protein.
2512	30	47	POsControl0026|random		
2513	30	48	Os07g0492000|mRNA|D10431|5'UTR+CDS	TGAATGTGGAGAGGTCCTTTGCACAGCAGCACTATGCCGACCTTTCCGACAAGCCCTTCT	Os07g0492000	D10431	Nucleoside diphosphate kinase I (EC 2.7.4.6) (NDK I) (NDP kinase I) (NDPK I).
2514	30	49	Os02g0508500|mRNA|AK062558|CDS+3'UTR	TAATGCCATACCATATGGCCTTTTGCTACAACTATGTTTCAGTGCCAGACCTGAATTGGC	Os02g0508500	AK062558	Conserved hypothetical protein.
2515	30	50	Os05g0204900|mRNA|AK102966|CDS+3'UTR	ACAGATCTGGTGGTGTAAGCAGGAATGCAATTTTTCTATATACTGCCATGGCACTCTGTT	Os05g0204900	AK102966	Similar to Type 5 protein serine/threonine phosphatase 62 kDa isoform.
2516	30	51	Os09g0504000|mRNA|AK068607|CDS+3'UTR	GATCAAAAACACTTGGAAGCCAGGACAGAAAGAAAGATGAAGTCACTGGCTTCCTTCGAA	Os09g0504000	AK068607	Similar to Nucleotide sugar epimerase-like protein (UDP-D-glucuronate 4- epimerase) (EC 5.1.3.6).
2517	30	52	Os01g0142800|mRNA|AK070036|CDS+3'UTR	TCTCATAAGTTCATTAGGTTGCAGAAATGCCATTGTTCAGCAGTCAGAAAGACAGCGATT	Os01g0142800	AK070036	Similar to Peptide transporter.
2518	30	53	Os05g0554000|mRNA|AK073902|CDS+3'UTR	CAACACGCATCTATCAGCGATGTCGTCTTAAGTGTGGACTCCACTTCACTAAGTATTGCT	Os05g0554000	AK073902	Conserved hypothetical protein.
2519	30	54	Os02g0610800|mRNA|AK099736|CDS+3'UTR	GTAACAAAATTTTCAATACAAGATCCCTTCCATCTGTACTACACACTGGTGTACTAAGGA	Os02g0610800	AK099736	Protein of unknown function DUF1092 family protein.
2520	30	55	Os02g0292600|mRNA|AK106688|CDS+3'UTR	AATAAGTTGATCGATAAGAAGAATAAACCCAACTATATATAATCGACGTTTTTGTTTCAG	Os02g0292600	AK106688	Lipolytic enzyme, G-D-S-L family protein.
2521	30	56	Os05g0414300|mRNA|AK120513|CDS+3'UTR	AAAGAATGATGATTTGAGACTACATTTTTGTTGCATGTTGCTGTAATGGATTGTGCACTC	Os05g0414300	AK120513	Disease resistance protein family protein.
2522	30	57	osa-miR395f|Os04|5'seq	TTATCGCGGGTTCCCTTCAATCACTTCACATGGTACTATTTCAAGGCCTACTATGTGAAT			miRNA
2523	30	58	osa-miR164a|Os07|3'seq	GTGGGTTGGAAGTTTAGATAGAACTCGCACTGCACGTGGTCTCCTTCTCCATCCCGGTCT			miRNA
2524	30	59	Os03g0167700|mRNA|AK069884|CDS+3'UTR	CTGTTCTAGACATGTACTTGATCAAAGCCAAAAACTTGGTCAACCGATGTTCTCTCTGCT	Os03g0167700	AK069884	Similar to Serine/threonine protein phosphatase PP2A-3 catalytic subunit (EC 3.1.3.16).
2525	30	60	Os10g0208500|mRNA|AK065698|CDS+3'UTR	GGAGTCCGGGTATAGCTCTAATAGCTTTCCTTTCCTCTTTGGTAAGCTTTGTACTTTATT	Os10g0208500	AK065698	Conserved hypothetical protein.
2526	30	61	Os04g0523100|mRNA|AK119597|CDS+3'UTR	GTTAGTTAATAATAAGTACTAGCTAGCTAGCTAGCTATTAGCTAAGCTTAGCAAAAGAGG	Os04g0523100	AK119597	Homeodomain-like containing protein.
2527	30	62	Os10g0469100|mRNA|AK066147|CDS+3'UTR	GTCTCCGGCTATGCCTTTTCGGGTCCCTCTTTCAAATATGAATATATGATGGTGCCAATA	Os10g0469100	AK066147	Conserved hypothetical protein.
2528	30	63	Os01g0877600|mRNA|AK061259|UTR	TATCACTGGTCAGAAAGACAAGATTCCATGAAGGTTCACACAGGCCTCAGGTGCATTATG	Os01g0877600	AK061259	Conserved hypothetical protein.
2529	30	64	Os10g0579400|mRNA|AK108346|CDS+3'UTR	TGCTTAATTACTTGTTACAGAGCACGCCACAATTGTTAGTTAAAATGTTACTCCCTCCCG	Os10g0579400	AK108346	Similar to WRKY transcription factor 66.
2530	30	65	POsControl0003|genome		
2531	30	66	Os01g0301300|mRNA|AK107188|CDS+3'UTR	CACTCCAGAGCATGCTAATCTGACAATTTGTTTTGAACGGCAACAAAAGCTTTGCCATTT	Os01g0301300	AK107188	Hypothetical protein.
2532	30	67	Os09g0380200|mRNA|AK058363|CDS+3'UTR	GCAACTACTGACATCTCCACTATGGGTCTCGGAAAAGTTTTGTAGAATGACATCACTTTG	Os09g0380200	AK058363	Conserved hypothetical protein.
2533	30	68	Os08g0128400|COMBINER_EST|Os08g0128400|8	AGCCGTGTGGACCAGGCACACTTTTAAGGTTACACACAAAGGGGGCACTTTTGGGGCGCT	Os08g0128400		Hypothetical protein.
2534	30	69	Os07g0681500|mRNA|AK121650|CDS+3'UTR	GTAGCTGTATCTCAACATATGCTTATTTTCGACAAAATTTAAACCAAGGTAGCATCAGTC	Os07g0681500	AK121650	Ankyrin repeat containing protein.
2535	30	70	Os07g0574600|COMBINER_EST|Os07g0574600|8	CACTATGTTTGTGCTTTCATCAAATGGATCTTTCGAAAAAGAAAATCAAGAACTACCTGC	Os07g0574600		Conserved hypothetical protein.
2536	30	71	Os01g0191300|mRNA|AK106152|CDS+3'UTR	GATCTGCCTCCATGAAAAAAGGGAGATCAAATTAACTGTGCAAGGACACTCCAAGATAGA	Os01g0191300	AK106152	No apical meristem (NAM) protein domain containing protein.
2537	30	72	Os06g0545800|COMBINER_EST|CI357759|0	GGTCGAGTACTCTGGCACAAACAACAAGACCATGGCCGTCTGCAAGAATGCCAAGGGCAC	Os06g0545800	CI357759	Similar to Exopolygalacturonase precursor (EC 3.2.1.67) (ExoPG) (Pectinase) (Galacturan 1,4-alpha-galacturonidase).
2538	30	73	Os09g0338400|mRNA|AK072043|CDS+3'UTR	CCCTTTAAGATACTAATTGGAGTTACTGGCATAATGCTGTTACTATATATTTTGGTGCTC	Os09g0338400	AK072043	Similar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1).
2539	30	74	Os01g0654200|mRNA|AK100750|CDS+3'UTR	GGGTATGCACCTCACTGTTGTAAGTTAAAACGGGAATATCAAATTTCAATTGATCTCAAC	Os01g0654200	AK100750	Peptidase M50 family protein.
2540	30	75	Os12g0612100|mRNA|AK101614|CDS+3'UTR	ATGGTAATTGAACCTATGTCTGAACATTTGGATTGATCAATGGAGCATGCTGTTCTTATG	Os12g0612100	AK101614	Conserved hypothetical protein.
2541	30	76	Os02g0179100|mRNA|AK058557|CDS+3'UTR	GGGATGCTGATTCACTAGGAAAGCCTTATTGGCCGTCCTCGTTGTTGTGATGTAAAATCA	Os02g0179100	AK058557	Metal-dependent phosphohydrolase, HD region domain containing protein.
2542	30	77	Os05g0593900|mRNA|AK058553|CDS+3'UTR	TAACAATGATCGATGTAATGTGCATCACCAAATCAAATATATGTCATCATACTACTGCCT	Os05g0593900	AK058553	Similar to C13 endopeptidase NP1 precursor.
2543	30	78	Os02g0587600|COMBINER_EST|Os02g0587600|8	AAACCCGGCCCAGCAGGGACAGAACCCTGCTCAGCAGGGACCAAACCCGGCGCAGCAGGG	Os02g0587600		Conserved hypothetical protein.
2544	30	79	Os01g0866100|mRNA|AK068991|CDS+3'UTR	ACTTATTTTTGTGTACGTAGTAAAGGTTTATTTGTATTTGAACGACTTGTAGTGTTTTGG	Os01g0866100	AK068991	Similar to Actin 4.
2545	30	80	Os02g0512300|mRNA|AK073819|CDS+3'UTR	TGACCTTGGGAACAATGATACAAACGAAGATACAGAAGCCGATGAGGAGTTCAGCATCGA	Os02g0512300	AK073819	Conserved hypothetical protein.
2546	30	81	Os07g0669500|mRNA|AK105365|CDS+3'UTR	TATTGCATGGCACAGCTTGTTAATTTCTTCTAGCATCTTAATCAATTAATCCATGACCTG	Os07g0669500	AK105365	Similar to Branched silkless1.
2547	30	82	Os02g0328600|mRNA|AK103347|CDS+3'UTR	TGCTGTTACAGAACAGGAGCTGACGGTACCTTACGTACTGTCTTTGGTTGTTTTGCTTGT	Os02g0328600	AK103347	Conserved hypothetical protein.
2548	30	83	Os02g0656300|mRNA|AK070096|CDS+3'UTR	TTGGAAGACTTGCCTTGTCTGGATTCCAGTTCTCATATTCTTGCTTGTTAAAATAATTGT	Os02g0656300	AK070096	Similar to Anaphase-promoting complex subunit 8-like protein.
2549	30	84	DarkCorner		
2550	30	85	DarkCorner		
2551	31	1	DarkCorner		
2552	31	2	Os11g0160700|mRNA|AK073141|CDS+3'UTR	CGCTCAGGAAGTAGTCACTGAAAAGGTACCAGTTGTTCAGAATTCTGATGTTGCACCCAT	Os11g0160700	AK073141	Zinc finger, FYVE/PHD-type domain containing protein.
2553	31	3	Os03g0240800|mRNA|AK121552|CDS+3'UTR	CTGGCAACTTCCTGAATCGGATGCTTCTTATAAGTTATTATAACGCACTTTGTATCTTCA	Os03g0240800	AK121552	Similar to AGL157Cp.
2554	31	4	Os07g0119800|COMBINER_EST|Os07g0119800|8	GTCACCTTCAAGACGGGAACCGGGCTGTCTGATACCTTCGACGCCACTGCATTTGCTCTT	Os07g0119800		Protein of unknown function DUF538 family protein.
2555	31	5	POsControl0033|random		
2556	31	6	Os05g0367000|mRNA|AK103509|CDS+3'UTR	TAGGTACCTGATGTTAATGACTATGATTGTTGACATGAAATGCGAACTGAGATATGGAGT	Os05g0367000	AK103509	Similar to PHD finger-like domain protein 5A (Splicing factor 3B associated 14 kDa protein) (SF3b14b).
2557	31	7	Os07g0684000|mRNA|Y08988|CDS+3'UTR	ATCGTGTGGTGTGCTTGTATCTTGTACAAGTTAATTAATTACCTGGCAATAAGAGCTCCT	Os07g0684000	Y08988	Ricin B-related lectin domain containing protein.
2558	31	8	Os01g0901800|mRNA|AK070266|CDS+3'UTR	ACTTCATTATTCTGGTGAAATCTAAAATGTGAGTATGTCAGTGATGGTTGTTGATCTACC	Os01g0901800	AK070266	Acid phosphatase/vanadium-dependent haloperoxidase related family protein.
2559	31	9	Os10g0493100|mRNA|AK063145|CDS+3'UTR	CAACTTTTATTCAGGAACAAGATTGGATTGTATAAAATGGTTTCGATCTGATTATCTTAT	Os10g0493100	AK063145	Pentatricopeptide repeat containing protein.
2560	31	10	Os01g0891300|mRNA|AK063674|CDS+3'UTR	AGGTGATAAGTAATAGATGTTTGTCTTAACATGTTCAAATTATACCTGGGAAAAAAGTTC	Os01g0891300	AK063674	Similar to Allyl alcohol dehydrogenase.
2561	31	11	Os05g0283100|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os05g0283100	CI274096	(No Hit)
2562	31	12	Os03g0288300|mRNA|AK100369|CDS+3'UTR	ACAGCACTCATCTGTGCAGGGACAGCCAGTGTTCTTGGTCGCTAACTAACATAAGAATAT	Os03g0288300	AK100369	Esterase/lipase/thioesterase domain containing protein.
2563	31	13	Os02g0791800|mRNA|AK066282|CDS+3'UTR	ACTGACAGACTTTGCCCTGAGTGGTTACAATGAAATGAACCAGCATACTGCCATACTGAC	Os02g0791800	AK066282	WD-40 repeat containing protein.
2564	31	14	Os11g0427500|mRNA|AK062510|CDS+3'UTR	CAATGCATTGAGAGACTCAATTGCTCAAGAGATGTGGGTCCAGTATCAGCAGCATGTACA	Os11g0427500	AK062510	Similar to Transposase (Fragment).
2565	31	15	Os02g0546600|mRNA|AK107852|CDS+3'UTR	AATCGTCGTCCCGGGTACTCCTAGTCCACAGAACTTGAATTAGACTCGCATTTCGTTTTT	Os02g0546600	AK107852	Similar to AP2 domain containing protein RAP2.2 (Fragment).
2566	31	16	Os01g0785700|mRNA|AY129829|CDS+3'UTR	ATAGTATACTAGTCTGCTGTTGCGGACATTGGAAGTATCTCATATTGTCACAAATGAGAT	Os01g0785700	AY129829	Protein prenyltransferase domain containing protein.
2567	31	17	Os02g0736200|mRNA|AK101440|5'UTR+CDS	CAAGGCCGCATCCTAATGAGTGTTCAGGGAGTGATCTTGACGGGGACATATATTTTGTTT	Os02g0736200	AK101440	Similar to RNA-directed RNA polymerase (EC 2.7.7.48).
2568	31	18	Os05g0378900|mRNA|AK058213|CDS+3'UTR	TCACTTGCCAGTTGTATGTATGATCTTTGGTGCTAAATCACCCGAAATGAAGGAATTTTA	Os05g0378900	AK058213	Conserved hypothetical protein.
2569	31	19	Os01g0685900|mRNA|AK064024|CDS+3'UTR	CAGTAAAACAGCTCTATACATTAGCTTGCTCACTACTCAGTACAGCTTTCTCGGCAGCAC	Os01g0685900	AK064024	Similar to 65kD microtubule associated protein.
2570	31	20	Os03g0334500|mRNA|AK066465|UTR	AAGGATTGTAGTCTAGATGCTGTAAGTTTGGACCGCATTTTTGGTCAAATTGCAAGGAAA	Os03g0334500	AK066465	Non-protein coding transcript, unclassifiable transcript.
2571	31	21	Os02g0754500|mRNA|AK105696|CDS+3'UTR	GGCCAGGCGATGACGGAAGAAACATTTGGTTAGATATATTTTGTACAAAATCATGTCATA	Os02g0754500	AK105696	Amidase family protein.
2572	31	22	Os06g0129700|COMBINER_EST|AU029348|6	TGCATTTTGATGTAGAATATGAGAAATTAATAAAGCGTATGTAAACACCGTCAGTCACGC	Os06g0129700	AU029348	NUDIX hydrolase domain containing protein.
2573	31	23	Os03g0288600|mRNA|AK065540|CDS+3'UTR	GCCATTTGAGCCATCTGAGAGATTTTCTAAGGCCTCGCATGGAATGGGAAGCAATTCAAT	Os03g0288600	AK065540	Muscle derived-like protein.
2574	31	24	osa-miR169i|Os08|3'seq	TCATTCAGAAAATGAGCCTTGAACTGGTTCATAGGCAGTCTCCTTGGCTAGTCTGAGTCG			miRNA
2575	31	25	Os02g0270900|COMBINER_EST|Os02g0270900|8	TACTGAGCAAAGTCCGGAATATTGTCGTCTTCCACTTCATCTTCTTCCATTTCAACACCT	Os02g0270900		"Peptidase S8 and S53, subtilisin, kexin, sedolisin domain containing protein."
2576	31	26	Os01g0736600|mRNA|AK099546|CDS+3'UTR	CATGTCTTGAGTAAGGAATAGTTGTACATACATTGTGTTTGTTTCTGTGGCAGAGTTCCT	Os01g0736600	AK099546	Zinc finger, RING-type domain containing protein.
2577	31	27	Os01g0275300|mRNA|AK058411|UTR	CTGTAGTATGATGGATGTACTACTATTTTGAGTTGTGCTCGCATGGTTGAATTTTGATGT	Os01g0275300	AK058411	Non-protein coding transcript, putative npRNA.
2578	31	28	Os02g0770600|mRNA|AK066977|CDS+3'UTR	TTCCAGTTTTTCAGAAGCTCTGCTAAATATTAATCCAGTGGGGATCGATTTTAGATCTCA	Os02g0770600	AK066977	Protein of unknown function DUF1644 family protein.
2579	31	29	Os01g0252100|mRNA|AK068737|CDS+3'UTR	ATCCTCCTCGTCGATTTTCTTGGTTCTTTGTGCCCTAGACTGCTACCTGGTTTTTAGACT	Os01g0252100	AK068737	Similar to Glycogen synthase kinase-3 homolog MsK-3 (EC 2.7.1.-).
2580	31	30	Os07g0627100|mRNA|AK119510|CDS+3'UTR	CCGTTTCACTGTCAAACTCTATCTACCGAGTGTGGTTTTATTTATTTATTTACTACTTCG	Os07g0627100	AK119510	Conserved hypothetical protein.
2581	31	31	Os01g0750100|mRNA|AK067329|CDS+3'UTR	CAATTTCCCTTTTTTTTTTTTGCTTTTCTTTAGTTCTCCTTGGAGTAATTTGGATTGGAG	Os01g0750100	AK067329	Similar to WRKY transcription factor-like (WRKY transcription factor 13) (WRKY13).
2582	31	32	Os02g0582200|mRNA|AK068936|CDS+3'UTR	GTCATTCTTTCTCCAAACTACTTAAGACGCATTAAGCATTCATTTAGAATGCAACAATGG	Os02g0582200	AK068936	Conserved hypothetical protein.
2583	31	33	Os05g0121700|mRNA|AK107571|CDS+3'UTR	CAGGTGACAGAATCTTAAGCATTCTAACATAGTGCCACGTAAAGGAGAAGATCTAGTTGC	Os05g0121700	AK107571	RecA bacterial DNA recombination family protein.
2584	31	34	Os09g0416800|mRNA|AK099984|CDS+3'UTR	GAGACCTCCTCTGCTGCTCACTAAGTAATGGATAGTTAAATAAAGGATGAACTATGTTTG	Os09g0416800	AK099984	Similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1).
2585	31	35	Os03g0393700|mRNA|AK101332|CDS+3'UTR	CAGAAGGCAAACAGATATACCTCACTCTCAATTAGCAGAGTGACATTGTACCGTTTCTTC	Os03g0393700	AK101332	Peptidase S10, serine carboxypeptidase family protein.
2586	31	36	Os02g0813300|mRNA|AK060823|CDS+3'UTR	CGGGCAAACTGAACTTTCTGCCGAGAAGAAAATACCATAGTGCGATGCTTGATAATAGCC	Os02g0813300	AK060823	Cyclin-like F-box domain containing protein.
2587	31	37	POsControl0026|random		
2588	31	38	Os02g0829200|mRNA|AK070520|CDS+3'UTR	TGTGCAACCATCCACGCACATGATTTAATTTGTGTGAATGGGAAATTTGGAGTTGCGTTC	Os02g0829200	AK070520	C2 calcium/lipid-binding region, CaLB domain containing protein.
2589	31	39	Os03g0643500|COMBINER|CI189628|6	CGACTGCCAAAGATGCCAGGAGAGAGAAGGAAGAAGAGGAAGCCTCCTCCCACGCAGCGC	Os03g0643500	CI189628	(No Hit)
2590	31	40	Os03g0687000|mRNA|AK065253|CDS+3'UTR	CCTAGTAAATCGCTACTTGCTGTTTGACTGATTCACAAGGAAGTAAATGAAATAGTTTTG	Os03g0687000	AK065253	Conserved hypothetical protein.
2591	31	41	Os04g0532200|mRNA|AK110853|CDS+3'UTR	ACAAAGACCAAGAAATTTTCTGGTTTGGATCACTCAATAAATTTAATGCATGTAACCGAT	Os04g0532200	AK110853	Conserved hypothetical protein.
2592	31	42	Os05g0156800|mRNA|AK119449|CDS+3'UTR	AATACCAAGCTGAGAACCAACATGCCATTTGGTGCTGCACTATAGACAAAAAGGAGAGGG	Os05g0156800	AK119449	Protein of unknown function DUF625 domain containing protein.
2593	31	43	Os12g0112000|mRNA|AK069456|CDS+3'UTR	AGTGCAAACGCACATTGTGTCGTGTTTCTTGCGGATATGTTTGCAACATCTCCCTTAATT	Os12g0112000	AK069456	Similar to Peroxidase precursor (EC 1.11.1.7) (Fragment).
2594	31	44	Os02g0160400|mRNA|AK070615|CDS+3'UTR	AGGGGTGCAGCATGGGTTCACTCATTGATTAGTTGGTAATTAAACTTGTTGCCGATTCTG	Os02g0160400	AK070615	Similar to Monosaccharide transporter 3.
2595	31	45	Os10g0547900|COMBINER_EST|Os10g0547900|8	TTCTTAGGAAAATGGAAAAAGAATGAGATAAGGATCGGAATTCCCTCAATCGGATTTCAT	Os10g0547900		Short-chain dehydrogenase Tic32.
2596	31	46	Os03g0235900|mRNA|AK066920|CDS+3'UTR	CAATTGTGTTGCAAAAGCATGCACCCGTTTTCATATATAAAAGTAAGAAAATCTTGCTGC	Os03g0235900	AK066920	Nitrate transporter.
2597	31	47	Os09g0375900|mRNA|AK121433|CDS+3'UTR	AACACAGCACTGTTAATCGAGCGAATGGGTAAAATACATACACAGTGCAGACCTGTGGCT	Os09g0375900	AK121433	Hypoxia induced protein conserved region family protein.
2598	31	48	Os01g0958100|mRNA|AK058574|CDS+3'UTR	ATATATATTTGCTAACATGCTAGGAAATTAGAAGCAAAATTTTGGACCATCACAGTTTTG	Os01g0958100	AK058574	Similar to Chloroplast SRP receptor cpFtsY precursor.
2599	31	49	Os01g0200400|mRNA|AK070272|CDS+3'UTR	TGCAATGATATGCCAACTATGTTTTCCACTGCAGTTAGTGATCAATTCAGACACCATTCG	Os01g0200400	AK070272	Thioredoxin domain 2 containing protein.
2600	31	50	Os05g0540000|mRNA|AK100416|CDS+3'UTR	CATGATCTGTTCAAAGTGGATGATTCTCTGTAGCTTTTGATGAACATGTTAAAATAGCCA	Os05g0540000	AK100416	Conserved hypothetical protein.
2601	31	51	Os08g0472600|mRNA|AJ582955|CDS	CGCAGATCTTGACAAATACATTAAAGATCATCCATGTGCAAAGCTTGAAGTGATTTTTGT	Os08g0472600	AJ582955	Similar to Alpha1,3-fucosyltransferase (Fragment).
2602	31	52	Os02g0702300|mRNA|AK100068|CDS+3'UTR	GAGGTTCTCCTACAGGTGTAGATCTGCGGAGGTAATTAAATGGGAGTCTTTCGAGACCCC	Os02g0702300	AK100068	Conserved hypothetical protein.
2603	31	53	Os07g0167100|mRNA|AK063292|CDS+3'UTR	AGGAAGCGTCCATAAACCACACACAGCCACACAGGCGTGAGTATGCTAAGATATCAAAAT	Os07g0167100	AK063292	Similar to Yarrowia lipolytica chromosome A of strain CLIB99 of Yarrowia lipolytica.
2604	31	54	Os01g0355400|mRNA|AK064594|CDS+3'UTR	AAATTGTTACTACTATTGTGCTAAACATGATGCTGGAATATGGATCAGGTTCTGGTCACA	Os01g0355400	AK064594	Conserved hypothetical protein.
2605	31	55	Os07g0175900|mRNA|AK067194|CDS+3'UTR	AGAAGCTTGCACAGTTACAATCATGTGTATAACCTTTTTATTTTGGTGCCTGAACAGTCA	Os07g0175900	AK067194	Similar to Inositol-1, 4, 5-trisphosphate 5-Phosphatase-like protein.
2606	31	56	Os05g0230600|mRNA|AK070398|CDS+3'UTR	GTCCATAGAACATCAATCTCTTGTAACTTATTTCAACTTGGCATGTTCCATCATTATACC	Os05g0230600	AK070398	Protein of unknown function DUF1620 domain containing protein.
2607	31	57	Os06g0728200|COMBINER_EST|Os06g0728200|8	AACGCAACTGAAACCGAGGAGAGCTATACTGAGATGGCGTACATAAAGCAAGTCCTCATT	Os06g0728200		Conserved hypothetical protein.
2608	31	58	Os08g0400300|mRNA|AK067617|CDS+3'UTR	ATCTCCAGGTTGATGTATGTGTTTTTGGGACGGAGGGAGTATCTCCACCTGTACCTATTA	Os08g0400300	AK067617	Conserved hypothetical protein.
2609	31	59	Os06g0133000|mRNA|AF515483|CDS+3'UTR	GATGAGAGACGAATGAACCAGTGGTTTGTTTGTTGTAGTGAATTTGTAGCTATAGCCAAT	Os06g0133000	AF515483	Granule-bound starch synthase I, chloroplast precursor (EC 2.4.1.21).
2610	31	60	Os03g0262200|COMBINER_EST|CI528217|0	GTACGGGTATTCCAAAGGAAAAGCTACGATTGGTTGGTTGTTGTTCTCCAGTTGGCAGTT	Os03g0262200	CI528217	Protein kinase domain containing protein.
2611	31	61	Os05g0481000|mRNA|AK068619|CDS+3'UTR	TGTAGATTTCTACAAGAACTTGGGATTCGAAGCTGACCCTCAAGGCATCAAGGGCATGTT	Os05g0481000	AK068619	GCN5-related N-acetyltransferase domain containing protein.
2612	31	62	Os10g0167300|mRNA|D17767|5'UTR+CDS	CTTGCCATGCAGGCATTCATGATCCTTCCTACTGGGGCCGCTTCATTCAAGGAGGCCATG	Os10g0167300	D17767	Similar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
2613	31	63	Os07g0495200|mRNA|AK070990|CDS+3'UTR	TGCATGGATTTTTGTAATAGTGAATATTTTTCTCCGAGCCTACAAAGTCGAAGTTTTCTG	Os07g0495200	AK070990	Similar to ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).
2614	31	64	Os10g0516000|COMBINER|CI269608|6	ATTATATCCGGGACATACTTTGTGATGATGTTGCTTAATCAATGAATGGCATGCCGCCCT	Os10g0516000	CI269608	(No Hit)
2615	31	65	Os08g0544800|mRNA|AK119660|CDS+3'UTR	AGCATGCAAATGAGCAGTTGACAATTTGACATAAGATTAAGTCTAATCCAGTACTACTTG	Os08g0544800	AK119660	PCF2.
2616	31	66	Os08g0104600|mRNA|AK119206|CDS+3'UTR	CGAGGGTTAATTGTTGTTGTTTAATTAATGTACGTTTTGCTGCACCTGCTTAATCATATC	Os08g0104600	AK119206	Ferredoxin I, chloroplast precursor (Anti-disease protein 1).
2617	31	67	Os12g0194800|mRNA|AK107780|CDS+3'UTR	AGGATGAAAGTCCATGAGAATATGAAGCATGTATACTCGTCTTTTGCTGGTCTAACTGAA	Os12g0194800	AK107780	tRNA pseudouridine synthase family protein.
2618	31	68	Os07g0479300|mRNA|D17587|CDS+3'UTR	TGGCTTGTGCTATGGATGGTATAATCTGTGCTCCAAACTATACAGTAAATATTTTTGCGG	Os07g0479300	D17587	Peptidase S10, serine carboxypeptidase family protein.
2619	31	69	Os04g0665400|mRNA|AK105869|CDS+3'UTR	CAGTTACACATAGTGATTAGCTTCACTTTTATTGTATGTATCATCTAGATGAGGTTGAGG	Os04g0665400	AK105869	Similar to FtsZ1.
2620	31	70	Os06g0223000|COMBINER_EST|Os06g0223000|8	CGCAGGAACCGAGGACAACTCGCCGTCGAAATGCTTGCTGCTGGCTGTTCTTGGATTGTT	Os06g0223000		Syntaxin, N-terminal domain containing protein.
2621	31	71	Os09g0539200|mRNA|AK119414|CDS+3'UTR	AACCATCACAGGTTGACAGACAGTTTGTAGTTCAGTTTGTTTAGATATATTGACAGTTTG	Os09g0539200	AK119414	Similar to Relative to SR12 protein (Fragment).
2622	31	72	Os02g0773400|mRNA|AK100497|CDS+3'UTR	CTACATCTCATGTATATAATGACGGCTAGTTTTTCACTAATAACTGTTTCATTCTTGGCC	Os02g0773400	AK100497	Ion transport domain containing protein.
2623	31	73	Os10g0432300|mRNA|AK111369|CDS+3'UTR	GGGTTGGGGGAAACCTGCGGGTTCTTGATCTGATACGATCTTGCATTGGTTTGGAGGAGT	Os10g0432300	AK111369	Similar to Transcription factor IID, TFIID (Fragment).
2624	31	74	Os07g0154300|mRNA|AK122093|CDS+3'UTR	AATTTCTGTGAGATGAGATGTTATCTTGGCAATCTATAATACAGTTATGATTCAGAGTTT	Os07g0154300	AK122093	Conserved hypothetical protein.
2625	31	75	Os12g0482700|mRNA|AK060431|CDS+3'UTR	GAATAGACAAACAGCCAAACATGGATGCTGATAATAATGGAATAAGTTGTGCCCATGCAC	Os12g0482700	AK060431	Similar to L-galactose dehydrogenase.
2626	31	76	Os02g0489500|mRNA|AK105149|CDS+3'UTR	CCGGAAAACAACTGAAAAGCTAATGTTAGCAAAGCGACCCAGTGAAATCGGTGGTTCTGT	Os02g0489500	AK105149	Conserved hypothetical protein.
2627	31	77	Os01g0227800|COMBINER_EST|CI407819|6	CCTCACTCGAGGAGATTGAATCGATAATGTGGAACACAACTACAACAGTCCATGAGTGAT	Os01g0227800	CI407819	Cytochrome P450 family protein.
2628	31	78	Os09g0326900|mRNA|AK067685|CDS+3'UTR	CTATGTGGTGTCACACTCCAGCTGGAGATCTTTTTATTTATCAAACCTTAATGTGTTTCA	Os09g0326900	AK067685	Similar to Eukaryotic translation initiation factor 5 (eIF-5).
2629	31	79	Os07g0186000|mRNA|AK121423|CDS+3'UTR	GGCTATTCTGTACGAGTTTGCTGACTATTAAAGCAATTATTATAATATGATGATGCTGGC	Os07g0186000	AK121423	Similar to Thioredoxin h isoform 1.
2630	31	80	Os05g0365300|mRNA|AK062028|CDS+3'UTR	TGGTTTCTATTGAGTATTGACTGTAAGCCTGTAACTATTATCTCTTGTATGATGAGATGC	Os05g0365300	AK062028	Similar to NBS-LRR protein (Fragment).
2631	31	81	Os07g0127500|mRNA|AK062949|CDS+3'UTR	CAGAATACAGTACGTTATTCGTACTTAAGGAGTACATGATAAATAAAGGATTTGTTATGT	Os07g0127500	AK062949	Similar to PR-1a pathogenesis related protein (Hv-1a) precursor.
2632	31	82	Os03g0366200|mRNA|AK059466|CDS+3'UTR	TGTATTCAGGTTTGTTTAGAGGTGAATGTACAGATGAGTTTAGGAAACAGGAAAAATGAG	Os03g0366200	AK059466	CaMK1.
2633	31	83	Os02g0272900|mRNA|AK101376|5'UTR+CDS	TAGGTGAGCTGAGCAAACTGAGAGATGTTCGAATCTGGTGGTCAGATTCCAACGAAGATA	Os02g0272900	AK101376	Disease resistance protein family protein.
2634	31	84	Os04g0521100|COMBINER_EST|CI561264|0	AGCTGTGTGCATATGGTACCAAAAAACTGTATGCACTCTATATGAAAAAGTACTTCGATG	Os04g0521100	CI561264	Major intrinsic protein family protein.
2635	31	85	DarkCorner		
2636	32	1	DarkCorner		
2637	32	2	Os05g0144400|mRNA|AK120211|CDS+3'UTR	TTTATCCCGTCGCTCGTTGTAGAGCGTGATGAATGTTTGTAAGCGAACCGTGTTGTGATT	Os05g0144400	AK120211	Serine/threonine protein phosphatase, BSU1 family protein.
2638	32	3	(+)eQC-39		
2639	32	4	Os07g0684800|mRNA|AK105645|CDS+3'UTR	AACTAAACCCCTTGTACATGTACCATCAGTTGTGCTTTACTTACATGATCAATTCAACCA	Os07g0684800	AK105645	Similar to NAM / CUC2-like protein.
2640	32	5	osa-miR166e|Os03|3'seq	TGCGAACATCTATCTCGGATCTTTGGGTTCTCGAACCAGGCTTCATTCCCCTCAGAGATA			miRNA
2641	32	6	Os03g0588800|COMBINER_EST|Os03g0588800|8	AGCAATCAGGCTATGCCTCGTTGGGAAAACCAAACCATACCAGGTCCTCCTGTATATTTT	Os03g0588800		Frigida-like family protein.
2642	32	7	Os01g0598400|mRNA|AK109846|CDS+3'UTR	GGTTGCGGAAGTACTAAAACTTTGGTGCGTATTGTTTTGGGCCAAAATCCACAATCCTGT	Os01g0598400	AK109846	Cyclin-like F-box domain containing protein.
2643	32	8	Os01g0571800|COMBINER|CI095526|6	AAAGGATGTCAAATTACTCCTCTATTTACTGTATGTCATATATGATTATATTTGTATTTA	Os01g0571800	CI095526	Lateral organ boundaries, LOB domain containing protein.
2644	32	9	Os02g0768600|mRNA|AK059725|CDS+3'UTR	TGAGCAGCGATTGTGTTTGGAACAAGCTTTACAAAGTGAACAATCAGTTTAGAAGTTGAA	Os02g0768600	AK059725	Similar to Chloroplast inorganic pyrophosphatase (EC 3.6.1.1).
2645	32	10	(+)E1A_r60_1		
2646	32	11	Os02g0673300|COMBINER_EST|Os02g0673300|8	ACTTATCATAGGAAGAGAACGATGTAACTTATCTCTCCCTAATTATCTTGGCAATAACTG	Os02g0673300		Hypothetical protein.
2647	32	12	Os01g0882500|COMBINER_EST|CI007457|6	GGCTCAAATTACCCCAAGACAACCATGTAAAATCAAACTTTCACATAATACAATCATCAG	Os01g0882500	CI007457	Conserved hypothetical protein.
2648	32	13	Os04g0493000|mRNA|AB001883|CDS+3'UTR	TTGGGCCCAATACTTATCAGCATGGTGTTGGGCATGAACTATGATGTACTATGACATGAC	Os04g0493000	AB001883	Zinc finger, B-box domain containing protein.
2649	32	14	Os03g0294100|COMBINER_EST|Os03g0294100|8	AAAGCATTCCAAGAACTGAAGATCATTGCAGTGCACCGGCAAACTTATGCCCACCAATCT	Os03g0294100		Conserved hypothetical protein.
2650	32	15	Os03g0386500|mRNA|AK106316|CDS+3'UTR	AAACGGGACGAATTAATCCGAATTAATACGATCCATTTCCACCTAATTTCAGTTTGTACT	Os03g0386500	AK106316	Similar to Trehalose-6-phosphate phosphatase.
2651	32	16	Os02g0519900|mRNA|AK121453|CDS+3'UTR	TCTGTCGTGATGTAACGGATGTGGAACCTGGATCATCTTTTTGCTGTCTAAGTTATAGTG	Os02g0519900	AK121453	Similar to Elongation factor EF-2 (Fragment).
2652	32	17	Os01g0155000|mRNA|AK073659|CDS+3'UTR	AGTAGATGAACGATGTCATTTATATGCGTGTAGCTTGTCAAAATACAAAGTAGAAACCTG	Os01g0155000	AK073659	Esterase/lipase/thioesterase domain containing protein.
2653	32	18	Os06g0237000|COMBINER_EST|CI399012|6	TTGTCTAATCCTGATTCATGATCAACTTATGTAAAGGGGTTCGAAAAAGCTAATGCCACA	Os06g0237000	CI399012	Hypothetical protein.
2654	32	19	Os07g0494800|COMBINER_EST|Os07g0494800|8	ATCATCTCGAGGAAATTAAGGAACTAGCTTCGTGGTGTGTTGCACCCGAGGTTACAGAAA	Os07g0494800		Protein kinase-like domain containing protein.
2655	32	20	osa-miR395g|Os04|3'seq	CTTCACGTGGCACTATTTCAATGCCTATTGTGAAGTGTTTGGGGGAACTCTCGATGTCAT			miRNA
2656	32	21	Os04g0346800|mRNA|AK109486|CDS+3'UTR	CCTTTGTATTGGGCTACAAACATGCTCTGATAGCTATGGCAATATGATCATTAATATCTC	Os04g0346800	AK109486	EAR repeat containing protein.
2657	32	22	Os03g0656800|mRNA|AK069506|CDS+3'UTR	TACGGCCCATTTATATATGGATATGGGCCGGTTTCTGTGACGGCCCGCGTAGCTTCGGAG	Os03g0656800	AK069506	Similar to 3-glucanase.
2658	32	23	Os02g0528100|mRNA|AK103078|CDS+3'UTR	CGTTTGATATAGCTGATGGGATCACGAGTTTATCTATTCTGTATGGTTCAGTTTAATTGC	Os02g0528100	AK103078	Protein of unknown function DUF662 family protein.
2659	32	24	Os05g0427300|mRNA|AK061869|CDS+3'UTR	TCCACTAATGCAGCTGTACCAAGACTTAGTCTAATTGCAGGGATGGCTGGCAATTTGTGT	Os05g0427300	AK061869	Similar to RNA binding protein (Fragment).
2660	32	25	Os02g0625000|mRNA|AK099334|CDS+3'UTR	TTTTTGCTTTTTGTGACACATTCTGTAACTAGCTGAGAACTGAGCTGACACGGTTTCCTC	Os02g0625000	AK099334	Similar to Deoxyribodipyrimidine photo-lyase (EC 4.1.99.3) (DNA photolyase) (Photoreactivating enzyme).
2661	32	26	Os09g0250200|COMBINER_EST|Os09g0250200|8	TGCCTTACTCGGCTGCGCCCGTTGGGCGAGGGCCTCGGAGCGAAGCAGGGGGAGAGCCCG	Os09g0250200		Conserved hypothetical protein.
2662	32	27	Os01g0748200|COMBINER|CI517949|x	TGATGAATATTGTTGCATTCTTGTCTCTGAACAGTCGCACTTTGGTGCTGAAGCCACGGT	Os01g0748200	CI517949	Conserved hypothetical protein.
2663	32	28	Os09g0560500|mRNA|AK071381|CDS+3'UTR	TGGGGTTGAAGTAGGTACCATGTTGTGTTGCTTGTCCAAAACTTTGGCAAACTTTGCTTA	Os09g0560500	AK071381	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
2664	32	29	Os06g0545400|mRNA|AK072748|CDS+3'UTR	AAGAAATTTTTGGAAATACCTATTCATCCCTCTAGGTGACATATACAATCCTCAAGACTC	Os06g0545400	AK072748	Similar to Polygalacturonase (Fragment).
2665	32	30	Os06g0320900|COMBINER|CI224798|6	CTGCAGTCTGCACCTTCTTAAGGTGATAGCTCTATGCCCTGGTTTCTTGAGATGTAAGAA	Os06g0320900	CI224798	Chaperonin Cpn60/TCP-1 family protein.
2666	32	31	Os01g0868400|mRNA|AK103345|CDS+3'UTR	CCATTTGGTAGATCAGTCCTCTCAAATGCATAGTTCCTCTTGACTGGAGTCATTGCAAAA	Os01g0868400	AK103345	Conserved hypothetical protein.
2667	32	32	Os01g0153400|mRNA|AK059454|CDS+3'UTR	TGAGAAATTTTGACCATGGATAGGCTGGTTGTCCATCTCATGAATCCAATAAAAAGTTTA	Os01g0153400	AK059454	Similar to Aspartyl-tRNA synthetase (EC 6.1.1.12) (Aspartate--tRNA ligase) (AspRS).
2668	32	33	Os01g0658900|mRNA|AY606941|CDS	CCTCCAGTCAAAACAAAAGCACAGCAAGCTCGAGGCGTCGAAAATTTCCTGTCAATGATA	Os01g0658900	AY606941	OSBZ8.
2669	32	34	Os03g0802300|mRNA|AK120564|CDS+3'UTR	TTCCTTCATCTGCCTGTCCTGCTAGTTCGATTATCTTCAAGAAAATCTGAGCTCCTTGTT	Os03g0802300	AK120564	Conserved hypothetical protein.
2670	32	35	Os02g0783100|mRNA|AK064154|CDS+3'UTR	ACCGTTTTTGTGCGAACATTTACTCCTTTATCCATTAATCAGGAGTCCAGGACCATTTCC	Os02g0783100	AK064154	Mitochodrial transcription termination factor-related family protein.
2671	32	36	Os03g0185800|mRNA|AK108006|CDS+3'UTR	AACCAGCAAGCAACAAGAATTGGAAATTTGTTACTGGGTTGCTGCGCTCCAATCCAACCA	Os03g0185800	AK108006	Conserved hypothetical protein.
2672	32	37	Os07g0104400|COMBINER_EST|Os07g0104400|8	GGTGAAGATGGGCGCCATCGGCGTGCTCACGGGAGACCAGGGCGAGATCCGCCTCAAGTG	Os07g0104400		Haem peroxidase family protein.
2673	32	38	Os09g0505000|COMBINER|CI253114|6	AAAGGTTCTACTACTTCTTGGCTTCTTGGCAACTGCAAATCATATCAAAGAATTCTCAGA	Os09g0505000	CI253114	Zinc finger, RING-type domain containing protein.
2674	32	39	Os10g0473400|mRNA|AK073558|CDS+3'UTR	TGTTGTATAATTGTACAGTAAACTACAAAATCATATCGTCAGCATCATCTTTGCTCTGCG	Os10g0473400	AK073558	Protein of unknown function DUF608 domain containing protein.
2675	32	40	Os01g0255700|COMBINER_EST|Os01g0255700|8	TGGGTCTGTGCGTGCAGATTTCGCGTGGTCATTGGCTATGGTCCGTCTGGGAGAGCATCG	Os01g0255700		Conserved hypothetical protein.
2676	32	41	Os04g0460600|mRNA|AK071020|CDS+3'UTR	TTAGTTAAGCAATTGGCCACTCCTCAGTTGCCAGTTAATTAGTTAGAGTTGCTTAATTTA	Os04g0460600	AK071020	Similar to NAM / CUC2-like protein.
2677	32	42	Os02g0736300|mRNA|AK099700|CDS+3'UTR	TTGCAACGATCTGTAAATGAAAAAAGATAGTAGGAACCAGAGGTATCATTCTAACACTGC	Os02g0736300	AK099700	Membrane attack complex component/perforin/complement C9 family protein.
2678	32	43	Os03g0710800|mRNA|AK062077|CDS+3'UTR	ATGTCAAAATGTGTCGAGCTGAAGTACCCAGTGGACACAGTTTATGTGCACTACATTGCT	Os03g0710800	AK062077	14-3-3-like protein S94.
2679	32	44	Os03g0268000|mRNA|AK058806|UTR	AAGGCAAATTTATGGCATCAAACAAAATGTGAAATGGTGAAGCCCATTTCGCTCATAGCG	Os03g0268000	AK058806	Similar to Protein phosphatase 1, catalytic gsmms subunit.
2680	32	45	Os07g0676800|mRNA|AK061062|CDS+3'UTR	GGTTACGACCCTCCAGGTTATAATCTTGTAATTTTTGTCCTGCTCTATCAATAGAATTTC	Os07g0676800	AK061062	Conserved hypothetical protein.
2681	32	46	Os12g0160400|mRNA|AK074015|CDS+3'UTR	GGCCATGTTTTGCTTGTATAATCTTGTTTCAGTTTGCTACTGATGTGTTTGTTGGCGTTA	Os12g0160400	AK074015	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
2682	32	47	Os12g0481200|mRNA|AK102011|CDS+3'UTR	CATCCAAAATACGGAAATCTTGATATTTTAAATATTCTCCAATAAGTATATTGAGCAGTG	Os12g0481200	AK102011	Conserved hypothetical protein.
2683	32	48	Os06g0479100|mRNA|AK104074|CDS+3'UTR	GCGGGGTCCTGCCCCGATCGCAACGAGCAGCCGCCGCTCGGTCTCAGCCGGCGCCCCGAT	Os06g0479100	AK104074	Hypothetical protein.
2684	32	49	Os06g0677500|mRNA|AK102430|CDS+3'UTR	ATTGCAGAGTTCTTTCTGCTTTGAACGAGTGAATTGTTAAAAATGATGGTATTGCAGAGT	Os06g0677500	AK102430	Protein prenyltransferase domain containing protein.
2685	32	50	Os08g0113300|mRNA|AK106523|CDS+3'UTR	TGTTCATGTGTAATGCTTGGTATCAGATTATCACTTATCCACAGTAAAAGAAAATTAAAG	Os08g0113300	AK106523	Similar to Clone ZZD1296 mRNA sequence.
2686	32	51	Os10g0492600|mRNA|AB114828|CDS+3'UTR	ACAGTGAGCTACCAGTGTGTAATGATAAATAATTAAGTTTCCATTATAAAGTGAAATCCA	Os10g0492600	AB114828	Similar to Tonoplast membrane integral protein ZmTIP3-1.
2687	32	52	Os10g0456200|mRNA|AK099701|CDS+3'UTR	TTTACTCGTGACTGTTGACCAATCCTGTTGTAACTTTGACCACTAATAAATTTTGAATGG	Os10g0456200	AK099701	Ubiquitin domain containing protein.
2688	32	53	Os05g0220900|mRNA|AK109456|CDS+3'UTR	CTCTCGTCCAAAATTATCCAATATGTGTAAAGTTTATCATGGCTGTAAGACGTTTTATGG	Os05g0220900	AK109456	Prefoldin domain containing protein.
2689	32	54	Os10g0127900|mRNA|AK104771|CDS+3'UTR	TGGTCTCCGGTGAAACGTATTGTATTTGTCTCTCTCCTAATATAATCCCATGTTATAGTG	Os10g0127900	AK104771	Conserved hypothetical protein.
2690	32	55	Os05g0521400|mRNA|AK066592|CDS+3'UTR	GAGGAGGGTTTAGCTTACTATCCTACAACTCCTAAATTGAGAGTATTGTGCGATTGAAGT	Os05g0521400	AK066592	Conserved hypothetical protein.
2691	32	56	Os02g0796300|mRNA|AK061820|CDS+3'UTR	ATTTAGGACAGAAAATGTGACAAATGATCAAGATGATGTTATGTAGGTCAAGTTTGTCTC	Os02g0796300	AK061820	Similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1).
2692	32	57	Os01g0117200|mRNA|AK120089|CDS+3'UTR	ACCTAGCAGATTGAAGTTGTTTTACGTGTATGTAAAATGACTATGAATAAACTACTCCCC	Os01g0117200	AK120089	Similar to ARK protein (Fragment).
2693	32	58	Os01g0748600|mRNA|AK071920|CDS+3'UTR	ATAGTTTTGCAACTTGTTGCTTCACTGTCGATCACAATGCGGTTGTACATCAGACAGCAT	Os01g0748600	AK071920	Protein kinase domain containing protein.
2694	32	59	Os12g0630100|mRNA|AK069182|CDS+3'UTR	ACTTCTACTAAACTGTATCAGGGAAAATAATAAGAACATACAATAAAACGAACGTGATCC	Os12g0630100	AK069182	Similar to Thaumatin-like protein precursor.
2695	32	60	Os06g0701200|mRNA|AK064009|CDS+3'UTR	CGTAGGATGCTTGTACTGAACACTTAGTATTGAAGCAACCAAGATGCCTTGAAATGTCCT	Os06g0701200	AK064009	UTP--glucose-1-phosphate uridylyltransferase family protein.
2696	32	61	Os07g0106200|mRNA|AK103047|CDS+3'UTR	CTTGTTTGGCCAAATTGATCTTAATTGCTGTACCTTTCACTGTCAAAGAGCGTCCCTTGT	Os07g0106200	AK103047	Similar to Hexose transporter.
2697	32	62	Os09g0135100|COMBINER_EST|Os09g0135100|8	ATGCTGAGCTTGTGAGAGGTGCTCTAGAAACCTTTGTGAGTGCAGTGACTCCTATTGAAA	Os09g0135100		Conserved hypothetical protein.
2698	32	63	Os03g0694000|mRNA|AK059872|CDS+3'UTR	CCGAGAGCATTTTCATGGTGTTCTCTGCTACCAGCAGCATACTTTAAGCTCCCGTTGTGT	Os03g0694000	AK059872	Similar to Oxalate oxidase 1 (EC 1.2.3.4) (Germin).
2699	32	64	Os02g0663900|mRNA|AK068885|CDS+3'UTR	CAAAAGTTCAAAATCGAACTATCCCCGAGAGAGACCGAGGCTGAAAGAAGCCAATCTGCC	Os02g0663900	AK068885	Similar to Phosphoribosyltransferase (Fragment).
2700	32	65	Os01g0759900|mRNA|AK103020|CDS+3'UTR	GTGTCAGAAAGAACTCAGAATGCTGAGCAGAGGCAATGTAGATGTTCTTCTAGTTGGCCA	Os01g0759900	AK103020	Similar to Permease 1.
2701	32	66	Os01g0763300|mRNA|AK063778|CDS+3'UTR	GAACTACCTGATGCTGATGCTTTGGTAGTATGGTTCAATGAAAGATGAAATGTTTCCTTC	Os01g0763300	AK063778	Conserved hypothetical protein.
2702	32	67	Os08g0104600|mRNA|AK120393|CDS+3'UTR	TTTGGTGTCATATATGCATGCATTACTGTGTCATATATACTACTGTCAAATACGTACTCC	Os08g0104600	AK120393	Ferredoxin I, chloroplast precursor (Anti-disease protein 1).
2703	32	68	Os12g0538600|COMBINER_EST|Os12g0538600|8	ACTACAATATGGAGTGAGCAAAAGTAATATAGTCAAGAACAAAGCAAGAAAGAACCACTT	Os12g0538600		Glutaredoxin-like, plant II family protein.
2704	32	69	Os05g0197700|COMBINER_EST|Os05g0197700|8	GCTACACTGGTCTACTGCGACAATCTACCTGAGCTCATCACCACAAGAAACCGGATGGCA	Os05g0197700		Retrofit.
2705	32	70	Os11g0133200|COMBINER_EST|Os11g0133200|8	ATGGTTAATGTTTTGATTAATGGGTACTGCAAGCTAGGAAGGGTGAAGGATGCTCTTGGA	Os11g0133200		Protein prenyltransferase domain containing protein.
2706	32	71	Os08g0205100|mRNA|AK119306|CDS+3'UTR	GTGTGCAAAGCCTACCGCCTGTAGGACAATACATTATCATAGCCAGCATTTTAAAAATGT	Os08g0205100	AK119306	Disease resistance protein family protein.
2707	32	72	Os08g0414600|mRNA|AK101579|CDS+3'UTR	ATGATTGTTACTGCTGCTATTCTCGTGTCAAAGCTTTGTCATGCCTGTTAACGTATGGAA	Os08g0414600	AK101579	Soluble quinoprotein glucose dehydrogenase domain containing protein.
2708	32	73	Os05g0346400|mRNA|AK102727|CDS+3'UTR	GAATCTTGTAGACGGTTTTATGTTTACTTAGTTTAAGGCCATGTTTGGCACCACTTCAAG	Os05g0346400	AK102727	Protein of unknown function DUF538 family protein.
2709	32	74	Os03g0106500|mRNA|U31771|CDS+3'UTR	AATTCATTCTCTGATTTTGCGTGAGATTATCATGAGAAGCAGTAACCATGTTGTGTATCC	Os03g0106500	U31771	Beta-expansin precursor (Beta-expansin 1).
2710	32	75	Os02g0587800|COMBINER|CI561738|x	ATGTATGAAATATGAATAGATCACACGTGGAATAAAAGAGCGATAGAGCGGACTGGTGGG	Os02g0587800	CI561738	Virulence factor, pectin lyase fold family protein.
2711	32	76	Os01g0303800|mRNA|AK121626|CDS+3'UTR	ATGCGGATCTGCGGATCTGTTGGCACCTTGTAATGGTTGAAATTTGCAGGCTATTTGACT	Os01g0303800	AK121626	Universal stress protein (Usp) family protein.
2712	32	77	Os01g0505500|COMBINER_EST|CI137483|6	CTCCTGAAATAGTTTACATCATCTGTATTGTATAGAGGGATTGAACTAAATAAAAGGCGC	Os01g0505500	CI137483	Protein prenyltransferase domain containing protein.
2713	32	78	Os10g0419000|COMBINER_EST|Os10g0419000|8	AACTTAACCCCAGCTGAAGCAACCTGGGAAGATGCTTCTTATATTCAGGCTGCATTTCCA	Os10g0419000		Retrotransposon gag protein family protein.
2714	32	79	Os03g0106500|mRNA|AK072792|CDS+3'UTR	GGTCATTTGTTTTTGCCCACAATATTTTCTGCTAAATTCATTCTCTGATTTTGCGTGAGA	Os03g0106500	AK072792	Beta-expansin precursor (Beta-expansin 1).
2715	32	80	Os02g0743700|mRNA|AK060092|CDS+3'UTR	TCAGAGGATTTGACACTGTTTCTTACGCTGAGTTTCAATGTAAAATGGAATAAAGGTTTC	Os02g0743700	AK060092	Similar to RING-H2 finger protein ATL1Q.
2716	32	81	Os06g0690100|mRNA|AK109757|CDS+3'UTR	GTATCTGTGACCACTTGAATTATGAGCAGGTGAATAAAACCAAGAAGATGCAGATGCCAT	Os06g0690100	AK109757	Conserved hypothetical protein.
2717	32	82	Os11g0118300|mRNA|AK119514|CDS+3'UTR	CTGTAAATTGTAAGTTTGTGTCCGCAAAAACGAACTAATGTTTGGATTGGATTGGTCAAA	Os11g0118300	AK119514	NPH3 domain containing protein.
2718	32	83	Os11g0529800|COMBINER_EST|Os11g0529800|8	GTCTCCCTGCTGCTGGGCGAGCGCGGCCTCGACTGCAGGATCTCCGGCGAGGTGGCGGCG	Os11g0529800		Type III polyketide synthase family protein.
2719	32	84	Os04g0674200|mRNA|AK101965|CDS+3'UTR	TGTAATACTAGCTGAATGCCGGTACTTCGCTATGGACAGAAGAAAACATATCATAATATT	Os04g0674200	AK101965	Coenzyme Q biosynthesis Coq4 family protein.
2720	32	85	DarkCorner		
2721	33	1	DarkCorner		
2722	33	2	Os02g0201300|mRNA|AK068381|CDS+3'UTR	TTTGCCATGTCAAAAGTGGTTGTGAACTCGACGAGAGATTAAAGTCAAAAGTGGTGTTCG	Os02g0201300	AK068381	Conserved hypothetical protein.
2723	33	3	Os12g0263800|mRNA|AK065157|CDS+3'UTR	CTTGTTTGAATATATGGTATTTGTACTGTTCACAACCCAGCTCGAATATACTCTGTTTTA	Os12g0263800	AK065157	Similar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
2724	33	4	Os01g0819900|mRNA|AK067401|CDS+3'UTR	TATGCCCAATGTATTATTTCACAATTGTGTATTACGATAGCTTCAGGATATATGTACATC	Os01g0819900	AK067401	Protein kinase domain containing protein.
2725	33	5	Os09g0496400|COMBINER_EST|CI172301|6	ACGGATCTGGAGCCTAGCGCGTTGGCGGCCGATCGTTGGGATTGGAGGCGGCCGAGGCCC	Os09g0496400	CI172301	Hypothetical protein.
2726	33	6	Os07g0615500|mRNA|AK108210|CDS+3'UTR	TACTGTAATGAGGATGAATAAAGGGGATCAAATCAAGGCCACCATGCATGGCTAGTCGAT	Os07g0615500	AK108210	Protein of unknown function DUF581 family protein.
2727	33	7	Os01g0730700|mRNA|AK109770|CDS+3'UTR	AATAGAAGGGCTGTCTTTGTTCACGATCTGATCGACGGAACATCATGTTATATATGAATT	Os01g0730700	AK109770	WRKY transcription factor 14 (WRKY14).
2728	33	8	Os04g0266200|COMBINER_EST|Os04g0266200|8	CGACGCCGCCATCGCCGAAGAGAAGCTCTTCTACTTGCCGTTCCGGCCAACTCCTCATCT	Os04g0266200		Conserved hypothetical protein.
2729	33	9	Os05g0409100|COMBINER_EST|Os05g0409100|8	GCCGCGTGCCATCGTCGCGCTTTGCTTGGGTGTTCTTGCCTCAGGATTTTCATTTCTGTA	Os05g0409100		Conserved hypothetical protein.
2730	33	10	Os02g0605900|mRNA|AK064754|CDS+3'UTR	TCATAAGTAATCAAATAAAATCGTATTGCATTACGTCAACGTTGTTTGCGGCATAGGAGT	Os02g0605900	AK064754	Similar to Chitinase (EC 3.2.1.14) A.
2731	33	11	Os03g0337800|mRNA|AK102721|CDS+3'UTR	GGATGTAGTAGATGCTTATGCAAAGTTGTTTTTTCAAAGGTTGATGGTGATCTTAACCTT	Os03g0337800	AK102721	Similar to 60S ribosomal protein L19 (Fragment).
2732	33	12	Os12g0132300|mRNA|AK119956|CDS+3'UTR	AACAACTACACAGTGTAAATGAAAATGAATAATGCTGGCCAATTAATATACTTGTTCCTC	Os12g0132300	AK119956	Similar to Calmodulin (CaM).
2733	33	13	Os10g0552400|mRNA|AK121815|CDS+3'UTR	AGCCAGTTCGGAAACTGCACAACTCACAGAATGCAGAAAGAAAATGCTTTGATTTTGTCT	Os10g0552400	AK121815	U box domain containing protein.
2734	33	14	Os02g0177700|mRNA|AK119941|CDS+3'UTR	GAAGCTACGTATGGCTGCTTTTTAGCAACGTCTGACATTGCAGACTATGTAAGTTTTCAG	Os02g0177700	AK119941	Protein of unknown function DUF588 family protein.
2735	33	15	Os01g0579000|mRNA|AK064700|CDS+3'UTR	CAACACCAACATGGATCGGCGCTGTTATGAAAAAGCAATAAAATTAATTGCATCGTGGAC	Os01g0579000	AK064700	Conserved hypothetical protein.
2736	33	16	Os06g0264700|COMBINER_EST|CI048347|6	TTCAGAAACTGTTAGCATGACACAACTTTTAAACTGTGTGCTTCTGTTCTGTTAAGAATG	Os06g0264700	CI048347	Acylphosphatase domain containing protein.
2737	33	17	Os04g0250200|mRNA|AK058584|CDS+3'UTR	TGTGTCAAAAGCTCTGAAACGTTACGAAAATTATGGTGCTTATAGACATCATGCTCTAAA	Os04g0250200	AK058584	Hypothetical protein.
2738	33	18	Os05g0244700|mRNA|AK104978|CDS+3'UTR	TTTATGTGAACGAAATTTTTCCGTATTATGAGTGGAGGATCCGTCACATTGACAGAATTG	Os05g0244700	AK104978	Aminotransferase, class IV family protein.
2739	33	19	osa-miR441b|Os07|5'seq	TTATCACCACTGACATACTTCCTCCGTTTCACAATGTAAGTCATTTTAGTAATTTTCATA			miRNA
2740	33	20	Os07g0119400|mRNA|AK102922|CDS+3'UTR	AAGGCCTCAGGCTTAATGGTGCAGAGTGCTCTGTTTCTGATGCCGCATCAATCTATTATT	Os07g0119400	AK102922	Similar to Pectinesterase like protein.
2741	33	21	Os06g0153100|COMBINER|CI559840|x	GTTAAGTTGAGGGACCTCTGGTGAACTTATTCTGAAAGAGAATAACTATGGCCCATTCAA	Os06g0153100	CI559840	Protein of unknown function DUF581 family protein.
2742	33	22	Os07g0136400|mRNA|AK110793|CDS+3'UTR	CCCACACCAATGCTTCCTAGGAGTATGTAATGATCATCCTGCTAGCTCTATGGCAATCTA	Os07g0136400	AK110793	Conserved hypothetical protein.
2743	33	23	Os01g0863800|COMBINER_EST|Os01g0863800|8	CGTCCTGCTCGTCGCACCGGAGGAGCTCGACTTGCACGATCACGGAGGAGTCGTCGTTGG	Os01g0863800		Protein of unknown function DUF623, plant domain containing protein.
2744	33	24	Os01g0253300|mRNA|AF005265|CDS+3'UTR	TGGTTTTGAGTTTCGTCAGGAGTGTGCTGAGTTGCAGTTTGTCCGGACATGTAAACCATT	Os01g0253300	AF005265	Importin alpha-1a subunit.
2745	33	25	Os07g0606800|mRNA|AK109579|CDS+3'UTR	ATTTGATTTGATTTGATTTGATTCATACGATGAATTCAACGAGACGAGCTGTTCATGATC	Os07g0606800	AK109579	Esterase/lipase/thioesterase domain containing protein.
2746	33	26	Os08g0500000|mRNA|AK058215|CDS+3'UTR	ATGGTAGTTACACTATTTGACTCCCTAAATGGATATGGATGCAGGTTTCCTGAGTTATGC	Os08g0500000	AK058215	Similar to COP9 signalosome complex subunit 6a (Signalosome subunit 6a) (Fragments).
2747	33	27	Os09g0515800|mRNA|AK070794|CDS+3'UTR	ACTACCCCCAATCTGTATATTTTACTTACAGATTATTATCAATGATGATGAATAGATGGC	Os09g0515800	AK070794	RabGAP/TBC domain containing protein.
2748	33	28	Os11g0137200|COMBINER_EST|CI418615|0	GATAGAGACCAATGTTGACCTCAACAAGCTCATGGATGCTGGAGATTACATCTCCAAGCA	Os11g0137200	CI418615	Pyruvate carboxyltransferase domain containing protein.
2749	33	29	Os03g0245800|mRNA|AK120048|CDS+3'UTR	ACTCAGCGAACGAGCGAATGAATGGAATAATGCTAGTATGAGATAAAAGGTTTGGTTGCT	Os03g0245800	AK120048	Similar to Heat shock protein 26.
2750	33	30	Os05g0595000|mRNA|AK071326|CDS+3'UTR	TCATGTACATTGATACAGCTGCACAAACAATACAATACAATGGAAACCAAATCTTCACTC	Os05g0595000	AK071326	Allergen V5/Tpx-1 related family protein.
2751	33	31	Os09g0522000|mRNA|AF300972|CDS+3'UTR	TGATTCCATCTGATTTTGAATGTGCAGTCAATGAATTCCTGTAAATTTACTTCTCCTCTC	Os09g0522000	AF300972	Similar to CBF-like protein.
2752	33	32	Os12g0194900|mRNA|AK069508|CDS+3'UTR	TTGGGCTTAATTTTGATCTTGGAGTAACTAGAAAACATGTAATTCATCGTGTTGAGGATG	Os12g0194900	AK069508	Similar to Amino acid carrier (Fragment).
2753	33	33	Os04g0502100|mRNA|AK066956|CDS+3'UTR	TAACTCAGAATAGCAAGTATTCTTTGGCTGTTTGTACTGAACAATAGCTCTGGTAGCTAC	Os04g0502100	AK066956	Conserved hypothetical protein.
2754	33	34	Os02g0556800|mRNA|AK060580|CDS+3'UTR	GATGAAGGATATGCACGTATACACTACATGGTAGATTGATGAAACCATTTTTAAGTTTCG	Os02g0556800	AK060580	Conserved hypothetical protein.
2755	33	35	Os08g0519000|COMBINER_EST|Os08g0519000|8	GGCTCCGCTTATGCACCACAACTTAGATCCCTTTTCTGTAGACCTTCTCGACATGCTGGC	Os08g0519000		Hypothetical protein.
2756	33	36	Os06g0186400|mRNA|AK066243|CDS+3'UTR	CAAGGGTGAACGTTCACATTGTTGTCGTACAGGATGTGTATAACATTGTTGTGTATAACA	Os06g0186400	AK066243	Similar to Serine carboxypeptidase II-2 precursor (EC 3.4.16.6) (CP-MII.2) (Fragment).
2757	33	37	Os09g0517900|mRNA|AK065112|CDS+3'UTR	TCTGCAGCTTTCGTTGAGATGATGTTCAGCCTTCAGGGCAGATTTTGATATATGATTTTG	Os09g0517900	AK065112	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
2758	33	38	Os09g0468300|COMBINER|CI561982|x	TTTCTTCAAACAAGCATGTACATATATACCGTACAGTGGTTGATAGCAGGAGGAATTTAC	Os09g0468300	CI561982	Zinc finger, RING-type domain containing protein.
2759	33	39	Os09g0485900|mRNA|AY072817|5'UTR+CDS	GAAGCTGACCCGCAACTTCAAGCACCTCAACCTCGACTTCCAGCTGCTGGAGGGCGGCCG	Os09g0485900	AY072817	Similar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA).
2760	33	40	Os01g0121000|COMBINER|CI251397|6	CGTAAGCGGATTGCTTTTGCTAGTGTTAGGCAGCTAGCTTGAGCTGGCTCTCGAGTGTAC	Os01g0121000	CI251397	(No Hit)
2761	33	41	Os12g0407900|COMBINER_EST|CI070903|6	GCAGAGAAGTTGAGGAAAGAATTGTCGGTGATAAGCATTCAGGATGGATGATATTTTCCT	Os12g0407900	CI070903	Protein prenyltransferase domain containing protein.
2762	33	42	Os01g0833000|mRNA|AK067226|CDS+3'UTR	GTAAGTGCGCGTGGCCACTGTGGAAGTTCTTTTTCAATTAAATTTTAGACACCAAAGTGT	Os01g0833000	AK067226	Protein prenyltransferase domain containing protein.
2763	33	43	Os08g0316900|mRNA|AK110651|UTR	GTTCCAGGCCGAGATACTGGGTGGTGCTGCTCATTCTAGTTCATCTTCCATCTTCCTCCC	Os08g0316900	AK110651	Non-protein coding transcript, putative npRNA.
2764	33	44	Os04g0278200|mRNA|AK066988|CDS+3'UTR	GTTGCTAGCTGAAGCGCAACAGATACTTGAAGAACTTGGACACGAGAGCAACTAGAAGTA	Os04g0278200	AK066988	Tetratricopeptide-like helical domain containing protein.
2765	33	45	Os12g0548300|mRNA|AK070054|CDS+3'UTR	ATGAAATTGTCACCGTATTGGTGTTCAACCCACAAATGAGGAGGCTAAGGGATACTCGTT	Os12g0548300	AK070054	Similar to Nucleoside diphosphate kinase II, chloroplast precursor (EC 2.7.4.6) (NDK II) (NDP kinase II) (NDPK II).
2766	33	46	Os09g0522200|mRNA|AF494422|CDS	TGGCGCAGGGGATGCTCATGGAGCCACCATCGGCGGCGCTCGGCGACGACGGTGACGCCA	Os09g0522200	AF494422	DRE-binding protein 1A.
2767	33	47	Os07g0219300|mRNA|D11385|CDS+3'UTR	TAGTTCGGAAGTGAAAATATAAGCTCAGGTATCATCGTATGTGACATGTGAAACTTGAGG	Os07g0219300	D11385	Prolamin precursor (13 kDa prolamin).
2768	33	48	Os03g0166200|COMBINER_EST|CI453100|2	GCAACGTATGTACATCGTAGTTTCAGAGTACTAATCGACTAATAATCATAATAAATACAT	Os03g0166200	CI453100	Similar to Prolyl 4-hydroxylase alpha-1 subunit-like protein.
2769	33	49	Os07g0241100|COMBINER|CI082393|6	TGTTGAATTCTCCTTGGTCTAAAAGGAGCCCTCAAATTTTACTTGAATTTTCAGAGCACC	Os07g0241100	CI082393	(No Hit)
2770	33	50	Os09g0531100|mRNA|AK110919|CDS+3'UTR	TTGACTTGTTACTGAGGTGCTTGTTGAACTCATTTTAAGTTACTGATCCCTGCAACTGTT	Os09g0531100	AK110919	Conserved hypothetical protein.
2771	33	51	Os05g0468100|mRNA|AK121589|CDS+3'UTR	AACGTTTTGCAACTTCTCCTTGCTGTATGTGCTATGAACCATGTTTACTTTATTCAGTGA	Os05g0468100	AK121589	Protein of unknown function DUF1618 domain containing protein.
2772	33	52	Os04g0651700|mRNA|AK105329|UTR	ATGCAATGCTTGGTGATTTCTGGAATTGAAGATATGATGGATGTATTGCAATTTGGAGTT	Os04g0651700	AK105329	Non-protein coding transcript, unclassifiable transcript.
2773	33	53	Os02g0614500|mRNA|AY030360|CDS+3'UTR	AATTTAATTTGTAATATTCCATTGAGTAACTGCATATATGATGGAAAGATATTTTCAGCT	Os02g0614500	AY030360	Protein of unknown function DUF250 domain containing protein.
2774	33	54	Os02g0769900|mRNA|AK073145|CDS+3'UTR	CTATGATTCCCCCTCATCTGTGTAGTCACAGGAGTGAAGTCCAACATGAATTGAATTATC	Os02g0769900	AK073145	Protein prenyltransferase domain containing protein.
2775	33	55	Os05g0540800|mRNA|AK058860|CDS	CCTAAGCGTGCTAATAGAGATGTTGATAGACCCTTTGTTCCTGATACTGTTGGGTTTGCA	Os05g0540800	AK058860	Homeodomain-like containing protein.
2776	33	56	Os07g0613900|COMBINER_EST|Os07g0613900|8	TTGTGAGATAAAGAACTTTGTAAATTTTGCTTTCCTGTCTTTCAATGTAAGCTACTGCCC	Os07g0613900		Endonuclease/exonuclease/phosphatase domain containing protein.
2777	33	57	Os12g0271700|mRNA|AK110824|CDS+3'UTR	TGCAATTTTCACATGCATATAGAAAACACGTTGTGTGTACTTGTATGGGCACCTCACCTG	Os12g0271700	AK110824	Similar to Solanesyl diphosphate synthase 1.
2778	33	58	Os12g0144600|COMBINER_EST|AU108157|7	CAGCAGCTGCAGATGAAGGGGCTGAAGCTGCCGCAGTTCATGGACGCCGCCAAGATGGCG	Os12g0144600	AU108157	Heavy metal transport/detoxification protein domain containing protein.
2779	33	59	Os09g0288700|COMBINER|CI330756|6	TATGTTTCCTTTTCCTCTGCCTCACTACACCAATTGGTCTTCCAGTTGAGTAGTGAGTCG	Os09g0288700	CI330756	(No Hit)
2780	33	60	Os07g0190600|mRNA|AK070975|CDS+3'UTR	TTAATAAAATGTGCCATAGTGGTCTACCGGCGCCCTTGGTACAATCAGAAGTGAACTGGT	Os07g0190600	AK070975	Similar to Helicase.
2781	33	61	Os07g0599600|mRNA|AK105918|CDS+3'UTR	TGTTTCAGCCATCCAGTTGTTCTTGTTCTTGGAGGATGTACTTGCGTGTGCTACGCTTAT	Os07g0599600	AK105918	Conserved hypothetical protein.
2782	33	62	osa-miR159d|Os01|5'seq	TGATGTGAGGAGGAGCTCCTTTCGATCCAATTCAGGAGAGGAAGTGGTGGGATGCAGCTG			miRNA
2783	33	63	Os12g0224000|mRNA|AK060284|CDS+3'UTR	TAGGGTGTATCGGTGGCCTATACAAAAGGTATGAATGTAAGTTTAATCCCTCGTTTTTTG	Os12g0224000	AK060284	Similar to Diacylglycerol kinase 1 (EC 2.7.1.107) (Diglyceride kinase 1) (DGK 1) (DAG kinase 1).
2784	33	64	Os07g0662500|mRNA|D12821|CDS+3'UTR	GAGCGGCTTGTAATGGCGAAACATATGCTATGTCAAAGTACATCCGTCCATTTTTACTGT	Os07g0662500	D12821	Similar to Elongation factor 1-beta' (EF-1-beta').
2785	33	65	Os09g0525400|mRNA|AK104112|CDS+3'UTR	TTGTGAATGTTCTACACCCCTACTCTGCCATCTTCAGTTAATTCAGCAATACTGCATTTG	Os09g0525400	AK104112	Similar to RING finger protein 13 (C-RZF).
2786	33	66	Os07g0576000|mRNA|AK063129|UTR	TGCTGAATACATCTTCTTCCCGTTGATATAGAGACCAAGCAATCTGATATGGTCTGCATG	Os07g0576000	AK063129	UbiA prenyltransferase family protein.
2787	33	67	Os11g0568600|mRNA|AK121732|CDS+3'UTR	GCAGTCGGTCCAATAAATTTCGTCAAGGTTCTCGCTATCTAAATACATACAGTGCATGTG	Os11g0568600	AK121732	THUMP domain containing protein.
2788	33	68	Os07g0191600|mRNA|AK071418|CDS+3'UTR	TCTTCCATCTTCAGGAGATCTCATTCTTGTAAGTATTTGCTTCTGTCAACTTTTTTATCA	Os07g0191600	AK071418	ABC transporter related domain containing protein.
2789	33	69	Os03g0144800|mRNA|AK103041|CDS+3'UTR	GCTTTGCTCAATAATCCTTTGTAAGTCCTTACGGGATTTATAGGTATATCAATTTTGCTG	Os03g0144800	AK103041	Similar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein).
2790	33	70	Os01g0742300|mRNA|AK071100|CDS+3'UTR	TACAGTGGTTAAAAGATTCAGATCAATAAAAGAAGCATACGTGGTGTTTCACCGTTTGGG	Os01g0742300	AK071100	Hydroxyacid dehydrogenase/reductase family protein.
2791	33	71	Os10g0562500|mRNA|AK064321|CDS+3'UTR	AGTGAGTCCCATACTTTCAACATTTGGGCAAAAGGCATTATCTGAATCTGACCAACCAGT	Os10g0562500	AK064321	Similar to Protein kinase KIPK.
2792	33	72	Os05g0579300|mRNA|AK111350|CDS+3'UTR	TGGCCTTAACCTTCATTCTTTGTAGTCACTTATCCTCCTCCATAATTTGGTTCTTGATTC	Os05g0579300	AK111350	ZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein.
2793	33	73	Os03g0191000|mRNA|AK066651|CDS+3'UTR	ATAGTTTGTGTAAGGAAAAATGTTTAATCCTTGCTATGTTTTGACTACGGTGTCTCGAGT	Os03g0191000	AK066651	Similar to CG-1 protein (Fragment).
2794	33	74	Os03g0711300|mRNA|AK060694|CDS+3'UTR	GGTGAGTGAATCTCTTGTCAACGGAAATTGCTGTAAGTTACTGCATATTTTCCGTAAGGA	Os03g0711300	AK060694	Protein kinase-like domain containing protein.
2795	33	75	osa-miR399i|Os02|Mature	TGCCAAAGGAGAGCTGCCCTGTGCCAAAGGAGAGCTGCCCTGTGCCAAAGGAGAGCTGCC			miRNA
2796	33	76	Os07g0488200|COMBINER|CI139401|6	CAGCAATCAGCATGATGGACAGTTCATACAAGCTTAACTCGAGCTATTCAATCTCCGAGT	Os07g0488200	CI139401	(No Hit)
2797	33	77	Os11g0171400|mRNA|AK107313|CDS+3'UTR	CATCCGATTTAAGTAGGCCACAATTATGCACTTGTAAATATTTTGTAACTATCCCAGCTT	Os11g0171400	AK107313	Conserved hypothetical protein.
2798	33	78	Os12g0121300|mRNA|AK068868|CDS+3'UTR	TTAGATGGCATTGTAATCTTTACTTAAAGGGCCAGTATGGCGCATGGAATAAACAAGCAA	Os12g0121300	AK068868	Similar to Phosphoethanolamine cytidylyltransferase.
2799	33	79	Os09g0527500|mRNA|AK110546|CDS+3'UTR	GTTGGTATGGATGTGTTGATAACTATTGGTTGGATGGAAACAAAGTAGATGGGGCTGAAA	Os09g0527500	AK110546	Similar to MEG5.
2800	33	80	Os06g0605600|mRNA|AK106613|CDS+3'UTR	TATATGCTTTGCTCCCCGAGGAAATGTGGCCCTTGAACTGAATGTTGCCATTGTTTGTGT	Os06g0605600	AK106613	Conserved hypothetical protein.
2801	33	81	Os03g0753100|mRNA|AY551926|CDS+3'UTR	TCCTCTTCAATTTGTTGCTAATTAAGTGCTTGCCAAACTTTTCTCAGTGTAATGTACTAC	Os03g0753100	AY551926	Transcription factor, MADS-box domain containing protein.
2802	33	82	Os01g0501800|mRNA|D21109|CDS+3'UTR	GATGTTATTTGCATTTCGACAAGCGGAGAGGACATTGTACGATACATATATGTGCCTATC	Os01g0501800	D21109	Similar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
2803	33	83	Os09g0116600|mRNA|AK059180|5'UTR+CDS	GACATCAAATCTGGCTGCTAAGGCAAAGACATCGCTTACAGATGGAGTAACAGAAGCAAG	Os09g0116600	AK059180	Non-protein coding transcript, unclassifiable transcript.
2804	33	84	Os01g0897200|mRNA|AK061505|CDS+3'UTR	GGTCATCTGCGACTGCAATCTGCTGAATTATAATGGACAGTGGCAATCGGTCTGAACTTT	Os01g0897200	AK061505	Similar to Ribonuclease 2 precursor (EC 3.1.27.1).
2805	33	85	DarkCorner		
2806	34	1	Os03g0182400|mRNA|AK100037|CDS+3'UTR	GGAGTGCTGTTGCAACATGATGGGAAATTACTATATTAACGAATCAAGATACAGGTTTGT	Os03g0182400	AK100037	Similar to SAC domain protein 1 (FIG4-like protein AtFIG4).
2807	34	2	Os02g0195300|COMBINER_EST|CI350664|3	CAGTCAAGCCGATCGATCGAGATGAGCATCGTATACGAGTGTTGTTTTAAGCACCATCAA	Os02g0195300	CI350664	Heat shock protein DnaJ, N-terminal domain containing protein.
2808	34	3	Os02g0534700|COMBINER_EST|Os02g0534700|8	AGCGTAGCTGGTGCTCCGTGCAGATGTCGATCATCTGCACGGCCATAACCAACCTCATCA	Os02g0534700		Pectinesterase inhibitor domain containing protein.
2809	34	4	Os07g0556200|mRNA|AF093631|CDS+3'UTR	TTCCAAATTATATGTACACACACTGTCACACTGTATGAAAGAGCATAAAACCCTTTTCAC	Os07g0556200	AF093631	Rieske iron-sulfur protein family protein.
2810	34	5	Os02g0551400|mRNA|AK068448|CDS+3'UTR	TTTCTCCGTTGGATAGTTTGGTTGATTGGCCAAATATTCAGAAACTATGTCATTGTGGCC	Os02g0551400	AK068448	Myb, DNA-binding domain containing protein.
2811	34	6	Os08g0547500|mRNA|AK065731|CDS+3'UTR	TTGTGTCAGTTTGTCTGGGGAAAATTCATCAATAAAATTCTTGGAAGGCTCGGTTGGGTT	Os08g0547500	AK065731	Similar to Kinesin-like protein NACK1.
2812	34	7	Os03g0588200|mRNA|AK120221|CDS+3'UTR	TTGAATTGTGTTGGCTCAATTGCCTCATGTTGTGTTGGACATTTATTTACATTAACATGT	Os03g0588200	AK120221	Frigida-like family protein.
2813	34	8	Os02g0714000|mRNA|AK104943|UTR	TTTGGGGTCTTATCGGTGTTGTGTAAGCCTGGATTGTTAAAACTTGTACTATTTGTACAA	Os02g0714000	AK104943	Similar to Yarrowia lipolytica chromosome C of strain CLIB99 of Yarrowia lipolytica.
2814	34	9	Os02g0747400|mRNA|AK068818|CDS+3'UTR	TTGTTCTTTTTGTTCATTTAGCTCTAGAGTTTGATCGAGTGCGAGCAGAAGAGAAATTTT	Os02g0747400	AK068818	Similar to PCF1.
2815	34	10	Os02g0189900|mRNA|AK062652|UTR	TGATTATTCGTACTCCTTAGTTTCAGGTTTTGATATGGGGACATGGGTATACTGGACATC	Os02g0189900	AK062652	Hepatocellular carcinoma-associated antigen 59 family protein.
2816	34	11	Os01g0652600|mRNA|AK072075|CDS+3'UTR	GGTGTTTGGCATGAATAAAAATAGTGGTTTAATAAATGCCGTTCCCTTAGAGCAGCAGAG	Os01g0652600	AK072075	Similar to Ketol-acid reductoisomerase, chloroplast precursor (EC 1.1.1.86) (Acetohydroxy-acid reductoisomerase) (Alpha-keto-beta-hydroxylacil reductoisomerase).
2817	34	12	Os06g0729300|mRNA|AK111833|CDS+3'UTR	GGCTCTATTTGTACTCTAATTCGTATGGACCTGTTTCATCATTTCAAAATGGTCAATTGT	Os06g0729300	AK111833	Similar to AGO1 homologous protein.
2818	34	13	Os06g0344900|COMBINER_EST|AU029461|6	ATCGTTGTGTCATCTAACTGCAGTAGCAGGATTTCCCCTGAGGTGACTGATCAGTGATTA	Os06g0344900	AU029461	Similar to NAM / CUC2-like protein.
2819	34	14	POsControl0014|genome		
2820	34	15	Os03g0155900|COMBINER_EST|CI550250|0	CGCTCTAAGATCGAGCATTGTTTATTGGGATCATTAATTCATTTGATTGTTCAGTTGCTA	Os03g0155900	CI550250	Similar to Alpha-expansin OsEXPA18.
2821	34	16	Os02g0635700|COMBINER_EST|CI560327|3	TGGCGTTCTACTGTTAAATCAATCTACATTCAATTCAGTCAGGTGCATTTGCCATACTTT	Os02g0635700	CI560327	Conserved hypothetical protein.
2822	34	17	Os07g0125900|COMBINER|CI544959|0	ACGTTCATGTATGTATAACATATACAGTACCATATTCGTACTTACTATAATAAGTAAGGC	Os07g0125900	CI544959	(No Hit)
2823	34	18	Os05g0568900|mRNA|AK067365|CDS+3'UTR	AGAGACTATATAGTAGACCCCACACTGCTCCGTAAGTCTACTTAACATGGCCTACCGTAT	Os05g0568900	AK067365	Similar to Protease Do-like 1, chloroplast precursor (EC 3.4.21.-).
2824	34	19	Os05g0597100|mRNA|AF255711|CDS	ATTTCTTGCAAGTCATGCAGCAAGACGTTCAACAGTGAAATGGCTCTGCAATCTCACTCG	Os05g0597100	AF255711	Similar to Nucleolar histone deacetylase HD2-p39.
2825	34	20	Os04g0439900|mRNA|AK098870|CDS+3'UTR	ACGAGGTTTGTGGTAGGTTGTGAAGATGCAGAGATAGTTCATATCACCTCAATTTTGATA	Os04g0439900	AK098870	Similar to Translocon Tic40 precursor.
2826	34	21	Os10g0580900|mRNA|AK104136|CDS+3'UTR	TTGTATTCATTGTGTTGTGCCTTAGTCTTTATACTAAATATTACGTTGGATGCTTCTCCC	Os10g0580900	AK104136	Conserved hypothetical protein.
2827	34	22	Os05g0395000|mRNA|AK101858|CDS+3'UTR	TTTGTCGGTGTGAATCGTCGTTTCTGCTTTTGCAGTTCAAATTTTGGTTGTGTTTGTCTT	Os05g0395000	AK101858	Virulence factor, pectin lyase fold family protein.
2828	34	23	Os03g0372500|mRNA|AK068964|UTR	TCTTCATCGTGGACACAGGTGTGGCTTTTGTGCGGCATAGTTTGATTGGTCAGTTTGTAT	Os03g0372500	AK068964	Similar to TA11 protein (Fragment).
2829	34	24	Os09g0544300|mRNA|AK072690|CDS+3'UTR	ACTACCTACTGCTTACTTTTTGTCCTGAATTCTTTTTCGACAATATAATGTTCTGTGCCG	Os09g0544300	AK072690	Amino acid-binding ACT domain containing protein.
2830	34	25	Os01g0915600|mRNA|AK101063|CDS+3'UTR	CCCTCTCAAGCAGAGAGGGACGACGTGTAATATCATTATTTGTATTCTCATTATATTTGT	Os01g0915600	AK101063	Similar to TA1 protein (Fragment).
2831	34	26	Os02g0658500|mRNA|AK099591|CDS+3'UTR	ACTTGTTAGTTCCTGACTAACAGTAGAGCCAACAGAAAATTTGTGTTCGCTGCACATACC	Os02g0658500	AK099591	Conserved hypothetical protein.
2832	34	27	Os12g0630700|mRNA|AK067843|CDS+3'UTR	TACTGAACTCGCTGTACTTGGACGAGGCAATTGAACTCATTGTCTGGTTTGGTCTTTGCA	Os12g0630700	AK067843	Similar to NONA protein.
2833	34	28	Os08g0366200|mRNA|AK103736|CDS+3'UTR	CATGACAACAGTAAACACCTGCCTTGTCAGAGATTAAAGAAAGATGCAGATATGATAGAC	Os08g0366200	AK103736	Protein of unknown function DUF1313 family protein.
2834	34	29	Os05g0407500|mRNA|AK074026|CDS+3'UTR	CTTTTGTTGCTGTTGATGTTCTAGTTTTATCTTCTTTCTTGTTAACAGGATTGGATGGTG	Os05g0407500	AK074026	Esterase/lipase/thioesterase domain containing protein.
2835	34	30	Os01g0238200|mRNA|AK063106|CDS+3'UTR	TGGGCTTGAAAGTTTGATGATAACCACAACGATGTACTGCACCGGAGCACATTTGGTATG	Os01g0238200	AK063106	Conserved hypothetical protein.
2836	34	31	Os04g0585900|mRNA|AK064763|CDS+3'UTR	TTAGAACATTGGAGCTAGGCGATCGATTCATGGGCTCTCCTCCATTTTTGCCTCCTGTTT	Os04g0585900	AK064763	Protein of unknown function DUF581 family protein.
2837	34	32	Os01g0138900|mRNA|AK058378|CDS+3'UTR	AGGCCTGAAATATTTGATCAGTCTGTAGATGGATAAAATAATGAGGCATTTTCAGCTGGC	Os01g0138900	AK058378	Mandelate racemase/muconate lactonizing enzyme family protein.
2838	34	33	Os06g0295000|COMBINER_EST|CI402979|0	TTCTATGCTTGTGTTCTCCTAATTTCATCTATGTCTATCTTTGCCAATAATTATATCCAT	Os06g0295000	CI402979	Conserved hypothetical protein.
2839	34	34	POsControl0042|art		
2840	34	35	Os12g0152500|COMBINER_EST|Os12g0152500|8	TTGCTCTACCTCTGGATGACCCAGAAGTGGCTCCCTTCTTCTGCGGCAGCCATGCATCAT	Os12g0152500		Hypothetical protein.
2841	34	36	Os03g0712700|mRNA|AK099746|CDS+3'UTR	CGATAATGTTGTCAGTTCTGAAACTGAAGAGGGTACTTTATATAAGCGATATATCGATGT	Os03g0712700	AK099746	Similar to Phosphoglucomutase, cytoplasmic 2 (EC 5.4.2.2) (Glucose phosphomutase 2) (PGM 2).
2842	34	37	Os01g0629900|mRNA|AK062211|CDS+3'UTR	CCAATTGTATTTCTAGGGTGAGGGGACAAAAGGGAAAGGAAGGACCACTAACCTTTTCCT	Os01g0629900	AK062211	Similar to Blast and wounding induced mitogen-activated protein kinase.
2843	34	38	PTaControl0001|mRNA|D86327|3'UTR		
2844	34	39	Os03g0622400|COMBINER_EST|AU108617|7	TTAGAAGTGGTTGGCCCTTGTAACCGCACTAACAGCATGCTTGGTTTTTAATCTTGCACA	Os03g0622400	AU108617	Conserved hypothetical protein.
2845	34	40	Os08g0155700|mRNA|AK062907|CDS+3'UTR	AGTGCCATGGCTCGATGGAATTATGCTAAAGTTGTAAGACTCTTGTCTGCCATTAGAGCT	Os08g0155700	AK062907	Similar to RNA polymerase II largest subunit (Fragment).
2846	34	41	Os05g0473300|mRNA|AK102559|CDS+3'UTR	TGCATTAGGAAAAAGTATAACTGATAGCATTCAAATGTAAATAGTAGAACTGAAACCAAA	Os05g0473300	AK102559	Similar to Ethylene response factor 1.
2847	34	42	Os08g0373400|COMBINER_EST|Os08g0373400|8	CAACAATGGTGGCAAGAATCAGGATGAGGACAACAAAGTCATCAGTGCACTAGGATGTGA	Os08g0373400		Disease resistance protein family protein.
2848	34	43	Os08g0443800|mRNA|AK110630|CDS+3'UTR	TCTGATGCTTCTGCTGACGCTATATATGTTCGTACTAGTCTTCTGACACCGTGTTTAGCT	Os08g0443800	AK110630	CD9/CD37/CD63 antigen family protein.
2849	34	44	Os12g0591200|COMBINER|CI155889|6	TCTTGTGGTGCCTTTTTCCTGCTTTTCAGCTTTCTAGGACAGCATCTCTACTTTCAGTTT	Os12g0591200	CI155889	(No Hit)
2850	34	45	Os01g0856500|mRNA|AK103239|CDS+3'UTR	CTCTGGCGATATATATGTGATGGTCGTCATGGCTTATAAAGATTTTCAGCTCATGTCACA	Os01g0856500	AK103239	Amino acid/polyamine transporter II family protein.
2851	34	46	Os02g0804100|mRNA|AK062523|CDS+3'UTR	TATATGAAGAGAAGGATGAGATCTAAATGAGGTTGCAGCAACAAGGGGCATTGGATGGGT	Os02g0804100	AK062523	Ribosomal protein S30 family protein.
2852	34	47	Os05g0129700|mRNA|AK111878|CDS+3'UTR	TGCATCCCCAGTTAAAACCATTTTAGACAGGAAAGAGTGAACTATGAGTAATAGTAACAT	Os05g0129700	AK111878	KNOX class homeodomain protein (Knotted1-type homeobox protein OSH71).
2853	34	48	Os07g0122400|mRNA|AB110197|CDS+3'UTR	GAGTTCATGGTGGACTACCATCCAACTCAATTGTATCTGATCATAGTATTTCCCCGTTTG	Os07g0122400	AB110197	Protein prenyltransferase domain containing protein.
2854	34	49	osa-miR167c|Os03|5'seq	TGTCCAAGGGAACGAGTGAAGCTGCCAGCATGATCTAGCTCTGAATGATCAACAAGATGT			miRNA
2855	34	50	Os10g0452300|mRNA|AK121664|CDS+3'UTR	GGTGTAATTGAATGTTTGATCAATATGTTATTCCAAATGCATGATAATTCACGATCGAAC	Os10g0452300	AK121664	Eggshell protein family protein.
2856	34	51	Os08g0536000|mRNA|AK104686|CDS+3'UTR	GGTTGATGTCAATAACATGTATGTAATGGAGCTCCATAAGTCGGCAAACCAAACCCCCAT	Os08g0536000	AK104686	Similar to Pyruvate dehydrogenase E1 beta subunit isoform 1 (EC 1.2.4.1).
2857	34	52	Os09g0447900|mRNA|AK111436|CDS+3'UTR	CACACAAATTGAGAAGTCACTGTATGTCTGTATAATACTGAAACTCCTGCGCAAAGTTGT	Os09g0447900	AK111436	Conserved hypothetical protein.
2858	34	53	Os05g0170400|COMBINER_EST|Os05g0170400|8	GTAGCAATGACAGTAATAGAGGATAGATCTGGTCGCCTCAATCTTGGGAGCAATGGATAA	Os05g0170400		Hypothetical protein.
2859	34	54	Os10g0545100|COMBINER_EST|Os10g0545100|8	TACAGCCATTGTACGCAGCCGTTGTTGCTGCAGCTGCAAACTCAACTTACTATTTGTGTT	Os10g0545100		Conserved hypothetical protein.
2860	34	55	Os05g0375100|COMBINER_EST|Os05g0375100|8	CTCTTCGAAGGCTACTCGGTCTTCAGAGAGTATCTGAATGAAGCTCTAGTTGAGATCCTT	Os05g0375100		Hexokinase family protein.
2861	34	56	Os06g0175500|mRNA|AK058599|CDS+3'UTR	TGGGTGATTCGGGATAAGATTAATTATTGGATTATTCATGGACATTGATCGAGTACGATT	Os06g0175500	AK058599	Epsin, N-terminal domain containing protein.
2862	34	57	Os01g0719400|mRNA|AK063516|CDS+3'UTR	TAGCTTGTATTTGGTGAACCAGAATAGTAATTGCGTCAGTGTCTGCCAAGGGTACTGTAT	Os01g0719400	AK063516	Conserved hypothetical protein.
2863	34	58	Os02g0743500|mRNA|AK100319|CDS+3'UTR	TCTCTTTTCCTTTATCTCGTGTTCTCCACCAAATGGTGGTATTTGTGTAATATGGCAAGA	Os02g0743500	AK100319	Similar to EDR1.
2864	34	59	Os01g0261500|mRNA|AK063838|CDS+3'UTR	TTCCATTATGTCCTCTTCCATTCGAGTGACTGGTTCTGGGCATATACTCTATATTATATG	Os01g0261500	AK063838	Conserved hypothetical protein.
2865	34	60	Os02g0132300|mRNA|AK070078|CDS+3'UTR	ACTGCATTGCAATAACCAAATCCATCAATTGTTGTTGTGCTGGCATAAATCAGGCTAATT	Os02g0132300	AK070078	Similar to Erythrocyte membrane protein PFEMP3 (Fragment).
2866	34	61	Os05g0101300|COMBINER|CI474834|x	TGGCTCTAGAGTTGCATGAATGTATGGATCTATGCTTATATGCACCTCCTCACTAGTCTG	Os05g0101300	CI474834	Hypothetical protein.
2867	34	62	Os03g0215900|COMBINER_EST|Os03g0215900|8	CTGGTTCTTGACGACGAGCGTCGCGGCCAGGCACTGGCTGGAGACAAAGAAATCGGCAGA	Os03g0215900		Similar to 67kD chloroplastic RNA-binding protein, P67.
2868	34	63	Os07g0635600|mRNA|AK119502|CDS+3'UTR	GCGACGGCGGCGAATCGTGGGCAGCGCTCGCAGAGGAGACCGGCGTGGTGGAGAGGCGAG	Os07g0635600	AK119502	Non-protein coding transcript, unclassifiable transcript.
2869	34	64	Os08g0223900|COMBINER_EST|Os08g0223900|8	ACTATCAGACCTCTAGCATCAAGCAAACAAATATAGCTCCATCTGCTGGCAATGCTGCTC	Os08g0223900		Similar to Cycloartenol synthase (EC 5.4.99.8) (Fragment).
2870	34	65	Os02g0688500|mRNA|AK102212|CDS+3'UTR	GTACTCATGGATGTGGCAACTCGCATGGATTGTCAGGCACTAATATGGTCTCTGGTTAGC	Os02g0688500	AK102212	ALG6, ALG8 glycosyltransferase family protein.
2871	34	66	Os10g0574800|mRNA|AK072719|CDS+3'UTR	CGTTGTAATGACCGTTTCATACCATATAATACCCAGTACATATTTTAGCCATATGGAAGG	Os10g0574800	AK072719	Similar to ARF GAP-like zinc finger-containing protein ZIGA2 (Fragment).
2872	34	67	Os08g0459600|mRNA|AK104843|CDS+3'UTR	TCTAGCCTATGTAAACCTTGGGTCATCAGCACAGATTGTATCTATATGTGTATTGCATAA	Os08g0459600	AK104843	Similar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3).
2873	34	68	Os05g0440100|mRNA|AK059585|CDS+3'UTR	TGTGGCTTATCTACTGTTGTATAAATTATGAACATGGAAGTGTGGTGCTTGTCGATTTGC	Os05g0440100	AK059585	Histone deacetylase superfamily protein.
2874	34	69	Os05g0392900|COMBINER|CI522528|x	TCTTCGGCCTGTTCTAGGCTGTGGCAATTAGTGCTTGAGCTATGGATCTGTCTAGTAAAT	Os05g0392900	CI522528	(No Hit)
2875	34	70	Os12g0555000|mRNA|AB127580|CDS+3'UTR	TGTGAGAGTGATTTGTGTTTGAGGTTATGTAAGAAATAAATCATAATTGTGATCGTGTTC	Os12g0555000	AB127580	Similar to Probenazole-inducible protein PBZ1.
2876	34	71	Os01g0940600|mRNA|AK070587|CDS+3'UTR	GAAGAATCGTCCTGAGTTCAAATCTGCTTTGTTTCAGAATCGTATCAAATACCGAAATAC	Os01g0940600	AK070587	Conserved hypothetical protein.
2877	34	72	Os02g0562300|mRNA|AK104737|CDS+3'UTR	TGTGATGCTTAGTTGAATCCTGTACGAACCTTAACCAGAACTGTGTACATTTAATTGTTT	Os02g0562300	AK104737	Calmodulin binding protein-like family protein.
2878	34	73	Os04g0411700|COMBINER_EST|Os04g0411700|8	CCACCGCGGCCGGCCCCGGCCTCCTCCGGCGGGTTTGTGATTTTGCCCCTGCTTTTTTGA	Os04g0411700		Hypothetical protein.
2879	34	74	Os06g0714100|mRNA|AK121079|CDS+3'UTR	CTATGCCTATGCATCATTTATCTTTCAGTCAAGCATAAACTGCTTAATGTGTTACGTTCG	Os06g0714100	AK121079	Complex 1 LYR protein family protein.
2880	34	75	osa-miR395o|Os04|5'seq	GAGTTCTCTTTAAGCACTTCATACGACACCATTATTGTTAGGGTTGTTATGAAGTGTTTG			miRNA
2881	34	76	Os01g0850700|mRNA|AK065154|CDS+3'UTR	TTTTTTCCTCTCCGGGGGAACGTGTAAACTGTAAAGCAACAAATGTCAAACTTCAGATTC	Os01g0850700	AK065154	Cupredoxin domain containing protein.
2882	34	77	Os05g0317700|mRNA|AK121364|CDS+3'UTR	CTTATCAAGTAAATAATTCTGCATACCATTTTTAAGAAGTAATGCTACTGTTTGAGTGGT	Os05g0317700	AK121364	Similar to Resistance protein candidate (Fragment).
2883	34	78	Os12g0454600|COMBINER_EST|Os12g0454600|8	GGCGGGAGCCGAGCCGGCGTGGGGTTGTTGGGGGTAGCTGTTGGGGTGGGGTTGGCAGTT	Os12g0454600		Cupredoxin domain containing protein.
2884	34	79	Os03g0284400|mRNA|AF095709|CDS+3'UTR	TAGAATTCCTGTACTTTTACTGCCTCACGTTTGAATTGAATCACAAAAGTTTTACCTCTT	Os03g0284400	AF095709	Similar to Ribosomal protein L10-like.
2885	34	80	Os05g0461000|mRNA|AK104166|CDS+3'UTR	GGTTCAGTTTTGCGAGTATTTAAAAAACTGCACAAACAAGATTGTGAACGGTGATTGTTT	Os05g0461000	AK104166	Clathrin adaptor complex, small chain family protein.
2886	34	81	Os11g0537800|mRNA|AK107113|CDS+3'UTR	CCACCGCTCTCACCGATGCTGCCGCCACCGCCGCCCTAGCCGAGGCTGCCACCATCGCCG	Os11g0537800	AK107113	Conserved hypothetical protein.
2887	34	82	Os05g0188500|mRNA|AK100219|5'UTR+CDS	GAAAATCCATTAACCGAGCTTACTGACATGGATGGAACCAATCTAGTTCGGATGCTGCGA	Os05g0188500	AK100219	Armadillo-like helical domain containing protein.
2888	34	83	Os01g0110200|mRNA|AK109646|CDS+3'UTR	CTTCTTGCTGGCTTGTAATAATTTTTTGGCATGCATTTTTATATATTTTTTCTTGACTTG	Os01g0110200	AK109646	Conserved hypothetical protein.
2889	34	84	Os11g0112800|mRNA|AK120247|CDS+3'UTR	GTGCACATACTTGTGCTGCTATCTGAATTCTGAAAGTAATGCTATGATTACTTTTTTGTG	Os11g0112800	AK120247	Saposin B domain containing protein.
2890	34	85	DarkCorner		
2891	35	1	DarkCorner		
2892	35	2	Os02g0136400|COMBINER_EST|CB638965|7	GCACTTTATTTGCCCTGAGTTGCAGTCCTGTTAACATGAGGATGCCAAATGGCATGATGT	Os02g0136400	CB638965	Conserved hypothetical protein.
2893	35	3	Os08g0282100|COMBINER|CI096691|6	TTAGATTTAGCTTGTTTGGAAAACTTGTGTAACAAATTAAGTACAAATAAAAGTAAGGTG	Os08g0282100	CI096691	Conserved hypothetical protein.
2894	35	4	Os09g0385300|mRNA|AK120455|CDS+3'UTR	TGAAAACTACGCGGGTTCAATTCGTTAATTTATCAGATTGTTCTCCAGAAAGTCTAATTC	Os09g0385300	AK120455	Hypothetical protein.
2895	35	5	Os04g0625000|mRNA|AY224500|CDS	AGGCTTTTATTGCTGCATGCAGTTGTGCTAGAGGAGACATTATGGTTGTGGAAGAAGCAG	Os04g0625000	AY224500	Conserved hypothetical protein.
2896	35	6	Os06g0715200|mRNA|AK066293|CDS+3'UTR	GTGTTGCTGTGTTGGCGAAGATTGGTCGAGGAATCAGAATGTATAAATTGCACTGCACAA	Os06g0715200	AK066293	Conserved hypothetical protein.
2897	35	7	Os03g0835400|mRNA|AK105896|CDS+3'UTR	AAGCGCCCTTGTAATGTGATTCTGCAAAAATAAGTGTCATTTCATATGATCACACAAGCA	Os03g0835400	AK105896	Similar to Uvs101.
2898	35	8	Os06g0287000|COMBINER_EST|Os06g0287000|8	AATCAAGACCGTCCAGGTATGGACGGTCAAATGTTATGATTTAAGGACCGTCAACAGCTG	Os06g0287000		Similar to NBS-LRR disease resistance protein homologue.
2899	35	9	Os07g0212400|mRNA|AK119367|CDS+3'UTR	CTGATGATTGTCTATGTAATGCAAAATACTATATTTAATATATAATCGATTATCATGATT	Os07g0212400	AK119367	Conserved hypothetical protein.
2900	35	10	Os02g0721600|mRNA|AK111506|CDS+3'UTR	CAGAATTTGAAGTCGTTTACCCGATAATTCAATTAATAAAACTTGTACCCTTCTGTATGT	Os02g0721600	AK111506	Similar to WD-repeat protein-like.
2901	35	11	Os07g0450900|COMBINER|CI106257|6	TGTAAAACTAGGGGGGCATATATATATCAGCATGCAGTAAATTTTCAATTTTGTTTGCGC	Os07g0450900	CI106257	(No Hit)
2902	35	12	Os02g0301100|mRNA|AK071676|CDS+3'UTR	TAATTTACTGTCTTATTTACAGGAGGAGGGCCTGGCTGCTCTTGTTAAAAACAGCTAGCC	Os02g0301100	AK071676	MtN3 and saliva related transmembrane protein family protein.
2903	35	13	Os04g0419200|mRNA|AK064626|UTR	GGCTAACACCGATGGTAGCTTCAAAACAAGAAGATCATGTAAATTCATCCTTGTTATCAA	Os04g0419200	AK064626	Non-protein coding transcript, uncharacterized transcript.
2904	35	14	Os01g0267800|COMBINER_EST|Os01g0267800|8	GTGCGGACGAGCAAGATCGAGTGCACGGAGCACTCCGGGTCAGAGGGGAGCGGTGCACAA	Os01g0267800		Protein kinase-like domain containing protein.
2905	35	15	Os09g0314300|mRNA|AK101689|CDS+3'UTR	TGACCAGGGTTTCAATGGTTTATGTAAAGTGTGATATACATGTTACTATTTCTTTGCTCC	Os09g0314300	AK101689	Peroxin-3 family protein.
2906	35	16	Os03g0435200|mRNA|AK120095|CDS+3'UTR	GTTTGGTTGTACACACTTGCAGTGAAGTACTCCTACAATGATTCAAATGTGGACAATTGT	Os03g0435200	AK120095	Protein prenyltransferase domain containing protein.
2907	35	17	Os01g0773100|mRNA|AK100668|CDS+3'UTR	GTAGTCAGGTACCTTCATTTTGATGAAATATCAAAAGTTGAAATGTACTACGGTGATTGG	Os01g0773100	AK100668	Conserved hypothetical protein.
2908	35	18	Os05g0429700|mRNA|AK059651|CDS+3'UTR	ATAGGCAGGCGCAAGCTAATCTTCAGTGTATTTTGTTTATGGATTTGTGCCAATTTTGTT	Os05g0429700	AK059651	C2 calcium/lipid-binding region, CaLB domain containing protein.
2909	35	19	Os04g0494900|mRNA|AK073892|CDS+3'UTR	AGAGTGCTACTGAAAATACACTATGTTACACCAAGATGCATTGTTTTAACATTGTACTGC	Os04g0494900	AK073892	Similar to Unidentified precursor.
2910	35	20	Os01g0834400|mRNA|AB095438|CDS+3'UTR	ATGTATCAGGTGGCACAAATCTATTGCAAGTACCCTAGCATTGAATAATGCTGGTTAACA	Os01g0834400	AB095438	Similar to HAP3.
2911	35	21	(-)3xSLv1		
2912	35	22	Os03g0268300|mRNA|AK102684|CDS+3'UTR	AAGATATCTTGTCTGGTGTTTCACAACCATTTTTGTTGGCGTGCTGCTGCTCCTTTTCCA	Os03g0268300	AK102684	Similar to Digalactosyldiacylglycerol synthase 2.
2913	35	23	Os07g0265600|mRNA|AK101842|CDS+3'UTR	GATGGTAGGTTTATGAATTCAAGACGCTAACTTTGCGCCATATCTAATTGTCAACCAGTT	Os07g0265600	AK101842	Stem cell self-renewal protein Piwi domain containing protein.
2914	35	24	Os02g0102900|mRNA|AK101537|CDS+3'UTR	AGAGCTGAAACAGTGCAACATAATGTTTTTAAGGTTGAGAATTATGCAAGCTGAAGTAGT	Os02g0102900	AK101537	Similar to RuBisCO subunit binding-protein beta subunit, chloroplast (60 kDa chaperonin beta subunit) (CPN-60 beta) (Fragment).
2915	35	25	Os01g0246100|mRNA|AK120732|CDS+3'UTR	TATTGAACAAAGGCACATTTTGTTCAGTGTTTCTGTGCCGTGGCAAAAGTCCAAATTCAA	Os01g0246100	AK120732	Protein of unknown function DUF902, CREBbp domain containing protein.
2916	35	26	Os02g0649000|mRNA|AK062294|UTR	GTTGTGAAATAGGAGTAGCAAAACTGAGGAAAATGTTCCTATCAGTACAAATAAGACTTC	Os02g0649000	AK062294	Non-protein coding transcript, unclassifiable transcript.
2917	35	27	Os03g0582000|mRNA|AK070707|CDS+3'UTR	TTTGCACAGATGATTCATACCTGTGTAATGATGCATGAAAAACAATAACCAATTTTATCT	Os03g0582000	AK070707	Formiminotransferase, N-terminal domain containing protein.
2918	35	28	Os05g0195400|mRNA|AK072351|5'UTR+CDS	CGGGAGCCCACCGCCTCTCCGCCCGTGGGGACTTCGTCGCAGGGGCCGCAGGAGCCCACC	Os05g0195400	AK072351	Conserved hypothetical protein.
2919	35	29	Os01g0343200|mRNA|AK058467|CDS+3'UTR	CTTGGAAGCTGTAAAGCCATAGTTTACATTGTTGTTAATCATGAGAACCCAGTGGGTTTT	Os01g0343200	AK058467	Similar to Importin alpha-1b subunit.
2920	35	30	Os06g0641200|COMBINER_EST|Os06g0641200|8	CCGAGGTGCGGCGTGCCTTCGCTGCGGACGGGGTGGTGTTGGAGAGCGCGCTCGGCAAGC	Os06g0641200		Similar to Elicitor-inducible cytochrome P450.
2921	35	31	(+)E1A_r60_a20		
2922	35	32	Os01g0110100|COMBINER|CI532153|0	ACAGTGATCCGTTCCTAGATGCATTAACATGTATAAAATACGCATCGCAGTATCGCAAAT	Os01g0110100	CI532153	Conserved hypothetical protein.
2923	35	33	Os05g0311600|mRNA|AK069819|CDS+3'UTR	ATTTTTGGACCCATGAGTTTTTAGACTTGGTGAATTTTGACTTAGGGATGAAATTGGGGT	Os05g0311600	AK069819	Similar to Transposase.
2924	35	34	Os04g0379400|mRNA|AK104861|CDS+3'UTR	TTTTTTCTAGACAATGAGTGTATTTACTCAGATAAGAAGAAAAATTACCTCACCTGCTAT	Os04g0379400	AK104861	Conserved hypothetical protein.
2925	35	35	Os03g0750800|mRNA|AK061386|5'UTR+CDS	GATGCTGAACAGGCACTCGCTGAGATGGAGTTTAAAGAAACTGATTCGGAAACTGATCGT	Os03g0750800	AK061386	Similar to Transcriptional adaptor (Fragment).
2926	35	36	Os05g0556900|mRNA|AK058689|CDS+3'UTR	TTATTTGAAGGCTTTTTAGCGGATTTGAAGCTACAGAGGTTTAGCATTTGTATCGTGATC	Os05g0556900	AK058689	Ribosomal protein L35Ae family protein.
2927	35	37	Os03g0452000|COMBINER|CI420549|6	TTTATCTGATCAAGGTTTAGACTTATTCTTTGAGTGATGCGGGTTTCGATTGCTTCTTTT	Os03g0452000	CI420549	(No Hit)
2928	35	38	Os08g0312000|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os08g0312000	CI274096	(No Hit)
2929	35	39	Os02g0202600|mRNA|AK099277|CDS+3'UTR	TGGCCCAACTCCTTGAAAAGGTAGACTTGAGTTGATCCCCTTTCTCTACAAAGGATTTTT	Os02g0202600	AK099277	Tetratricopeptide-like helical domain containing protein.
2930	35	40	Os08g0366000|mRNA|AK073703|CDS+3'UTR	TTTTTTGTGTAGACCACATAGTGAGTGTGTTGAAATTCCATTTGCTTAATGAAACTGCCA	Os08g0366000	AK073703	Phosphoenolpyruvate carboxylase.
2931	35	41	Os06g0578700|COMBINER|CI550812|x	CAATGCATGTAAGATCGAGTTTACACTTTATAGCAAGCTAATTAAGCTCTGTTTATTGCC	Os06g0578700	CI550812	(No Hit)
2932	35	42	Os05g0415200|mRNA|AF439787|CDS+3'UTR	AATTTCAGAGCCTTGTTTCTACGGACGATCTTCCTGATCCTCTTAAACTGGAGGTGTGCT	Os05g0415200	AF439787	Similar to Phytochelatin synthase.
2933	35	43	Os03g0789500|mRNA|AK059333|CDS+3'UTR	AGTGACCTTGTAGAAACTTTCACATTTCTTTTAATAGAAATGGAGGGGTATTGCCCTTTT	Os03g0789500	AK059333	Hypothetical protein.
2934	35	44	Os02g0807100|mRNA|AK103831|CDS+3'UTR	AAACTTACGCTGTTAAAACAAAAATTTTTATGCTGTCACATCAAATGTTTGAATACATGT	Os02g0807100	AK103831	Similar to Wall-associated kinase-like protein.
2935	35	45	Os02g0829100|mRNA|AK103235|CDS+3'UTR	CCAGTGAAATTACATGTAACCGTATCTGTATTACGAGTAGCACATATCGAGTGACAAAAC	Os02g0829100	AK103235	Replication protein A 30kDa.
2936	35	46	Os03g0120600|mRNA|AK121692|CDS+3'UTR	ATAGTTAGCCACAAATTTGTAAATACCCGTATATTTTGTAATAACATCTCCTCTGGAGCC	Os03g0120600	AK121692	Conserved hypothetical protein.
2937	35	47	Os08g0254600|COMBINER|CI549230|0	TTCTCATCGTCTCAACATGTATTAAGTACTCAGCCAATTCTACTATAGCTGATGAGGTCT	Os08g0254600	CI549230	Cyclic nucleotide-binding domain containing protein.
2938	35	48	Os02g0804800|COMBINER|CI396925|3	TATCATAGAAGCATGCTCACGGTTAACCTGGTATTCACTCTTCAGAATTAAGTTTAACAA	Os02g0804800	CI396925	Hypothetical protein.
2939	35	49	Os02g0327500|mRNA|AK069802|CDS+3'UTR	TGAATGTAAAGAGCACAAGGAACTATATTTTTTATACTAACCACACATGGAATATAGAGT	Os02g0327500	AK069802	Protein of unknown function DUF266, plant family protein.
2940	35	50	Os01g0738600|mRNA|AK073479|CDS+3'UTR	ATGTGTGATACACGCTCATATGAATTTTGAAAAATGAATAACGCAAAGCATTCTGGATGC	Os01g0738600	AK073479	ENTH/VHS domain containing protein.
2941	35	51	Os01g0960400|mRNA|AK111512|CDS+3'UTR	AAGTAGTGTAATGTAAATCGAATTTTATTTGCTGAAAATAATATCATTGGATTGGTATTT	Os01g0960400	AK111512	Protein kinase-like domain containing protein.
2942	35	52	Os11g0293900|mRNA|AK071663|CDS+3'UTR	GGTCGCCACAGTACAGACCGAGCACTGGACCCTGGAATCGTCCTGGAGAGGACACTGCTT	Os11g0293900	AK071663	UBX domain containing protein.
2943	35	53	Os02g0475300|mRNA|AK072737|CDS+3'UTR	ATGTGCGTCTGCCCTGTAAATGCAAAGAAAAAGGAAAACGTAAAACTCGAGGTTCAGTCT	Os02g0475300	AK072737	Membrane attack complex component/perforin/complement C9 family protein.
2944	35	54	Os04g0643300|mRNA|AK120067|CDS+3'UTR	TGGTCAGCGTTCTGGCACTGATAATAAGCATGTAAGAAAGTGATGGATGTTTGTTGTAGG	Os04g0643300	AK120067	Similar to 3-ketoacyl carrier protein synthase III.
2945	35	55	Os03g0135200|mRNA|AK059226|CDS+3'UTR	CAGGTCATTTGTTTTCTCCCTTGTTTAGTGATTAAATAAAATTGTTAATCGACCTGGCAG	Os03g0135200	AK059226	Similar to Glutathione S-transferase GST 9 (EC 2.5.1.18).
2946	35	56	Os12g0525800|COMBINER_EST|CI058802|6	CTGTCGGTATTGGAAACGTCTTCAGTTCTTTGATTCATTCCGTGGCGCGAAATCCTTCAT	Os12g0525800	CI058802	Hypothetical protein.
2947	35	57	Os01g0559600|mRNA|AK068011|CDS+3'UTR	TATTACCTGCCATCATTGCTGTACATACTTATAGCTTGCTATATGTAGTTTGTAGCTACA	Os01g0559600	AK068011	Similar to C13 endopeptidase NP1 precursor.
2948	35	58	Os01g0650200|mRNA|AK066857|CDS+3'UTR	CTCGTTGATAGCTTGAATAAAAATTCTCTGATTGTGTTTCAGGAATTGAGAATCCTTTGG	Os01g0650200	AK066857	Lipolytic enzyme, G-D-S-L family protein.
2949	35	59	Os02g0667500|mRNA|AK059662|CDS+3'UTR	AATGATGGCCTACATATTTCGGCCGGAGCTTCAGACATGAGTTAATGCCAATGGTAGTAC	Os02g0667500	AK059662	Major facilitator superfamily MFS_1 protein.
2950	35	60	Os12g0418900|mRNA|AK064683|UTR	AGCGAGCTTTCATTTTTGCATCTTCCCCAGATCACTGCTGGTCAACAGGTCAACAAAAGA	Os12g0418900	AK064683	Non-protein coding transcript, uncharacterized transcript.
2951	35	61	Os08g0465800|mRNA|AK121088|CDS+3'UTR	AGCTATTTGGTGGTTTGTTTTCAACTTTTCCATGTACACCTGGGGCTTGCCAATCTCCTT	Os08g0465800	AK121088	Glutamate decarboxylase (EC 4.1.1.15).
2952	35	62	Os08g0485600|mRNA|AK064883|CDS+3'UTR	TGAGTGGAGATGAAAGAATCTTGTGGTATTATTTGGTTGGTCAAATCTTTGTGGTATAGT	Os08g0485600	AK064883	Methyl-CpG binding domain containing protein.
2953	35	63	Os08g0181800|COMBINER|CI148322|6	TTTGGAAGCGGCAAATGTGAACTATGGCATAATAATGCATGTATTGTCTTGCTGTGTTGC	Os08g0181800	CI148322	(No Hit)
2954	35	64	Os02g0689900|mRNA|AK065840|CDS+3'UTR	ATGTACGCCTGTGTTTCATCGTTTCACATTTTTCTGGCCAATGTAACAAGAGAACGCGAC	Os02g0689900	AK065840	TGF-beta receptor, type I/II extracellular region family protein.
2955	35	65	Os01g0617500|mRNA|AK111993|CDS+3'UTR	GTTAACCATGTGTGTTTCGTGTGTGCAATACGTTGGGTATGCAACAATCAATCAGTCGAG	Os01g0617500	AK111993	Tetratricopeptide-like helical domain containing protein.
2956	35	66	Os03g0698100|COMBINER|CI138407|6	CTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGG	Os03g0698100	CI138407	(No Hit)
2957	35	67	Os07g0546500|COMBINER_EST|Os07g0546500|8	ACCTGTGGTGAGCAAAAAGGAAATGGAAAGTTTTTGTCAGGCGCACCGAAGCACAAAGAT	Os07g0546500		Conserved hypothetical protein.
2958	35	68	Os01g0667900|mRNA|AK105335|CDS+3'UTR	CCCACCATGTGAATACGGAGCGAGAGAGGAAGAGGGACAGTGACATTTGCCACATCTGTA	Os01g0667900	AK105335	Glutaredoxin-like, plant II family protein.
2959	35	69	Os03g0412200|mRNA|AK061834|CDS+3'UTR	GATCCATGTCTATTCCGTTTGTCATTGCCATGATTAATGTGCCTAATACATCATCGTCGT	Os03g0412200	AK061834	Conserved hypothetical protein.
2960	35	70	Os01g0742400|mRNA|AK119360|CDS+3'UTR	TGACACTGTTAATTTTGTACTCTCCTTTTGTGCCGTATTCTATACAGAACATGTCTAGTT	Os01g0742400	AK119360	Protein kinase-like domain containing protein.
2961	35	71	osa-miR399g|Os02|Mature	TGCCAAAGGAGATTTGCCCAGTGCCAAAGGAGATTTGCCCAGTGCCAAAGGAGATTTGCC			miRNA
2962	35	72	Os02g0573500|mRNA|AK119890|CDS+3'UTR	GTTCTGTCTTGTGTAACGCAGACACGGTAGAGTCTGACCATCAAACGTTACTTATCACAT	Os02g0573500	AK119890	Similar to Monosaccharide transporter 1.
2963	35	73	(+)E1A_r60_n9		
2964	35	74	Os01g0848200|mRNA|AK064210|CDS+3'UTR	ACTATGCTCCTTTATGGCCCGTCCGCCGCCTACTCTTTCTTTATTATCATTGTGATTCTA	Os01g0848200	AK064210	Similar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
2965	35	75	Os07g0492000|mRNA|D16292|CDS+3'UTR	CTTATATGGCTTTTTAAGTTTCTGGATTGGATGTGATGGGAAAATAATACTAGCAGTCAG	Os07g0492000	D16292	Nucleoside diphosphate kinase I (EC 2.7.4.6) (NDK I) (NDP kinase I) (NDPK I).
2966	35	76	Os01g0810700|mRNA|AK109802|UTR	CTTCTTGCTTATTTGCAGCTTCTTTCATGTACTGTGACAGAATACTGAAGGTCTTGCCGC	Os01g0810700	AK109802	Non-protein coding transcript, uncharacterized transcript.
2967	35	77	Os10g0418100|mRNA|AK109037|CDS+3'UTR	GATATTATACCATCTTGTTATTTGCCATATATAATATGATATATGATTTGTTTGGTTCAT	Os10g0418100	AK109037	Similar to Calcium-transporting ATPase 8, plasma membrane-type (EC 3.6.3.8) (Ca(2+)-ATPase isoform 8).
2968	35	78	Os06g0199500|mRNA|AK064613|CDS+3'UTR	TGAACTTGAAGTTGAACTGCATATGGTTGGCCATGGTGTATGTTGAAATAGTAACACAGT	Os06g0199500	AK064613	Similar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC).
2969	35	79	Os03g0685000|mRNA|AK098989|CDS+3'UTR	TGTAAACTGAACACCTAATCTTGAGTGCGAATAATGAATAATGATCACCGGAGTTATGAG	Os03g0685000	AK098989	Similar to Ferredoxin.
2970	35	80	Os08g0487100|mRNA|AK107150|CDS+3'UTR	AGCCCGGCAACATGTGCCACGAAACAAATCTAGGCTTTTGTCAATACATAAACGTGAGTG	Os08g0487100	AK107150	Similar to BZIP transcription factor BZI-2.
2971	35	81	Os01g0113400|mRNA|AK073168|CDS+3'UTR	GAGGCTACATATTGTTGTAAACAGATGTTTCATCGCATTGTTGTAATTTGAAAGTGATTT	Os01g0113400	AK073168	Similar to TAK19-1.
2972	35	82	Os01g0182900|mRNA|AK061255|CDS+3'UTR	CCGTACTCGTGGTGCCTGATGTCTGTAGTTTGTTGTAAATTCCATTGACCCAACCATGAA	Os01g0182900	AK061255	Conserved hypothetical protein.
2973	35	83	Os03g0599800|mRNA|AK061813|CDS+3'UTR	TTTAATAACCTTTGCAAATCACTATACCTGTTGGTTGTTCTGAGAATTGTATGCACTACC	Os03g0599800	AK061813	Reversibly glycosylated polypeptide.
2974	35	84	Os12g0441200|COMBINER_EST|Os12g0441200|8	CGCCGACGACGCCGCGACGAACTTGACGACACCGGCGGAGCTTGAAGGAGATGGCACCGG	Os12g0441200		Conserved hypothetical protein.
2975	35	85	Os07g0470800|COMBINER_EST|Os07g0470800|8	TCAACGAAGGCTACTGCAGAGGAGAAATTCAAGCACTGCAGTGCAGCATACCAAACATTA	Os07g0470800		Similar to Chaperone protein dnaJ.
2976	36	1	Os06g0644200|mRNA|AK099807|CDS+3'UTR	TGGGAATGTTAGGATGATCTTGTACAAAAAAGAAAACAACTCTAGTGATAGGGGGTGGAG	Os06g0644200	AK099807	Similar to Pyrophosphate-energized vacuolar membrane proton pump (EC 3.6.1.1) (Pyrophosphate-energized inorganic pyrophosphatase) (H+-PPase) (Vacuolar H+-pyrophosphatase).
2977	36	2	Os01g0923700|mRNA|AK067355|CDS+3'UTR	TTTTTTCTGCAAGGTTTGTGGAAGCTGTAAATGACACAATTCAAAGGTGAAGCCTTTGGT	Os01g0923700	AK067355	Similar to Histidine kinase-like protein.
2978	36	3	Os01g0124400|mRNA|U76004|CDS+3'UTR	TCGCTTGTGTGGACCATGAGGAAAAATAAAATAAATATGCAATGCAAGCGTGGATATGTA	Os01g0124400	U76004	Similar to Bowman Birk trypsin inhibitor.
2979	36	4	Os07g0242600|mRNA|AK065752|CDS+3'UTR	GACATTATTTAGAGTTGCTGCAACTTTGTATCATAGCTGCTAGCCAGTTGGTTGGATACT	Os07g0242600	AK065752	Cyclin-like F-box domain containing protein.
2980	36	5	Os12g0485600|mRNA|AK100852|CDS+3'UTR	CCCAGCTGGCCTCCGCATTGTGGGTGTGCTTGTCATATGGTTATATGAATGATATATGAT	Os12g0485600	AK100852	Amino acid/polyamine transporter II family protein.
2981	36	6	Os04g0671900|mRNA|AB071298|CDS	TTTCACCTGAGGATGTGCATAAGATGGGAAAGCAAGGAAATGATCCACGGTATCTGTCCT	Os04g0671900	AB071298	Similar to P-167-1_1 (Fragment).
2982	36	7	Os05g0540800|mRNA|AK071090|CDS+3'UTR	AATCAATCCTGTAATCTTGGACAATTTAACGAGGAACCGCGATCCCAATGCAAACCTGAG	Os05g0540800	AK071090	Homeodomain-like containing protein.
2983	36	8	POsControl0040|art		
2984	36	9	Os02g0771100|mRNA|AK102740|CDS+3'UTR	GCTCGAAATGTGCATAGTCCAGAATTCTCATGTATAGGTTTAAAGCAGTCAAGTAATTGA	Os02g0771100	AK102740	Similar to COP1 (Fragment).
2985	36	10	Os08g0200600|mRNA|AK105596|CDS+3'UTR	CCCTTTCTCTTTACTCTCTAGATGTATTTGTCATTGCAGATGAATAAAGATTTCAGAGAC	Os08g0200600	AK105596	Similar to NAC-domain containing protein 21/22 (ANAC021) (ANAC022). Splice isoform 2.
2986	36	11	Os01g0116400|mRNA|AK066041|CDS+3'UTR	TATGTGGGCTTGTACGATTTATTATCTTGTGCTTCATCTGTATGAATGCATGCAAAAATC	Os01g0116400	AK066041	Protein kinase-like domain containing protein.
2987	36	12	Os12g0590500|COMBINER_EST|Os12g0590500|8	TGGGGTTGAGGATCTTAAACTGAAGTGCAAACTACTGCATGAAAAGGCCCGTTTATCGGA	Os12g0590500		Similar to Kinesin-like polypeptides 8 (Fragment).
2988	36	13	Os08g0347400|COMBINER_EST|Os08g0347400|8	TCTTCTCATACTACTTGGTCTGCTTGGAGCTGGTACATTTTTCGTCATCCGTCAGGTTCT	Os08g0347400		Protein prenyltransferase domain containing protein.
2989	36	14	Os11g0219000|mRNA|AK066071|CDS+3'UTR	TTTGCAGAGCCAGAATTTTAAGGATGGGTATTGAGTGTACAGAACTATGTGTAATGAAAA	Os11g0219000	AK066071	Conserved hypothetical protein.
2990	36	15	Os08g0295300|mRNA|AK059095|CDS+3'UTR	ATTTCTTGACAAAAGTACATCTGATTGTCTTTTCTTAATAACGAAAGTGTGCTATTCTTC	Os08g0295300	AK059095	Similar to Threonyl-tRNA synthetase, cytoplasmic (EC 6.1.1.3) (Threonine--tRNA ligase) (ThrRS).
2991	36	16	Os01g0834500|mRNA|AK058829|CDS+3'UTR	GTAAAAACCATGCCTTGTCAGATTTTTGCTTCTGTTAAGGGGAAAGTACTGTGCTGAGCT	Os01g0834500	AK058829	Similar to 40S ribosomal protein S23 (S12).
2992	36	17	Os03g0573500|COMBINER_EST|Os03g0573500|8	AATGCAGTCCACGGTTAACTCAACGATGTCTTGATGATGAACCTGATAATCTGAATATTG	Os03g0573500		Disease resistance protein family protein.
2993	36	18	Os01g0343500|mRNA|AK071988|CDS+3'UTR	CTGAAATGGCTGATCAAACACGGTGGAAGCATTTTAAAGATTCAACCTCTGAGAAAGATG	Os01g0343500	AK071988	Hypothetical protein.
2994	36	19	Os12g0460800|mRNA|AK066287|CDS+3'UTR	TGTATTTACAAGTTGATCTGTATCAGTCTGAATCATAAATTAAGTGTTTTGAAGATGTTT	Os12g0460800	AK066287	Similar to Protein kinase AFC2 (EC 2.7.1.-).
2995	36	20	Os05g0426900|mRNA|AK073384|CDS+3'UTR	GGGTTCGTCGAGTTAAAATCGCGACGAACAAATTAAGCAAGTTAAAAACCAGCTGATGCA	Os05g0426900	AK073384	Conserved hypothetical protein.
2996	36	21	Os12g0162100|mRNA|AK062812|5'UTR+CDS	TTCATAAATGGAAATCATGGGAAAGTGAAGATTGGTGATTTTGGTTTGGCAACATTCATG	Os12g0162100	AK062812	Similar to MAP kinase-like protein.
2997	36	22	Os11g0235200|mRNA|AK100802|CDS+3'UTR	TGCAAGGATGCAAGAGTAGTGGTATTTGGGTAGGGATCAAGTGATCAAGTACGTATCTAG	Os11g0235200	AK100802	TGF-beta receptor, type I/II extracellular region family protein.
2998	36	23	Os07g0231900|mRNA|AK105271|CDS+3'UTR	ATTTTTAGCAGACCAGTATTTTTATCCTTGGTTCCTGAGTGCGAATGACGGCAGAGTTAG	Os07g0231900	AK105271	Peptidase, trypsin-like serine and cysteine domain containing protein.
2999	36	24	Os08g0531700|mRNA|AY332477|CDS+3'UTR	ATACTACCTTAAAAACTATCGGTGTCTGTTGAACATATTCTGCGATCAACTTTAAGCGTA	Os08g0531700	AY332477	Similar to Developmental protein SEPALLATA2 (Agamous-like MADS box protein AGL4).
3000	36	25	Os04g0679400|mRNA|AK099653|CDS+3'UTR	TCGCGGGTGGCATGTCATGGTACATACTATGAATGATGAATAAGAAAGAGTTTGCTTCAC	Os04g0679400	AK099653	Similar to Ripening-associated protein (Fragment).
3001	36	26	Os03g0838100|mRNA|AK119881|CDS+3'UTR	GATCAAACTCAATGGTATATTCGCGTTGTAACTTGTACAAATAATTCAAATGAGGCGATG	Os03g0838100	AK119881	Curculin-like (mannose-binding) lectin domain containing protein.
3002	36	27	osa-miR395f|Os04|Mature	GTGAATTGTTTGGGGGAACTCGTGAATTGTTTGGGGGAACTCGTGAATTGTTTGGGGGAA			miRNA
3003	36	28	Os05g0215000|mRNA|AK104258|CDS+3'UTR	GGTCATCTTGTACGGTGCTACTCCCTCTATCCCGAAATAAAACAACTTATAGAGATTGAA	Os05g0215000	AK104258	BURP domain containing protein.
3004	36	29	Os04g0569100|mRNA|AB101647|CDS+3'UTR	TGATAGTCTCGAGCTATCAACGCCTGGCAAATGCAAACCTTGTTATGCTAAAATATGTTT	Os04g0569100	AB101647	Similar to OCL1 homeobox protein.
3005	36	30	Os06g0130000|mRNA|AK119321|CDS+3'UTR	TCTTTGGAATGTTCATATTTGTTTGGTTGTGGTGTGTCATGTGCATGAATGAATCTGCTG	Os06g0130000	AK119321	Similar to Tobacco mosaic virus helicase domain-binding protein (Fragment).
3006	36	31	Os01g0611100|mRNA|AB015971|CDS+3'UTR	GTTTTGTCGGATATTTGACCAGTTCAGACAAGTTTTGGTTATCGTTGATTGATGCTATAA	Os01g0611100	AB015971	Similar to GTP-binding nuclear protein Ran-2.
3007	36	32	Os09g0434500|mRNA|AF364176|CDS+3'UTR	TCAAATAACTGCCTTGGCCATGTGTGTGCTGTAATGTGCTTATTAAGTTATATAGTTGTG	Os09g0434500	AF364176	Similar to Ethylene response factor 2.
3008	36	33	Os07g0620300|mRNA|AK099150|CDS+3'UTR	GCAGTTAATATCTACCTAGGGCAATTTATTTTTCCTTGTGTAATATGCAGGAGATACATG	Os07g0620300	AK099150	Clathrin adaptor complex, medium chain family protein.
3009	36	34	Os04g0659900|mRNA|AK060780|CDS+3'UTR	CCAGATTTAGAGGACATTGAGATGTGATAATTCCACCGTTCAGAATTGGCAATATGCTAA	Os04g0659900	AK060780	Probable translation factor pelota family protein.
3010	36	35	Os03g0180400|mRNA|AK104324|CDS+3'UTR	GTGAACCATTTCATGTAACTCCAAAAAACAGTCATCAGCTTTACTTGTTGGATCATCCTC	Os03g0180400	AK104324	Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1).
3011	36	36	Os02g0142300|mRNA|AK067944|CDS+3'UTR	ATGGATGGATGGTTAGATCGTATAGTGTCTGTTTTCTTCCCGGACTGTTAGTTGTTACTT	Os02g0142300	AK067944	Similar to Nuclear protein-like.
3012	36	37	Os06g0697500|COMBINER_EST|CI067539|0	TGAATACTACTTAAAAGTCAACGGCGTCATACATTAAAATATGAAGGTACTATTTAGCAA	Os06g0697500	CI067539	AAA ATPase domain containing protein.
3013	36	38	osa-miR399j|Os04|3'seq	CTTTTGTAGCTCACTCATTTTCAGCCCTCTGCCAAAGGAGAGTTGCCCTAAAACTGGACT			miRNA
3014	36	39	Os07g0169700|COMBINER_EST|CI271638|6	GCATCTCTTTCGTATTGTTCGAGAAAAATGTAACGTGGTAATCTATCACAAATTGAAAGG	Os07g0169700	CI271638	Similar to GA 20-oxidase 3.
3015	36	40	Os11g0546000|mRNA|AK103366|CDS+3'UTR	CCCTTAAATCGTTGGTTTTATAGGCATAAAGTTTTTGAGCTGTTACTCATGTTACCAATG	Os11g0546000	AK103366	RNase L inhibitor-like protein.
3016	36	41	Os01g0975900|mRNA|AB114829|CDS+3'UTR	CTCTTCTTCTGTACAAACAAATTACGTAAATCTCCTTTAATTCCAAAATCTGTGCTGTGC	Os01g0975900	AB114829	Similar to Tonoplast membrane integral protein ZmTIP1-2.
3017	36	42	Os07g0457300|mRNA|AK073856|CDS+3'UTR	TGTGCATTTCCAAGACATACCTTGGTTGCTATATTAGTTGATGAGATTTTAATGAGTTCC	Os07g0457300	AK073856	Protein of unknown function DUF1446 family protein.
3018	36	43	Os11g0118400|mRNA|AK067579|CDS+3'UTR	GACACTACACAGATTGCAAATGGTTCTAATGATCACATTAAACAGTGCAAGTATTCATGT	Os11g0118400	AK067579	Conserved hypothetical protein.
3019	36	44	Os08g0476900|mRNA|AK101432|CDS+3'UTR	ACATCTATGTAAGGAAATGATTCTAAACTCTCGAGAAGATATCTATGTGAGTAGTAATGA	Os08g0476900	AK101432	Similar to Patatin-like protein 1.
3020	36	45	Os02g0198900|mRNA|AK070231|CDS+3'UTR	TTATTGTGACATTGGGACCGAGTGAATGGAATGTAGACAGAATTGCCTATGCTGATACCT	Os02g0198900	AK070231	Similar to Ribosomal protein L7/L12.
3021	36	46	Os11g0152600|mRNA|AK066868|UTR	AAGTTCGACATCATGAGATTGTGGGTTAATGCCAATTCTTGTTGCTTTGAATGCAAGTGC	Os11g0152600	AK066868	Non-protein coding transcript, uncharacterized transcript.
3022	36	47	Os07g0120500|COMBINER_EST|Os07g0120500|8	CAAGACTGGAACCGGGCTCTCTGATAACTTCGATGCCACTGCTTTTGCTCTCGGGGAGTA	Os07g0120500		Protein of unknown function DUF538 family protein.
3023	36	48	Os08g0431900|mRNA|AY345220|CDS+3'UTR	CATCAGGAAAACATGGAACTACACAAGAAAGTCAGCCTTGTCCATCAAGAAAACATCAAT	Os08g0431900	AY345220	Transcription factor MADS23.
3024	36	49	Os04g0658000|mRNA|AK068928|CDS+3'UTR	TTTTCCAAGTTGATATGAAAACGCGGTTGTAAAATGAATTGCCACAAATTTCTGTCGAAC	Os04g0658000	AK068928	Similar to Possible apospory-associated like protein.
3025	36	50	Os05g0406200|COMBINER_EST|Os05g0406200|8	GGCTTGTGAGCATTAGGATAACCACACCATTACCCTGTTGGGAGGAATTAAAGATTTTGA	Os05g0406200		Inosine/uridine-preferring nucleoside hydrolase domain containing protein.
3026	36	51	Os07g0626100|mRNA|AK062899|CDS+3'UTR	GGGGGCTTACAGAGATACAATTGTAGTTGGCTCTACTGTATCGAGTGATTCGCATATGGT	Os07g0626100	AK062899	Similar to 50S ribosomal protein L7/L12.
3027	36	52	(+)E1A_r60_n11		
3028	36	53	Os09g0521500|mRNA|AK071023|CDS+3'UTR	AGTGAGACAAATGTGGGATTTTGCCCTTATTTATTCAATGATCGGTTTGAAGAGTCTGTT	Os09g0521500	AK071023	Similar to Arsenical pump-driving ATPase (EC 3.6.3.16) (Arsenite-translocating ATPase) (Arsenical resistance ATPase) (Arsenite-transporting ATPase) (ARSA) (ASNA-I).
3029	36	54	Os10g0329400|COMBINER_EST|CI244058|6	TGTACATTCTCTAAATTCTTAATATACTACGGTCGGCGTTCTTTGTCGACCCGGCGAATT	Os10g0329400	CI244058	Hypothetical protein.
3030	36	55	Os08g0364500|COMBINER_EST|Os08g0364500|8	GATCGGAAGATCCTTTTGATGTTGGCTGTACTGCTTCTCCTCACTGTTCATATGATGACT	Os08g0364500		Conserved hypothetical protein.
3031	36	56	Os04g0119400|mRNA|AF358778|5'UTR+CDS	GGTGCTCAAGCAGTCTAGCCCTGATGGACTTGATGTAACCCTGGCATTCTTTGGTGATGG	Os04g0119400	AF358778	Similar to Pyruvate dehydrogenase E1 component, alpha subunit.
3032	36	57	Os06g0153900|mRNA|AK061306|CDS+3'UTR	AGTCTTGCAGCTCAAGATGTAACTGAATGAATTAGGGACAAAAGGAATAAAAGATCCTAG	Os06g0153900	AK061306	Similar to Thiol methyltransferase 2.
3033	36	58	Os05g0228000|mRNA|AK064229|CDS+3'UTR	GACGTTATTGTTCTGATTAAACTTTATATTATTGACACATTTTTTAAAAAAGAAACAGTT	Os05g0228000	AK064229	Purine and other phosphorylases, family 1 protein.
3034	36	59	Os01g0530500|mRNA|AK105280|CDS+3'UTR	TGGTGGTCACATTATGGAACCATTCAACTCCTGTTTTAGGGTGGTGGTCTCTGATTTTCT	Os01g0530500	AK105280	Protein of unknown function DUF295 family protein.
3035	36	60	Os02g0313400|mRNA|AK073608|CDS+3'UTR	ATTTACATCCCTGACCGTTTGTTAGTTGACCAGTTCTACTTGTTTTGGTGGTTCGATGAA	Os02g0313400	AK073608	Apoptosis inhibitory 5 family protein.
3036	36	61	Os01g0976200|mRNA|AK061022|CDS+3'UTR	CTCTGTTTTAAAGTCAACAGCCGTTCGATTCGATCTGCCATGCATGAACGAACTGGTTTT	Os01g0976200	AK061022	11-S plant seed storage protein family protein.
3037	36	62	Os05g0562200|mRNA|AK109438|CDS+3'UTR	CTACTTCTGTGAGAGTATAATAAACCAAGTTTACAACTGGTTGGTTTTGGAAGATTATGC	Os05g0562200	AK109438	Drought induced 19 family protein.
3038	36	63	Os12g0244100|mRNA|AK072071|CDS+3'UTR	AAAGAGGAGGCAAAGGTTTTGATCGAAGAAGTAGCTGATTGATATGACCTTGTTCCTTGA	Os12g0244100	AK072071	Similar to Heat shock 70 protein.
3039	36	64	Os02g0627100|mRNA|AK068993|CDS+3'UTR	GTGGCAGGTTTCAAAAGCAACTAGTGTTGTAACATATAAGTTTTGGATATCAGAGTGTTG	Os02g0627100	AK068993	Similar to Phenylalanine ammonia-lyase (EC 4.3.1.5).
3040	36	65	POsControl0013|genome		
3041	36	66	Os02g0670000|mRNA|AK073148|CDS+3'UTR	TGCTTCAAGGGGCCAAGTGTAATTGAGTTCCTTTACAGAAGTGCAAGGTATTGTACCAGA	Os02g0670000	AK073148	Protein of unknown function DUF300 family protein.
3042	36	67	Os04g0174800|COMBINER_EST|CI042021|3	CTTGTGGTGATTATTGGTGAACATGGCTTTTGTTCAGCTGAATACATGGTCTGAAATGCC	Os04g0174800	CI042021	Tetratricopeptide-like helical domain containing protein.
3043	36	68	Os09g0480400|mRNA|AK100641|CDS+3'UTR	AGACATGTTCAATCACAGATCACGAAAGCTGCATCACATTTTGTAGTCACTAATGTTAAT	Os09g0480400	AK100641	Similar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-).
3044	36	69	Os06g0476200|mRNA|AK068502|CDS+3'UTR	GTAGAGTATGTAGAGACTATAATATTTTGATATCCTTTCAATAGAAACCTGCATTAGTTT	Os06g0476200	AK068502	Similar to Phosphoglucomutase precursor (EC 5.4.2.2).
3045	36	70	Os03g0200400|mRNA|AK107086|CDS+3'UTR	GTGCGTGACTATATGTTGTCTGGCTGGGATGATCGAAGAAGATTACTCAAATTCTGCTCC	Os03g0200400	AK107086	Conserved hypothetical protein.
3046	36	71	Os02g0658100|mRNA|AB114830|CDS+3'UTR	AACACGGTACATGTAAAAGGTCACTTTCTGCGATTGTTGTCTGGAAGGGGAAATCAAAAT	Os02g0658100	AB114830	Similar to Tonoplast membrane integral protein ZmTIP2-1.
3047	36	72	Os10g0391300|COMBINER_EST|CI006695|6	ATTTGCACAATCATGTGATGATTTGCAAATTTGCATACCGAAGCATGAATACCAGGACAA	Os10g0391300	CI006695	DNA-binding SAP domain containing protein.
3048	36	73	Os04g0308300|COMBINER_EST|BU673153|7	GAAGGCCGGCAAAATCTGCACAGACCAAACCGACAAGAACTGTGCATCAACCGTCAGCGT	Os04g0308300	BU673153	Conserved hypothetical protein.
3049	36	74	Os04g0280200|COMBINER_EST|CI517473|6	CATGCCACAGTTTTCAGAATGGACTTGTATCGATACGAGTACCACATGGTTAATTGGCGA	Os04g0280200	CI517473	Phosphoribulokinase/uridine kinase family protein.
3050	36	75	Os02g0180000|mRNA|AK120521|CDS+3'UTR	TATGGAAGTATGGAACAATTTGGGGATTTTGCAAAAAGGAGGCAATGCAATTACATTTCA	Os02g0180000	AK120521	Similar to Protein phosphatase type-2C.
3051	36	76	osa-miR171c|Os04|3'seq	GTGCTCCGAAGGCGAGGGGCTCCACTCTTTGATTGAGCCGTGCCAATATCACGTCGCCTT			miRNA
3052	36	77	POsControl0042|art		
3053	36	78	Os01g0837800|mRNA|AK064840|CDS+3'UTR	TTTATACTCAAAGTCTAGAGAGACATATGCCTGGTAATTACAGGCTCACAGCCACTTTAC	Os01g0837800	AK064840	Similar to Cation diffusion facilitator 8.
3054	36	79	Os12g0635500|COMBINER_EST|CI385749|6	TACTGTACGTCTCTCACTCAAATGTCTACATTATATATACGATGTATACTCACATCACAG	Os12g0635500	CI385749	Protein of unknown function DUF266, plant family protein.
3055	36	80	Os06g0224200|mRNA|AK067986|CDS+3'UTR	TGCTGTTTTGTTGTGGCACAAAGAAATGAGTACCAATCCAACTCTGTTCGATTCACTGGA	Os06g0224200	AK067986	Glutaredoxin domain containing protein.
3056	36	81	Os06g0618300|mRNA|AK067443|CDS+3'UTR	CAACCAGCATGTACTTGAGAAATAACAATCCGGCATTCCTGGCATTATTTGAACGCGGCA	Os06g0618300	AK067443	Conserved hypothetical protein.
3057	36	82	Os01g0943000|COMBINER_EST|CI442151|0	ATTCTTGATCTATACATGGACTTGGAATAAGGTGTTCACCCTGAATAAGGAGGGAGGTCA	Os01g0943000	CI442151	Conserved hypothetical protein.
3058	36	83	Os01g0618800|mRNA|AK060394|CDS+3'UTR	CTCCTGGGTTGAGAAGTTCATACTCAGCTTAGTTAGGAAAAAAGGTGAAAGTGTAATTTT	Os01g0618800	AK060394	AAA ATPase, central region domain containing protein.
3059	36	84	Os11g0114200|mRNA|AK106364|CDS+3'UTR	CAATAGCAATGTGGCCATTGTTGTGATCTCCTTGTGTTGGAAGCTAATATGGATGGATTT	Os11g0114200	AK106364	Hypothetical protein.
3060	36	85	DarkCorner		
3061	37	1	DarkCorner		
3062	37	2	Os12g0485400|mRNA|AK100051|CDS+3'UTR	TTTTGCAGGCTGTCTGCCCCTTAACTAGCTCGAGAAGTTGGCATTGGTTCATAACTTTGA	Os12g0485400	AK100051	Similar to Cyclin T1 (Fragment).
3063	37	3	Os12g0457500|mRNA|AK073212|CDS+3'UTR	AAATTCAGTGCAGGCCCTATGTATAACAAGCTAACATTTTTCTTATGCTATAGCCATTTC	Os12g0457500	AK073212	Hypothetical protein.
3064	37	4	Os10g0561800|mRNA|X96681|CDS+3'UTR	GTTTACTCAGCAAAGAATATGGTGTCTTTGTATAAAGTGATGCATGAAATGGATCATAAA	Os10g0561800	X96681	homeodomain leucine zipper protein hox1 [Oryza sativa (japonica cultivar-group)].
3065	37	5	Os05g0228400|mRNA|AK121917|CDS+3'UTR	CGATGTTGCTGAATTATTTGTGTGCATCTATATATGGATTTTCTGTATGTCAATCGACAG	Os05g0228400	AK121917	Helix-loop-helix DNA-binding domain containing protein.
3066	37	6	Os09g0549900|COMBINER_EST|CB646153|7	CACTGATCCGTGTTGCTGGCTTGGTAATGACTGACAATTGACCCTATGAGTTGTGATTGT	Os09g0549900	CB646153	Hypothetical protein.
3067	37	7	Os08g0130500|mRNA|AK062008|CDS+3'UTR	TTCTACTAGACAAGAATGTATCCAACAATGGTATCGTTAATTATGCATTTTGGTTGTGCC	Os08g0130500	AK062008	60S acidic ribosomal protein P0.
3068	37	8	Os07g0661400|mRNA|AK107202|CDS+3'UTR	AGCTAGGGAGAAGAACATGAATTCAGAAGTAGTTGGTCAAAACTCAAAAGTGATTGTAGG	Os07g0661400	AK107202	Conserved hypothetical protein.
3069	37	9	Os04g0542200|mRNA|AY512581|CDS	TTCACCTGGCATATAATTGACAAAAGCAAAGCAGCACTAATGGTGCCAGCAGTTGCATCT	Os04g0542200	AY512581	Similar to Iron-phytosiderophore transporter protein yellow stripe 1.
3070	37	10	Os04g0659100|mRNA|AK063706|CDS+3'UTR	GCCTCCACGTTTGCTCTCACGGTCTAGAAAATCCCCCGTTAATCGAAAGAAAATAAGAAA	Os04g0659100	AK063706	Glutamine synthetase shoot isozyme, chloroplast precursor (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS31).
3071	37	11	osa-miR169p|Os08|3'seq	TAATTAACCTCGCCGTCGGCCATCGCCGGCCGGCAAGTCATCCTTGGCTGCATCCTGCTC			miRNA
3072	37	12	Os07g0576000|mRNA|AK072012|CDS+3'UTR	CAGCATTTGCATTCTCCTCCACACTTGTACTTGAAGAGTTGAAGACAACTTTTTTGTTTG	Os07g0576000	AK072012	UbiA prenyltransferase family protein.
3073	37	13	Os11g0582100|mRNA|AK068669|CDS+3'UTR	CTTCAGCAGAACATGAACTGACATAGACACCATGACAAAGTTTTGTTCTTCAGTTTTCTC	Os11g0582100	AK068669	Zinc finger, RING-type domain containing protein.
3074	37	14	Os03g0684700|mRNA|AK068538|CDS+3'UTR	TGCACAAAAAGAAAAAAGGGAGGAAGGAAGTTCACCTCTGTTAATCTGAGGGAGATTGAA	Os03g0684700	AK068538	HPP family protein.
3075	37	15	Os02g0564600|COMBINER|CI560207|x	ATACGATTATGCCTTGTGTTGTGCCTCAAAGTTGATATGAAATTGAGTTCGAGTTCAGTT	Os02g0564600	CI560207	Late embryogenesis abundant protein 3 family protein.
3076	37	16	osa-miR439d|Os03|Mature	TGTCGAACCGCGGTTGTTCGATGTCGAACCGCGGTTGTTCGATGTCGAACCGCGGTTGTT			miRNA
3077	37	17	Os06g0155600|mRNA|AK101138|CDS+3'UTR	TTTGCCGACACATGCTACTGGCCCAATCTTATATCGGTGTGGAATTAAACACATTTGGCT	Os06g0155600	AK101138	Peptidase S16, lon protease family protein.
3078	37	18	Os02g0727300|mRNA|AK120552|CDS+3'UTR	CCGGTCGCAAAATTTATCTCAGTAGCATATCCATGATATGTTGTATGAAATCTTCCAAAC	Os02g0727300	AK120552	U box domain containing protein.
3079	37	19	Os11g0158700|COMBINER_EST|AU078724|7	CAGCAGATGCAGGTGGTGGTGGCGTCGTTCGAGGCGGTGGCGGGGGGCGGGTCGGCGAGG	Os11g0158700	AU078724	POX domain containing protein.
3080	37	20	Os10g0440100|mRNA|AY224551|CDS	TTTGAACTGCATGACGATTCCTTTGTACTGAAAGCATTGGGGTTCTCTGGCAAAGAACCA	Os10g0440100	AY224551	DP TF.
3081	37	21	Os04g0594100|mRNA|AK111960|CDS+3'UTR	CAAGATTGCCGGTACGAGTTAACCAGAGATGTAACTTATGTACTTTTAACATCAGTTTCC	Os04g0594100	AK111960	Similar to P-type R2R3 Myb protein (Fragment).
3082	37	22	Os07g0669100|mRNA|AF358766|CDS+3'UTR	ACTACGAGCAATAATCTAGTTATAGTTTAGTTATTAGCCTTCCATGCAATGAACTTTTGT	Os07g0669100	AF358766	Similar to Xylose isomerase (EC 5.3.1.5).
3083	37	23	Os06g0640500|COMBINER_EST|Os06g0640500|8	GACCAAGCTCGACATGACTGAGGCGTTCGGCATCGGTGTTCGCCGGAAGGCTGACCTCAT	Os06g0640500		Cytochrome P450 family protein.
3084	37	24	Os01g0383900|mRNA|AK072730|CDS+3'UTR	GTACGGATAGCTGGATACTTCTGGACGAAATAACTTTAGCTATAAAAACTGCCTTTGTTG	Os01g0383900	AK072730	Peptidase S59, nucleoporin family protein.
3085	37	25	Os12g0641500|mRNA|AK120333|CDS+3'UTR	AGTTATACTTTGTAGAAATTTGTATAATTAAGGAGCACCAAATGAGCATTGTGTGTGCGC	Os12g0641500	AK120333	SMC protein, N-terminal domain containing protein.
3086	37	26	Os04g0663200|mRNA|AK111925|CDS+3'UTR	CGAGGAGAGGAGATGTTCTGAAAGAAAGCAAAATATTTCATGATTGATTGGTGCTCAAAT	Os04g0663200	AK111925	Zinc finger, CCCH-type domain containing protein.
3087	37	27	Os01g0867300|mRNA|AK067919|CDS+3'UTR	CTGATTCTCTGTTTGGTGCCACGACTCAAATTGTCTGTACATACACGTTGGATGTAAAGT	Os01g0867300	AK067919	Similar to OSE2-like protein (Fragment).
3088	37	28	Os03g0226600|mRNA|AK121288|CDS+3'UTR	CGTTCCTCGTGTGTATGAAAACTTAGTAAAGGCATAGATTTCAGAAATGCGGTAAAGTTC	Os03g0226600	AK121288	Conserved hypothetical protein.
3089	37	29	Os03g0441000|mRNA|AK070997|CDS	ATTGACCAGCTGAATGATGTTACTGCAGTTAGTGGTGTTAATCTGAGGGAAGAAGAGGAG	Os03g0441000	AK070997	Transcription initiation factor TFIID component TAF4 domain containing protein.
3090	37	30	Os01g0866700|mRNA|AK060459|CDS+3'UTR	TGTGTAACAATTTCTGATCGAGGTGCTAGTTTCTACTGTCATGTTGAATCAACCTTTTGT	Os01g0866700	AK060459	Similar to Sm-like protein.
3091	37	31	Os08g0418600|mRNA|AK108371|CDS+3'UTR	GACCGCAAGCTGTCCGAGTAACTATGTGATCCGACTTTTATGCTACTACATGTTGCAGTT	Os08g0418600	AK108371	Conserved hypothetical protein.
3092	37	32	osa-miR156h|Os06|5'seq	GAGATTGTTGACAGAAGAGAGTGAGCACACGGCGCGGCGGCTAGCCATCGGCGGGATGCC			miRNA
3093	37	33	Os02g0782700|mRNA|AF193803|CDS+3'UTR	CTATGTTGTTGACTGCTCTTTCTTTCGGTCTTTGCTGTGCTGCGCTATGTTGGTGATAAC	Os02g0782700	AF193803	Similar to Transcription factor EREBP1.
3094	37	34	Os03g0581800|mRNA|AK121839|CDS+3'UTR	ATCATACTCAGGTTGATTACGTTACCGTCTGGGGAGTCGAATTACTTCCATGTTCTAACT	Os03g0581800	AK121839	Hypothetical protein.
3095	37	35	Os10g0466700|mRNA|AK120324|CDS+3'UTR	TTCAGTTAAATTTTCAGTGCGGATTGTGTCCTTGATGAATGGAAAATGGCATGTTTGCTT	Os10g0466700	AK120324	60S ribosomal protein L17 [Oryza sativa (japonica cultivar-group)].
3096	37	36	Os12g0281300|mRNA|AK071926|CDS+3'UTR	TACTCCTTGTAAACATGTATTGGTTAATAACGAAGTAGTTTGGACATTAGTTATGATTTT	Os12g0281300	AK071926	Similar to Pi-ta protein.
3097	37	37	Os06g0114000|mRNA|AK060117|CDS+3'UTR	TAGCAAAATTTGTGGTGTAACTGGAACGGCTGTCAAATTACGAAGGAAGATATTTGAAAG	Os06g0114000	AK060117	Similar to 60 kDa chaperonin (Protein Cpn60) (groEL protein) (63 kDa stress protein) (GSP63).
3098	37	38	osa-miR395f|Os04|5'seq	TTATCGCGGGTTCCCTTCAATCACTTCACATGGTACTATTTCAAGGCCTACTATGTGAAT			miRNA
3099	37	39	Os04g0397500|COMBINER_EST|AU174699|6	TGAGGAAGTGAGGTCACCTGCAAGTGCATACCTGCAGTCTCATTAGGTTTCTCTGTAAAA	Os04g0397500	AU174699	Homeodomain-like containing protein.
3100	37	40	Os03g0779000|mRNA|AK122026|CDS+3'UTR	CAACTTTAGTAAGCTATATATATGAAACAGTATTATTGGTCACACATCAATCAGTGTTAC	Os03g0779000	AK122026	Protein of unknown function DUF295 family protein.
3101	37	41	Os03g0149000|mRNA|AK107949|CDS+3'UTR	AGTTCAGATTGTACCATGACTTCCCTTCTTGAGCTTAATTTCGCTGGAAAAGCACTGTGT	Os03g0149000	AK107949	Similar to LOB domain protein 31.
3102	37	42	Os01g0160800|mRNA|AK103707|CDS+3'UTR	TATATACTCCCTTCGTCCCAAAAAAGACAAACACTGGTCTCCGTGTCCAACGTTTGACTG	Os01g0160800	AK103707	Similar to Protein synthesis inhibitor II (EC 3.2.2.22) (Ribosome-inactivating protein II) (rRNA N-glycosidase).
3103	37	43	Os07g0249200|mRNA|AK059902|CDS+3'UTR	TTCAAACCGTGTGACCAACATTACATAAAGTAGTAATAGTACGGTTGCTTGTCGATTGAT	Os07g0249200	AK059902	Similar to Vesicle-associated membrane protein 724 (AtVAMP724) (SYBL1-like protein).
3104	37	44	Os05g0594500|mRNA|AK100617|CDS+3'UTR	TATAGCAATCAATCATTCAATGTATGCAAGACGATCAATCCAGCGATGAAGCTGGTGATG	Os05g0594500	AK100617	Invasin/intimin cell-adhesion domain containing protein.
3105	37	45	Os03g0101800|mRNA|AK061186|CDS+3'UTR	GCTACGTTTCTGCATCCACCGGCCGTGTGTTGTTTATGCCATCATGTAAAATTCATTCTT	Os03g0101800	AK061186	Protein of unknown function Cys-rich family protein.
3106	37	46	Os02g0515100|mRNA|AK106640|CDS+3'UTR	TGCTTTCAGCATGATGTGTTAGACTCACATTGTTTGACGGAAATACTTGCACTTAAAAAG	Os02g0515100	AK106640	Conserved hypothetical protein.
3107	37	47	PGmControl0001|mRNA|AF035253|3'UTR		
3108	37	48	Os02g0229500|COMBINER_EST|Os02g0229500|8	AGCAGCAACAGGTGTACGAAAAAGTTCAACTTCCCAGGCAACTCCCCTTGCAAGAAATAA	Os02g0229500		Kinesin, motor region domain containing protein.
3109	37	49	osa-miR171e|Os03|3'seq	ATGCGTGCTTGCTAGCTCACTTGTGTTTCTGATTGAGCCGTGCCAATATCTTAGTGCTCT			miRNA
3110	37	50	Os05g0137800|mRNA|AK062730|UTR	CGGTTCTGCTGTAATTAGCGTTCAACAAATTGACTCAAGATTGTAGCAAACACTGCATAC	Os05g0137800	AK062730	Non-protein coding transcript, putative npRNA.
3111	37	51	Os06g0647400|mRNA|AK103281|CDS+3'UTR	GCAGGCTGTTAGACAGAAAATTAAATTAAGGTAACATACAGTGGAAACTCAATAAGTCAC	Os06g0647400	AK103281	Similar to Lysosomal Pro-X carboxypeptidase.
3112	37	52	Os07g0617000|mRNA|AK061047|CDS+3'UTR	ACGAATTCTTTATTATGATGTTAGGTTCTTAATTTGCCCTTCTTCATCAGGGATTTGTTC	Os07g0617000	AK061047	Similar to Ethylene response factor 2.
3113	37	53	Os03g0364500|mRNA|AK108428|CDS+3'UTR	GTACATACCACGACGACATTGAGCTAAGTAAAGTTTGATCCGGAACGTGGGCTAGTTTGT	Os03g0364500	AK108428	Hypothetical protein.
3114	37	54	Os01g0604000|mRNA|AK109130|CDS+3'UTR	GGGGATGTGTTGTATCGGTTTTATGGTTGGGGGACGATTTTGTAACTCGGTGACAAGTTG	Os01g0604000	AK109130	Conserved hypothetical protein.
3115	37	55	Os02g0702500|mRNA|AK066790|CDS+3'UTR	CTTCTTTTCGTTTTTGGTTTATTTGTTATACATCGAGCGGAGGCTTCTGCCTGCTGCAAA	Os02g0702500	AK066790	Protein kinase domain containing protein.
3116	37	56	Os01g0174300|mRNA|AK104306|CDS+3'UTR	ATTGCTTCAGCCGTTTATGAGATGGTCTGGAATTGCCGTGGATGATCTTATAGAGATAGA	Os01g0174300	AK104306	NADH:cytochrome b5 reductase (CBR) family protein.
3117	37	57	Os08g0436000|mRNA|AK104066|CDS+3'UTR	AGTCGCTGTCTGTAAACTGTCCGGCAATTAGAAATTCCCATCCTTAGCATGCCTGGTATT	Os08g0436000	AK104066	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
3118	37	58	Os04g0412500|mRNA|AK059525|CDS+3'UTR	TACTAAGAGACCGGTCTTTTGTCACCCTCTTTAATTACCTACTAATGAAGAACTACTGAG	Os04g0412500	AK059525	Conserved hypothetical protein.
3119	37	59	Os08g0203100|COMBINER_EST|Os08g0203100|8	ACTCGGGATCGTAGACCCAAAACTCAAGGAATTCAATGAGAAGGAAGCCTTGAGAGTCAT	Os08g0203100		Leucine-rich repeat, plant specific containing protein.
3120	37	60	Os02g0547300|COMBINER_EST|Os02g0547300|8	CGCCGCATCGCCTACCGGCCATCGGACTTCCTCGCGCCAGCGACCTCCTTCCCACCGCCG	Os02g0547300		Conserved hypothetical protein.
3121	37	61	Os05g0499800|mRNA|AK064392|CDS+3'UTR	TGAAACTTTCAAAAATATCTTGTAATATAATATTGGTGAAACGGAGGTTGTGGGGACGAG	Os05g0499800	AK064392	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
3122	37	62	Os11g0661400|mRNA|AK063910|CDS+3'UTR	AGAACATTGTCCTGTTGTCGACAGTATAATGATTCTGACTAGCCATGGGTTGTTGACATT	Os11g0661400	AK063910	AAA ATPase, central region domain containing protein.
3123	37	63	Os04g0593200|COMBINER_EST|CI550960|0	TCGGACTTCTGACATCATTAATTGATCGCTGTGTATTGAGATTTTGATTTTTGTAATCGC	Os04g0593200	CI550960	Similar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4).
3124	37	64	POsControl0035|random		
3125	37	65	Os03g0826700|mRNA|AK071165|CDS+3'UTR	AGAATTATGGATGGATTAGAAACCAGGCAAATGCGCTTGGCCATGTATTGATCAATTGAT	Os03g0826700	AK071165	SAM (and some other nucleotide) binding motif domain containing protein.
3126	37	66	Os04g0448000|COMBINER|CI355485|4	AGATTTCGTCACATCTGAATGTGTAAATCAAGCATAGATCGATATTATACGAGAAACCTG	Os04g0448000	CI355485	Conserved hypothetical protein.
3127	37	67	Os07g0205500|mRNA|AK103449|CDS+3'UTR	TGAAGAGAAGCATGGCGTGAGGTGGTGGTGCAGGGGTGATGATGACAATTGATTTGTGGG	Os07g0205500	AK103449	Protein of unknown function DUF239, plant domain containing protein.
3128	37	68	Os01g0585300|mRNA|AK071353|CDS+3'UTR	TAGTATCGACTGGTTCTCGAGATGAAAATTTGTTGTAAATTTCAAGGAGTTTCAGGCTGC	Os01g0585300	AK071353	Protein of unknown function DUF1118 family protein.
3129	37	69	Os03g0221500|mRNA|AK103138|CDS+3'UTR	CTAGGTTGTATTTGCAGAAGGTGTCAGTGTTTGTGCGCTGACCACAATCAAAATCTTCTT	Os03g0221500	AK103138	Glycoside hydrolase, family 17 protein.
3130	37	70	Os01g0103800|mRNA|AK102782|CDS+3'UTR	AAGTGCTCATGGCTTGTGCTTCCTGAGTGATGGCTAATTTATGATCGCCCCTTGTGTTAT	Os01g0103800	AK102782	Conserved hypothetical protein.
3131	37	71	Os08g0179000|mRNA|AK122092|CDS+3'UTR	AGCAAAGAGTAGCTCTGTATCTGTCTGAATGGCATCTTGGCCTGATTGGCTCTGATATGT	Os08g0179000	AK122092	Similar to Receptor-like kinase.
3132	37	72	Os03g0711100|mRNA|AK120563|CDS+3'UTR	ATCCTGCTAATTATAAAGGTTGTTGTAGATTTTGATCCCGGATCAATGTATGTAAAGGCC	Os03g0711100	AK120563	Similar to CONSTANS-like protein.
3133	37	73	Os12g0151500|mRNA|AK058389|CDS+3'UTR	GGAGCTTTGTAAGGAGAAATGTAGCTCAATTTTGTTGTGAATTTATTCGAACCATTGCAG	Os12g0151500	AK058389	Similar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX).
3134	37	74	Os07g0673100|mRNA|AK103678|CDS+3'UTR	CTTCTAGACTTCTGCATGTATGTACTAACAGTGTATCTGCTAGTACTTCCCCCGTTCCAA	Os07g0673100	AK103678	Ribosomal protein S8E family protein.
3135	37	75	Os06g0482200|mRNA|AK119703|CDS+3'UTR	TGAATGCACGTTCAGCCTGTACTAGAATACTTTTGTTCAAAGCCTTTCTGTATGTGGCAT	Os06g0482200	AK119703	Thioredoxin fold domain containing protein.
3136	37	76	Os12g0102500|mRNA|AK120291|CDS+3'UTR	TTTGTCCTTCAGGTCGTCGTGCACTTTTGAAATGATCATGTGCATTCATTCTCGTTCATT	Os12g0102500	AK120291	Protein kinase-like domain containing protein.
3137	37	77	Os08g0564300|mRNA|AK063134|CDS+3'UTR	CCATCCTCAACCTGCTGCTGCTAGATGTTCTAAGAATGAATTAATGAAATGAATTACTAT	Os08g0564300	AK063134	ABC transporter, transmembrane region domain containing protein.
3138	37	78	Os11g0169400|mRNA|AK110948|CDS+3'UTR	CTCTGTTGTAGGTTGTAGTATGTTTACTTACTTCATGTTCATCAAGTCAGATCATAATGC	Os11g0169400	AK110948	Zinc finger, C2H2-type domain containing protein.
3139	37	79	Os01g0276800|mRNA|AK104914|CDS+3'UTR	ATGAATAGTATATTTATGAACTACATCCTGGATATTCATCACTCTGGATGTAGCATCTGC	Os01g0276800	AK104914	Virulence factor, pectin lyase fold family protein.
3140	37	80	Os01g0707500|mRNA|AK100208|CDS+3'UTR	AAACGGGTGCCATCTGATAGAGGAAAACATGTGGTTCAATAATGGAAAAGAGTGGCCTGG	Os01g0707500	AK100208	Similar to Transcription factor LAX PANICLE.
3141	37	81	Os03g0259400|COMBINER_EST|Os03g0259400|8	ACGACTACATACATGTCCTCAACCTAGCAGAGGAAGCTAAAGAAGAGGAGGAGAAGAAGA	Os03g0259400		Similar to Leucoanthocyanidin reductase (EC 1.17.1.3) (Leucocyanidin reductase).
3142	37	82	Os01g0840900|mRNA|AK063699|CDS+3'UTR	GTTAGCTTGCTCAGCCAGCTAATTAACCACATCACCACCATGGCAAGGCCTAATTTAAGC	Os01g0840900	AK063699	Conserved hypothetical protein.
3143	37	83	Os01g0685200|COMBINER_EST|CI222913|6	AAATGGTGAATCCTTTTGCTGGCGATGATCTGTAAGCTGAATGTTTGCCAGATCCATGCC	Os01g0685200	CI222913	Anti-silencing protein, ASF1-like family protein.
3144	37	84	Os06g0181900|mRNA|AK111463|CDS+3'UTR	TGTATTTGAAGGAAATGGTGTACTCTCTGATTGCCATATGTTCGACTTTATAATCAAGTC	Os06g0181900	AK111463	Hypothetical protein.
3145	37	85	Os02g0121100|mRNA|AK119758|CDS+3'UTR	ACAAAATCTCTCTCCTTTTTGTGGTTTCCCCGAGATGAAAAAGATGATTATTGTCGGTTA	Os02g0121100	AK119758	Conserved hypothetical protein.
3146	38	1	Os09g0475200|COMBINER_EST|Os09g0475200|8	GCGCGGCGGTTGGCGTCGAAAGATGTGGGAGGGGAGAGGCGTGGCGGTCGGCGTTGCCGC	Os09g0475200		Conserved hypothetical protein.
3147	38	2	Os10g0170600|COMBINER_EST|CI274787|6	GGATATTGTATTCGTTGGGCACACTTTTGTTGCACTACTTGTTGCTGCACTGCTGTTGTA	Os10g0170600	CI274787	Zinc finger, BED-type predicted domain containing protein.
3148	38	3	Os12g0169000|COMBINER_EST|CI530099|1	ACATGACCAGAAGGACGAGAGCAAAATTAGATCAATTGCAGAAACTGTTTGATTAGCGGA	Os12g0169000	CI530099	Similar to N-acylethanolamine amidohydrolase.
3149	38	4	Os05g0293500|mRNA|AK072592|CDS+3'UTR	AATAGTTGCATAGGATCGAACAAGATTAAACAAGCCTATCAGAAGATGTGAATGGCAGCG	Os05g0293500	AK072592	Similar to Pectate lyase B (Fragment).
3150	38	5	Os09g0570300|mRNA|AK058687|CDS+3'UTR	GCGTACGTACATCAAACCAACATGATACTAGTAGTGAGTAATAAGCATATGCGAATCTTC	Os09g0570300	AK058687	Similar to Short-chain dehydrogenase Tic32.
3151	38	6	Os09g0439700|mRNA|AK105702|CDS+3'UTR	CACGGTGCGCCACGTTATAGGCATCACTGTATGGATGATGATATATATGATAGGAACAAT	Os09g0439700	AK105702	Lung seven transmembrane receptor family protein.
3152	38	7	Os04g0448100|mRNA|AK108771|CDS+3'UTR	CATGTGTTCTTCTTGTCCAGTGGATCTGCAACTTTCAGTGATAACAATGTGCTAGCAGTT	Os04g0448100	AK108771	Protein of unknown function DUF1644 family protein.
3153	38	8	Os11g0691600|COMBINER_EST|CB660294|7	GCCGCATTGTAGTATTAATTACACCGTTTCTATTGTTACCGTTGCAGTGTTTATTGTAGT	Os11g0691600	CB660294	Conserved hypothetical protein.
3154	38	9	(-)3xSLv1		
3155	38	10	Os03g0245500|mRNA|AK064707|CDS+3'UTR	CCAGCGGATGTGCGTGCTGTGTGTACTGGTGTGTTGCAGGTGGTGCTTTTTCTGGGTGTT	Os03g0245500	AK064707	Curculin-like (mannose-binding) lectin domain containing protein.
3156	38	11	Os03g0636800|mRNA|AK073129|CDS+3'UTR	GGCCATATCTGATGGAGACAACAAGAAGAATTTGAGGAGCTTGTACTGTACTATGCACAA	Os03g0636800	AK073129	Serine/threonine protein kinase domain containing protein.
3157	38	12	Os04g0502800|mRNA|AK099877|CDS+3'UTR	TATCTTCTTCATCCCACTGACGCTGTTAATACCATGAGTGCAATGAGCCTGGTTATGTGT	Os04g0502800	AK099877	Similar to Nodulin-like protein.
3158	38	13	Os01g0835800|COMBINER_EST|Os01g0835800|8	CAAAGTTCCAAGGAGAGGCAGTGCGATCTTGGAGAAGCCTCATGTTATCAACAAGTCTTA	Os01g0835800		Prefoldin domain containing protein.
3159	38	14	osa-miR395e|Os04|5'seq	GTATTATCGAGAGTTCCCTTCAACCACTTCACGTGGCACTGTTTCAAGGCCTATTGTGTG			miRNA
3160	38	15	Os05g0262000|COMBINER|CI402974|6	CATTGTATATTCGGCAATCTGCCGCAAACCCTTTTATTGTAACCGAAACAGGTGGCCGTT	Os05g0262000	CI402974	(No Hit)
3161	38	16	Os02g0742000|mRNA|AK101261|CDS+3'UTR	GCCGCTGTAATTAGGTTCAGTTTGTTTGTTTTTAGTTTCTTATGACAGACCAATTTTCTC	Os02g0742000	AK101261	Bromo adjacent region domain containing protein.
3162	38	17	Os01g0127700|mRNA|AK072972|CDS+3'UTR	TTTGATTGATATGAACAGGAGTACAGTTGCTGTGAATTAATTGGCAGTGCATATGCACAG	Os01g0127700	AK072972	Similar to Receptor-like protein kinase.
3163	38	18	Os09g0456700|mRNA|AK108731|CDS+3'UTR	GCACAATGAACCGTTAATTGTAAGACACGGTCTCCCAGAAATGAAAACTGCATATTGCCG	Os09g0456700	AK108731	Conserved hypothetical protein.
3164	38	19	Os05g0415400|mRNA|AK107330|CDS+3'UTR	GTTTGGATGCCGTCTGTAGAACCTTGTGTGCTATGTAACTTTTTTCTTTGTATTTTGGCA	Os05g0415400	AK107330	Similar to OsNAC6 protein.
3165	38	20	Os04g0176200|COMBINER_EST|Os04g0176200|8	CACCGGCGGCACGCTGGAGATGATCATGTCCCGGCACAAGCACATCACCGGAGTCAACTT	Os04g0176200		O-methyltransferase, family 2 domain containing protein.
3166	38	21	Os05g0556800|mRNA|AK109887|CDS+3'UTR	GTTGCATGGATCAGTAGACCGACTGTCTGTGCTTGTAACTGATGGGTTAGCTTGATTTGT	Os05g0556800	AK109887	Protein of unknown function DUF250 domain containing protein.
3167	38	22	Os06g0331500|COMBINER_EST|CI210004|6	CTCCTGTGTGATTTATTTGTGATCTGATTTGATTATCTCCTGTCATGTGATCTATTTTGG	Os06g0331500	CI210004	Hypothetical protein.
3168	38	23	Os08g0205300|mRNA|AK122033|CDS+3'UTR	TGTCATGTCATGGTGTAGTTGATTGTATGGCATTGCATCTCTTGTCTACTGATGAGAGGT	Os08g0205300	AK122033	Nuclear protein SET domain containing protein.
3169	38	24	Os11g0586300|mRNA|AK072257|CDS+3'UTR	CCGGTTTTATGCCAATACCTGTACCGAGCTATGTTATCAAAAGTTCATATGCTACTATGC	Os11g0586300	AK072257	Conserved hypothetical protein.
3170	38	25	Os02g0127000|mRNA|AK102416|CDS+3'UTR	TGGGTTGTACCACACCTGTTTTGATCATTTAGAAATATATATTCATCGTCGTGTTTTGAT	Os02g0127000	AK102416	Protein prenyltransferase domain containing protein.
3171	38	26	Os05g0519200|mRNA|AK067065|CDS+3'UTR	TCTTGTTTGGCTTAGTAATTTTGCCTGCAACCAACCAATGGAGTCTTAGTTCCCGGCGGG	Os05g0519200	AK067065	Protein kinase-like domain containing protein.
3172	38	27	Os03g0295800|mRNA|AK106050|CDS+3'UTR	TTCTGTCTAGGCTATAGGACATAGTTCATCCAGTAATAATGAAGTGCCGTTCAAAAAAAA	Os03g0295800	AK106050	Gamma interferon inducible lysosomal thiol reductase GILT family protein.
3173	38	28	Os02g0264300|mRNA|AK072028|CDS+3'UTR	CCGGTTTTGTTAGGGCACTAATCATTCTTTATGACGAAATGGACTATGTTTCAGGCTACT	Os02g0264300	AK072028	Conserved hypothetical protein.
3174	38	29	Os05g0576800|mRNA|AK070644|CDS+3'UTR	CTCGATGGGACAATCACCGATCCTGTAAAATTTCCTTTCTTTTGATGACAGAATCATACA	Os05g0576800	AK070644	Similar to Blast and wounding induced mitogen-activated protein kinase.
3175	38	30	Os06g0220300|COMBINER_EST|AU095433|6	AGAACTCACCTGTGTGAGTAGGTATGCATTTGATGAGTGCGCATGTCCAAATGTACTTTT	Os06g0220300	AU095433	Similar to Phi-1 protein.
3176	38	31	Os11g0456200|mRNA|AK060974|CDS+3'UTR	TTGTAGCCCATAAACTCACTGTAAAGTGTGAAGTGTATATACGTGTTCTTGTAAGGCCCT	Os11g0456200	AK060974	Conserved hypothetical protein.
3177	38	32	Os07g0173200|mRNA|AK061624|CDS+3'UTR	ACCAGGCTTACTACCGGTAGGATCAGTCAGGAAAGTCGCTGATGAATGACATGACAAATA	Os07g0173200	AK061624	Frigida-like family protein.
3178	38	33	Os02g0242100|COMBINER_EST|Os02g0242100|8	GCCGGGGTGGCGCTACCGCTAAGTCCGGTGGCGCCCGGCGGCGTGGTGTCGCGGGAGGAG	Os02g0242100		UDP-glucuronosyl/UDP-glucosyltransferase family protein.
3179	38	34	Os05g0126200|mRNA|AK059554|CDS+3'UTR	CTAAAATAAAAGATGTGATTTTCGTTTTGTGCCAGAGGCCAGGAATGGCCAACATGGCAA	Os05g0126200	AK059554	Conserved hypothetical protein.
3180	38	35	Os05g0526400|mRNA|AK121753|CDS+3'UTR	AACTTCCGCCCCTGGAAGCTGTTGGTACTAAGTGCTATCAATATGTGACTTATCTTTATG	Os05g0526400	AK121753	Reticulon family protein.
3181	38	36	Os08g0347200|mRNA|AK058279|CDS+3'UTR	GGGGGAAATGTGAGGGAGGAGGAAACTGGGATACCTAAGTAATCTGCTAATGCGTTTTTA	Os08g0347200	AK058279	Hypothetical protein.
3182	38	37	Os07g0180900|mRNA|AK104629|CDS+3'UTR	AACATAGAGTATGTGGTTTGGACCAGCTATCTAAATTATGTATGCACTTCCATGTTCTCT	Os07g0180900	AK104629	Ribosomal protein L4/L1e family protein.
3183	38	38	Os04g0639800|COMBINER|CI393913|0	GCTGCTGGGTTGTTTGTGAACTGCTATGTCGGTTTGGAAAACTGATTGTTTGGCTAGCAT	Os04g0639800	CI393913	Peptidase C48, SUMO/Sentrin/Ubl1 family protein.
3184	38	39	Os12g0428400|COMBINER_EST|Os12g0428400|8	AGGACCATATTCCTCCAATCCCTGATAGAATATTCAATCATGAGATCTCCATTCCAAGTA	Os12g0428400		Protein of unknown function DUF1649 family protein.
3185	38	40	Os02g0133100|mRNA|AK060180|CDS+3'UTR	TGAAACGACAGACGTCGGATGTAAATCGGCAAAATTCTGACATAAATAAATGTGTTTTTT	Os02g0133100	AK060180	Similar to Phosphatidylinositol transfer-like protein III.
3186	38	41	Os04g0459500|mRNA|AK119522|CDS+3'UTR	ACCTCATCTGACTTTTCACTGTCCGGCACGGATTATTATCGACTTCCGGCAATTGGAAAT	Os04g0459500	AK119522	Similar to GADPH (383 AA) (Fragment).
3187	38	42	Os03g0629900|mRNA|AK109858|CDS+3'UTR	GTCTGGTGGATGGCTTTCCAGTTGTACATTACAAACTAGGTTACTGAGCGCGTGATGTAT	Os03g0629900	AK109858	Conserved hypothetical protein.
3188	38	43	Os10g0330400|mRNA|AK061323|CDS+3'UTR	TCTCAAGGGTGACCATTATGTAATTAATTAATTAATTAATCTCTTAATTAACTCGCAAGT	Os10g0330400	AK061323	Protein of unknown function DUF179 family protein.
3189	38	44	Os02g0448000|COMBINER_EST|CI075703|0	CGTGGGAATAATGCATGTGATTTCAGGTGTTATTAATCGTTATTATGTCAGCGTCGGGGA	Os02g0448000	CI075703	Protein of unknown function DUF296 domain containing protein.
3190	38	45	Os01g0618000|mRNA|AK064632|CDS+3'UTR	TTTCATGTTCAGTTTCAGTTTCTGATCTAAATGAAATTATAGGAGTACCATTTTTTGCTG	Os01g0618000	AK064632	Exonuclease domain containing protein.
3191	38	46	Os09g0515500|mRNA|AK065778|CDS+3'UTR	GTTATTGACTTAATTATTATTACTGTATAATTGCAGCCACAGAAAGGCCATTTTTGCCGG	Os09g0515500	AK065778	Initiation factor 2 family protein.
3192	38	47	Os11g0485200|mRNA|AK068468|CDS+3'UTR	TTTGGGTATCAAACTTGTTTTGGGTGTCATGTAGGCCCAAACGAGCTCTGACCTGTTTTA	Os11g0485200	AK068468	ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter family protein.
3193	38	48	Os11g0109300|COMBINER|CI205565|6	AAGATATATCCTAGAGATAGAATCCTAGAGATAAGATAGAGTCTCTAGAGATAGAATCCC	Os11g0109300	CI205565	(No Hit)
3194	38	49	Os09g0314900|COMBINER_EST|Os09g0314900|8	GGAATGGAGGTTCTCCTTGAGATAGGTATATGCAAGAAATACATTCATACCAGATCTAGA	Os09g0314900		Proteasome maturation factor UMP1 family protein.
3195	38	50	Os01g0889800|mRNA|AK070087|CDS+3'UTR	AGACCATTGCTGTTACTGACATCATGGTGAATCTTATGTTTGTTGGATGTTGTATTTTTC	Os01g0889800	AK070087	Rhodanese-like domain containing protein.
3196	38	51	Os11g0470200|COMBINER_EST|Os11g0470200|8	CTCCAGTTCATCTTCTGCATCCAAAGCTACTGTTTCGATATCACAACTTTCAGCCAGGTG	Os11g0470200		Protein kinase-like domain containing protein.
3197	38	52	Os05g0461300|mRNA|AK111917|CDS+3'UTR	GTAACGTAGTCCATGCTGTATTGCTATTGGGTTTTCAGTTAATCAATGGATGCATGGAAT	Os05g0461300	AK111917	Similar to RAB8C.
3198	38	53	Os04g0457800|mRNA|AK105892|CDS+3'UTR	TATTGTACGTACAACTCTCTCTTTTGACGGTGCTAAACATCCTAGGCAATCTTTTTTGGT	Os04g0457800	AK105892	Similar to SERK1 (Fragment).
3199	38	54	Os02g0814000|mRNA|AK102943|CDS+3'UTR	TTGTTTGTTACTGTGTGTGAACCTGGACTGTTCTGCTTAAATTCGATAATCTTTCTCTTG	Os02g0814000	AK102943	Protein of unknown function DUF862, eukaryotic domain containing protein.
3200	38	55	Os05g0442400|mRNA|AK107134|CDS+3'UTR	AAACTAAGCTTGGCTGGAACCTGAGATCAATTGTTGTGATACTAGTTTGTGTACTTGTCA	Os05g0442400	AK107134	Similar to MybSt1.
3201	38	56	Os09g0558300|mRNA|AK059452|CDS+3'UTR	ATCTCAAAGATGAAACCAAACTGGTCCTTTGTGTAATTCAAATATACGCATTTTAGGAGC	Os09g0558300	AK059452	Similar to Cyclic nucleotide-gated channel A (Fragment).
3202	38	57	Os06g0548000|mRNA|D67043|CDS+3'UTR	AGAACGAACGTTCTAACTGTGACAGTGTCATGCTTTGTAAAGGAAGTGTACCTTTCCACC	Os06g0548000	D67043	Aspartate aminotransferase (EC 2.6.1.1).
3203	38	58	Os08g0233300|mRNA|AK120342|CDS+3'UTR	GCGGGCAAAACGAGCTGCAATGTGTTCTGTATTTCTACTAATTTATTGTACAACATTTTT	Os08g0233300	AK120342	Conserved hypothetical protein.
3204	38	59	Os09g0451400|mRNA|AK058296|CDS+3'UTR	CCTGCAGTCTCCTCGTGACCTTGCCTGTATCTTGGTTTGGATGCATTATTACCTTGATTT	Os09g0451400	AK058296	1-aminocyclopropane-1-carboxylate oxidase 1 (EC 1.14.17.4) (ACC oxidase 1) (Ethylene-forming enzyme) (EFE).
3205	38	60	Os10g0184200|COMBINER_EST|Os10g0184200|8	GTCAGGATCCTACTGGTTATTCTTGGCATTCCTTTTCTAAGGTCGGACATGAAACCAGGA	Os10g0184200		Protein of unknown function DUF594 family protein.
3206	38	61	Os03g0856400|mRNA|AK111501|CDS+3'UTR	TGGAGTTGTGTAAAACCTGTACCACCTGATTTTTATGTCTAAACCGCAGCTTACTCATTT	Os03g0856400	AK111501	Similar to Protein kinase AKINbetagamma-2.
3207	38	62	Os03g0727600|mRNA|AK071011|CDS+3'UTR	TCTCCCAGTTGTTGTAACCTATGGAAAGTATTATTGCTCGTCAATAAAAGCTAGTGCCCA	Os03g0727600	AK071011	1-aminocyclopropane-1-carboxylate synthase 1 (EC 4.4.1.14) (ACC synthase 1) (S-adenosyl-L-methionine methylthioadenosine-lyase 1).
3208	38	63	Os07g0624700|mRNA|AF187063|CDS+3'UTR	AGAGGGTTTAAAACTTCTGTAACTGTCACATTCTTTCATAAGCGATTGGCTATTCGTTAA	Os07g0624700	AF187063	UMP/CMP kinase a (EC 2.7.1.48).
3209	38	64	Os08g0526400|mRNA|AK120803|CDS+3'UTR	TTGTCCCTTGTCAACACAGAAAGTCCATTATGCACGTATTAATCTATGAAACTAGATTTC	Os08g0526400	AK120803	Nitrate-induced NOI family protein.
3210	38	65	Os01g0809300|mRNA|AF364177|CDS+3'UTR	GTAGCAGAATACTTTCTTTCTGTGAAAGTAAACATGGAACTGCTTATGTCATGAGTCAAA	Os01g0809300	AF364177	Leucine rich repeat, N-terminal domain containing protein.
3211	38	66	Os07g0249700|COMBINER_EST|AU164584|6	AAACATGGGAATTTTGTGTGTTCCAAAGGAGGCCTAAGTCTTTCAGTGGCTTTTGAAAAA	Os07g0249700	AU164584	Peptidase M20 family protein.
3212	38	67	Os05g0247100|mRNA|AK065866|CDS+3'UTR	TGAGGTGATCAGGACGGGCAGGCTTACTTTCTTCTGGGTGATATGTTGTATGTATTTTGT	Os05g0247100	AK065866	Similar to Chitinase (EC 3.2.1.14) III C00481-rice (EC 3.2.1.14).
3213	38	68	Os11g0600500|COMBINER_EST|Os11g0600500|8	TGAGTGTGAGCAAATGATTGCCAAATATGACATGAACAGAGATAGGAGGATAGATATGGT	Os11g0600500		EF-Hand type domain containing protein.
3214	38	69	Os01g0624000|mRNA|AK071073|5'UTR+CDS	ATTGGGAATAGGCAATTTCTAAAGGCTAGAGATCTCTTTGATTCAGCTTCTGAAGAAATA	Os01g0624000	AK071073	Neutral/alkaline nonlysosomal ceramidase family protein.
3215	38	70	Os03g0326300|mRNA|AK066058|CDS+3'UTR	TTACTGTTAAGTATTGACAACTATCTCTTCGGCTTTGCTGATGGCTAAAATCTGTGTTTA	Os03g0326300	AK066058	Zinc finger, RING-type domain containing protein.
3216	38	71	Os05g0438300|COMBINER|AU082861|6	TCTGGCAATGGTGGCAATAACAACGGCGACAACAACTGCAATGGCAATAATACTAGCAGT	Os05g0438300	AU082861	(No Hit)
3217	38	72	Os03g0179200|COMBINER|CI489451|x	ACATTTATCATCTGTATGTGTATTGCTGTGGCATTCCAACCTGATCTTGGTTGTTACTGC	Os03g0179200	CI489451	Conserved hypothetical protein.
3218	38	73	Os03g0275500|mRNA|AK065232|CDS+3'UTR	TGTTCCCCTGCCTCTGGATCAAACCTTTTGGTCTCTTATATGTAATTCTATTTGTTTGGA	Os03g0275500	AK065232	Epsin, N-terminal domain containing protein.
3219	38	74	Os03g0243300|mRNA|AK073601|CDS+3'UTR	TGTTAACGTGTGCAATTTGCATCAAAGTTTACCATTTACCCCACGCAACTTATCAAAACG	Os03g0243300	AK073601	Similar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein).
3220	38	75	Os02g0100800|mRNA|AK062555|CDS+3'UTR	TGTCTCATTTTTTTTGTACTATGTATGCTATTATTATTGTTATTACAGAATAAGTTCCTC	Os02g0100800	AK062555	Hypothetical protein.
3221	38	76	Os01g0157200|mRNA|AK108577|CDS+3'UTR	GGTGGACTCGAAATTCTTGATCAGTTTGAAAACAACCACTTGGATGTTTCTGTTTCTTCT	Os01g0157200	AK108577	Conserved hypothetical protein.
3222	38	77	Os10g0563000|mRNA|AK072479|CDS+3'UTR	AAACGCAATTGTGGGCTTTTATGTAGCAGACCTCACTAGGAAAAAGTCCAATTCGACAAT	Os10g0563000	AK072479	Similar to Palmitoyl-protein thioesterase-like.
3223	38	78	Os01g0755600|COMBINER|CI434063|x	AGACTCTAAGACTGTTTGCAGTACTGGTGTGCTTTGCTAAAGTATGAATGAAAAGAACTT	Os01g0755600	CI434063	(No Hit)
3224	38	79	Os01g0642000|mRNA|AK110911|CDS+3'UTR	TACAAGCCTAAATGTGGATATACAGAGCAGAGAATTGAAGAAAAGCATTTGCAGTTTTTC	Os01g0642000	AK110911	Carboxylesterase, type B family protein.
3225	38	80	Os01g0783200|mRNA|AK119289|CDS+3'UTR	GAAGGAGAAAACAAAAACATCAACCAAGGCCATAGCTTGTAAAAGACAGTGCCAACATTA	Os01g0783200	AK119289	Similar to Diacylglycerol kinase.
3226	38	81	Os02g0774100|COMBINER_EST|Os02g0774100|8	TTCTATCTTCAGAAAATGCCCACTATCCAGTTATGGAAGGATGGAGAATGGGCAGCGGAA	Os02g0774100		Thioredoxin domain 2 containing protein.
3227	38	82	Os04g0372400|mRNA|AK107450|CDS+3'UTR	CTTGGAGGCATCGTTTAGAAGTCCTATTCCTTTGGGGTGTTGTGTGCTTGTTTTGTTTTA	Os04g0372400	AK107450	Conserved hypothetical protein.
3228	38	83	Os02g0156400|mRNA|AK100447|CDS+3'UTR	CACTTATGTAAGACTTTTGAACGGAAGCGCCAAAGTTGTGTCAATAAATCAATCTTGTCG	Os02g0156400	AK100447	Leucine rich repeat, N-terminal domain containing protein.
3229	38	84	Os05g0523300|mRNA|AK071192|CDS+3'UTR	ATAATGGGAAAATAGCATCTTGCAGGTGCAGTGGACAAACTGCATATTTTGTAAATGACC	Os05g0523300	AK071192	Similar to IAA8 (Fragment).
3230	38	85	DarkCorner		
3231	39	1	osa-miR529|Os02|3'seq	TGACTATCTTTTGCGAGTCTGATCGATACTCTGATGAAGGCTGTACCCTCTCTCTTCTTC			miRNA
3232	39	2	Os06g0575100|COMBINER|CI546278|x	ACTTTTTTCTTCAAACTTTCAACTTTTCAACTTTTTCGTCAGATCGAACTTTCCTATACA	Os06g0575100	CI546278	Conserved hypothetical protein.
3233	39	3	Os08g0390000|mRNA|AB117988|CDS+3'UTR	GGTATCTGTTGTAGATGGATGGACGGCTTGCCGTATGAAATAAACAAATAATGCTTGTGT	Os08g0390000	AB117988	Moesin domain containing protein.
3234	39	4	Os05g0501400|mRNA|AK110116|CDS+3'UTR	TGATTAACCCTAGCACTGAGTTGCGAATTCAATCCCACCCAAATAACCAGAAATCGAGAT	Os05g0501400	AK110116	Similar to Receptor-like protein kinase 5.
3235	39	5	Os03g0577500|mRNA|AK121292|CDS+3'UTR	GTCTCCCCCCACCATTCTTGGAAAGATGTTCATCACCGTTTCTGATTAATTTTCTCTGGA	Os03g0577500	AK121292	Similar to Avr9 elicitor response-like protein.
3236	39	6	Os03g0131200|mRNA|AK066378|CDS+3'UTR	ACCTGAAGACACGTTTCTCCTGATACTTCATCATTATTGTAAGCACACCTTTTATCAATA	Os03g0131200	AK066378	Similar to Catalase isozyme 2 (EC 1.11.1.6).
3237	39	7	Os04g0622000|COMBINER_EST|Os04g0622000|8	CTGGGTTGGGAGAATACAAAACCATCCTTTTTTCGCAGATAAACATCCTTTTCCGGCGAT	Os04g0622000		Conserved hypothetical protein.
3238	39	8	Os09g0439800|mRNA|AK068870|CDS+3'UTR	GTTCTGGGACAAAGGCCTATTCCATGTGTCTACTCTCTTCTGCCCTGAAACTGTAAAGAA	Os09g0439800	AK068870	Conserved hypothetical protein.
3239	39	9	Os03g0125600|COMBINER_EST|CI006129|0	GGTGGTGTTGTGACTGAGACTGACTATGCCCCAGCTAATGCTTACAGTGTTAATGTGATT	Os03g0125600	CI006129	Protein kinase domain containing protein.
3240	39	10	Os05g0445900|mRNA|AK103871|CDS+3'UTR	ATTCAACTAGCTTGCCAAGAGACCTTACCATCTGTTCTCATGACATGTTAGTTTTTCAGA	Os05g0445900	AK103871	Similar to ROS1 (Fragment).
3241	39	11	Os10g0433100|COMBINER|CI150560|6	CTGACATGTAGGTCCATGTGGGCCCCCTATTTTAAAATTATTCTTTTGTGTGCTGCTGAA	Os10g0433100	CI150560	(No Hit)
3242	39	12	Os02g0564500|mRNA|AK103450|CDS+3'UTR	TTCCCCACATTTGTACATGGTAACCACTTACACTCCGCATTCGAACGTTTACTGTGCAGT	Os02g0564500	AK103450	SFT2-like family protein.
3243	39	13	Os11g0483000|COMBINER_EST|CI553248|0	ACACACACCATGTTTCATTGAGATCCTTGATAGATCCAAGGTAAACATTGGGTGGTGCTT	Os11g0483000	CI553248	Cytochrome P450 family protein.
3244	39	14	Os02g0225200|COMBINER_EST|AU173896|6	GTATGAAGAACAATTTAATATATGTACTATGGGATATTGGTTTCCTTGGTTCTTTGGCCC	Os02g0225200	AU173896	Conserved hypothetical protein.
3245	39	15	Os03g0703600|mRNA|AK107066|CDS+3'UTR	TGAGAACTTGTACCGACTGTCTCTCGTACGTGGAGAACTGCTCTATTTTCTGAGTTTGCA	Os03g0703600	AK107066	Conserved hypothetical protein.
3246	39	16	Os01g0175400|mRNA|AK102191|CDS+3'UTR	AAATACACTTGATTGAAATGGTGCCAAGCTTGTGCACAGTACAGTTAGTAGGTTAATTGT	Os01g0175400	AK102191	Ankyrin repeat containing protein.
3247	39	17	Os03g0581400|COMBINER_EST|Os03g0581400|8	GGTTGCGTTTGATGGATCCCCGCCGTTGGTTTACCCGATAAACATCAGCCAGCTCACTGC	Os03g0581400		Lipolytic enzyme, G-D-S-L family protein.
3248	39	18	Os03g0167400|COMBINER_EST|Os03g0167400|8	ACGTGCCCGGGCTCGGCCCCGACGCCTTCATCCCGCCCGAGGAGGTCAGGAGGAGCCGCT	Os03g0167400		Protein of unknown function DUF620 family protein.
3249	39	19	Os04g0623300|mRNA|AK061831|CDS+3'UTR	GCCATCATTACTGAACAAGATGGTGTATGTGTGACGAACAATTAATTTAAACGATCGATA	Os04g0623300	AK061831	Similar to Flavin-containing monamine oxidase family protein.
3250	39	20	Os05g0588800|mRNA|AK073047|CDS+3'UTR	TATCCTTGTGTAACCGCCTCTCTCTGTTCTCTTGTGCTCTTCTGTTGTGATGGGGAAATT	Os05g0588800	AK073047	Similar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica.
3251	39	21	Os02g0725000|mRNA|AK065888|CDS+3'UTR	ATGATAAGTGTTGTAGACTGTCCACTGCAACCTGTTTCTGTTATTTCCTGCATAATCTAT	Os02g0725000	AK065888	Similar to Protein kinase G11A (EC 2.7.1.-) (Fragment).
3252	39	22	Os06g0624900|mRNA|AK061790|CDS+3'UTR	CTACTGTTAGGTCACTAGCTAGATATGATATGTTGATTAGCAGCTAGCCTGATACATATA	Os06g0624900	AK061790	Conserved hypothetical protein.
3253	39	23	Os11g0649500|COMBINER_EST|Os11g0649500|8	CTGTACTTGAAGGACGTGCCGGTCTCCGACGAACGCAAGCCGGAGCCGAGATGTGGCCAT	Os11g0649500		Conserved hypothetical protein.
3254	39	24	Os05g0577900|mRNA|AK064201|CDS+3'UTR	ATTTCCATTCTTTGGTGTAGGAACTTCAATATAGCTTAATGTCTCGTTTTACTTTTTTTT	Os05g0577900	AK064201	Conserved hypothetical protein.
3255	39	25	Os02g0565200|mRNA|AK061593|CDS+3'UTR	ACATCTGTTAGTTTTTGCATATGACTAGCAAGGAATCGCTTTATAAAATCAAATCTTAAC	Os02g0565200	AK061593	Microsomal signal peptidase 25 kDa subunit family protein.
3256	39	26	Os04g0287400|mRNA|AK121494|CDS+3'UTR	GTGTAAAACAATTTTAGGAGACTTTGAGACTGAGCTTTTACTGAAGAAAAAATAAAGCAG	Os04g0287400	AK121494	Similar to WRKY transcription factor 51.
3257	39	27	Os12g0634900|mRNA|AK106811|CDS+3'UTR	CGCAGGAATGATGGCTTTTATTTGCTCCAGATGGAGAAGAAATGTTGTTGGAATGATGAA	Os12g0634900	AK106811	Tetratricopeptide-like helical domain containing protein.
3258	39	28	Os07g0513000|mRNA|AK064835|CDS+3'UTR	TAATCGCGCGAGATACACAAGATTTCAATTCAGCGATGCCAAATGTACAAGCAGAGTATT	Os07g0513000	AK064835	Similar to ATP synthase gamma chain, chloroplast (EC 3.6.1.34) (Fragment).
3259	39	29	Os12g0542200|COMBINER_EST|CI274228|6	AGAGGAAATGTGGTTAACACGATGTAATTGTAAGAAGACATGAAAGCGGCATTTTTGGGT	Os12g0542200	CI274228	Similar to Extensin-like protein.
3260	39	30	Os08g0109500|mRNA|AK069943|CDS+3'UTR	TGCTTACCGCGCTGGAGTAGGGTTGTACTTGAACCTTATAATTGTATTGTTGGTGTCAAA	Os08g0109500	AK069943	Bromodomain containing protein.
3261	39	31	Os05g0458300|COMBINER_EST|Os05g0458300|8	GCTGGGTCGCCATCCGCTTCGTCGCCGACAACCCCGGTTGGTTACCCGCTCTATACTTAT	Os05g0458300		Similar to Laccase (EC 1.10.3.2).
3262	39	32	Os11g0178700|COMBINER_EST|CB966978|7	CGGTGAACACGAAGTTCATGTTCATGAGGAGGCCGAACGTCTTCTGGTCGGCGAACGTGT	Os11g0178700	CB966978	Conserved hypothetical protein.
3263	39	33	PAtControl0002|mRNA|X64271|3'UTR		
3264	39	34	Os09g0401300|mRNA|AK065170|CDS+3'UTR	TAGGCTTACAAAAACTGTACTATTCTTGTTTCTTGTATGAACTTACAAGCTGCAGAATGC	Os09g0401300	AK065170	ZIM domain containing protein.
3265	39	35	Os10g0355800|COMBINER_EST|Os10g0355800|8	GCCACAAGCTTTATGTTCGGCGCAGTACTAATACTGGAACTTATGAGCAAGAATTGCTCT	Os10g0355800		ATP synthase beta chain (EC 3.6.3.14).
3266	39	36	Os01g0570500|mRNA|AK111702|CDS+3'UTR	AGGCATCCAAGGCCTAAATTTTGATGCCAACGATAGGATCCACTACTAATATTGTTGGGA	Os01g0570500	AK111702	Similar to Dual specificity kinase 1.
3267	39	37	Os06g0270900|mRNA|AB044537|CDS+3'UTR	GTGGTTGGTGCTCATGTTACTGATGGAGTATATTGTAGAAGCAGATTTATGTTCATTATG	Os06g0270900	AB044537	Similar to RF2 (EC 1.2.1.3) (T cytoplasm male sterility restorer factor 2).
3268	39	38	Os02g0121800|mRNA|AK103260|CDS+3'UTR	GTGCTTGTAGACTTGTGAATAATAAACAAAACATGCAATGACCATACTCCCTGTGAGATA	Os02g0121800	AK103260	Succinate dehydrogenase, cytochrome b subunit family protein.
3269	39	39	Os07g0111400|mRNA|AY341858|CDS+3'UTR	TGGATTAATTAGCACGGTAAGTAGTTACTTATTCGTGTTGAGATCACTGGAAAGATAATA	Os07g0111400	AY341858	WRKY transcription factor 29.
3270	39	40	(-)3xSLv1		
3271	39	41	Os07g0612500|COMBINER_EST|Os07g0612500|8	AAAGAGAAGAATGACAGTAACAAACAGAAGCCTTCTAAGAAGGTTTCTCAACTCAATACT	Os07g0612500		Transcription factor TAFII-31 family protein.
3272	39	42	Os12g0244000|mRNA|AK106408|CDS+3'UTR	TCATGTACTTCGGGTATAAATATGGCCCGACCCCATGTAATCAAGGGACGACAGTTCAAT	Os12g0244000	AK106408	Hypothetical protein.
3273	39	43	Os05g0337200|mRNA|AK063202|CDS+3'UTR	CAAAAATGACCATCTAAATCTCTAATTAAGATTACTGCTCTAATGCTATTATTCTACTTT	Os05g0337200	AK063202	Helix-loop-helix DNA-binding domain containing protein.
3274	39	44	Os02g0752800|mRNA|AK105991|CDS+3'UTR	CGCGGCCGGTCGAGAATTAAGCTGTAATCCCTTGTTACATGTTGGAAATTCAGTAGCTTA	Os02g0752800	AK105991	Similar to Dehydration responsive element binding protein 2B (DREB2B protein).
3275	39	45	Os08g0127500|mRNA|AK071322|CDS+3'UTR	TGTGAGAAAGAAAACTCATGTCATTCTTTTGTAGCTAAGAAATAATCAGCTTATTTGTAT	Os08g0127500	AK071322	Acid phosphatase/vanadium-dependent haloperoxidase related family protein.
3276	39	46	Os08g0155900|COMBINER|CI254543|6	TGCTTGATTCCGTTGCTGTGCCGGTTAATTGTGTTTGTTTAGCTCTGTACTCGTTATCCT	Os08g0155900	CI254543	Conserved hypothetical protein.
3277	39	47	Os02g0819500|mRNA|AK069427|CDS+3'UTR	CGTATATAGCTGCTGCTGAGCTGCACTGCACTGCATTGCATTCCCTGAATCAATTATCAA	Os02g0819500	AK069427	Ovarian tumour, otubain domain containing protein.
3278	39	48	osa-miR445d|Os05|Mature	TAAATTAGTGTATAAACATCCGATTAAATTAGTGTATAAACATCCGATTAAATTAGTGTA			miRNA
3279	39	49	Os09g0424300|mRNA|AK102445|CDS+3'UTR	GTTGCCGATGCTCTTTAAGGGAGAATGATATGTAACTCGATTATTTTCAATAACTATTGC	Os09g0424300	AK102445	S-adenosylmethionine decarboxylase.
3280	39	50	Os01g0111400|mRNA|AK066455|CDS+3'UTR	TCCGTGGGTGACCAAAACTAAAGCTAAATGTATCAGGTAATATTGATTGTAGTTTGTCCA	Os01g0111400	AK066455	Zinc finger, BED-type predicted domain containing protein.
3281	39	51	Os03g0165800|mRNA|AK069165|CDS+3'UTR	TCAGAAGAGGTAATTTTGCATGTTTGCTTCAATATATTTCGTACAGAGCTAATTGTCCAG	Os03g0165800	AK069165	Similar to Vesicle-associated membrane protein 725 (AtVAMP725).
3282	39	52	Os06g0712800|mRNA|AK121236|CDS+3'UTR	TGTACCTTCTGAGCACTAACACAAAAGTACAGAACTGAGATGTCTGATGGCTTGGGCTCT	Os06g0712800	AK121236	Similar to Ankyrin-like protein.
3283	39	53	Os01g0809000|mRNA|AK119363|CDS+3'UTR	ACGATGACGCGAAGACGACTCGACGATGCCGAGGAGATCGAGATCGATCTCGGCGGCGAA	Os01g0809000	AK119363	Conserved hypothetical protein.
3284	39	54	Os11g0191800|mRNA|AK071532|CDS+3'UTR	TCACCCCTCAAGTACATACACATACTTGCTTCCCTATCACTCAAATAGTTACAAAATGTT	Os11g0191800	AK071532	Conserved hypothetical protein.
3285	39	55	Os03g0581200|mRNA|AK073069|CDS+3'UTR	GAGAGTACAATGCAGCAGCCACAACAACTCAGTTCTCGGAGCATTTCTCTTGGCAATTAA	Os03g0581200	AK073069	Non-protein coding transcript, unclassifiable transcript.
3286	39	56	Os11g0120000|mRNA|AK060359|CDS+3'UTR	TGTGCGTGGCGTGGAAGAGAGGCTAGTAATTTGATTCGATTGGATTGGATTCAAGTAGTG	Os11g0120000	AK060359	Harpin-induced 1 domain containing protein.
3287	39	57	Os06g0664300|mRNA|AK100655|CDS+3'UTR	AATATGGATGGCGGTGTATCAAAAACCATAAAATAAGGTGTTTCTGTCTATTTGGAGTTG	Os06g0664300	AK100655	Similar to Vacuolar sorting receptor 6 precursor (AtVSR6) (Epidermal growth factor receptor-like protein 6) (AtELP6) (BP80-like protein d) (AtBP80d).
3288	39	58	Os08g0120000|mRNA|AK099077|CDS+3'UTR	GTCCATTCCATTATGTCGTGCGGTTTATGCATGAAGTAATTCATGGATTTTACCTTTGTT	Os08g0120000	AK099077	Succinate dehydrogenase iron-protein subunit (SDHB).
3289	39	59	Os12g0636000|mRNA|AK099519|CDS+3'UTR	ACTTATATTGTGTTTTTGATATGATGATGCTCAGAATGAGCAGGCTATGCAATTGTTTGG	Os12g0636000	AK099519	Zinc finger, RING-type domain containing protein.
3290	39	60	Os01g0361000|mRNA|AK120275|CDS+3'UTR	TCGTGTTAGTGTAGTTGAACTTCGAGGCTGTGATCGCTTTTGGTACTTCAGAACTTGGTG	Os01g0361000	AK120275	Conserved hypothetical protein.
3291	39	61	Os05g0532500|COMBINER|CI405886|6	AAGGGATTTTGCTCGTACAGTTTATGTGGGCAAAATCCCGTATACTATGGGACAGAGGTA	Os05g0532500	CI405886	Conserved hypothetical protein.
3292	39	62	Os06g0644600|COMBINER_EST|CI385800|1	TTTAATTTTTGGTGGGTGCTATAGCATTCAGCAAAACTATCGTGACAGACTTTTGATTTC	Os06g0644600	CI385800	WD40-like domain containing protein.
3293	39	63	Os09g0481300|COMBINER_EST|CI430972|0	TCTGTAAATGTCAAAAGTTCCTATATAAATGTATTTCTTTGCAGACCGTATAAATTGAAA	Os09g0481300	CI430972	Hypothetical protein.
3294	39	64	Os02g0729700|mRNA|AF264731|CDS+3'UTR	ATTTCTCGCGCGCGCGCGTCGTCGTGCATTCAATTCTCGTGTTAAAAAAATCGTTCTCTT	Os02g0729700	AF264731	Similar to HAHB-7 (Fragment).
3295	39	65	Os05g0374600|mRNA|AK110774|CDS+3'UTR	GAAAACATGATGTATAAGTTTATGCAGATTGCCTGTTGTTGAATGCGTTTTTGTTCTTCG	Os05g0374600	AK110774	Heat shock protein DnaJ, N-terminal domain containing protein.
3296	39	66	Os11g0591800|COMBINER_EST|CI442904|0	TCTGAATAACAGAATAAGCGTGTTCCTTTTGTTTAATCAGTTGCATCTTCTGAGCTCAAG	Os11g0591800	CI442904	Barwin-related endoglucanase domain containing protein.
3297	39	67	Os03g0353400|mRNA|AK062176|CDS+3'UTR	GTTAATGTTCTGATGATGTGCAATAGCAAGCAGCCTAATGTTGAATATTCAGACTTTTCT	Os03g0353400	AK062176	Similar to Poly(A)-binding protein C-terminal interacting protein 6.
3298	39	68	Os01g0682500|mRNA|AK104091|CDS+3'UTR	GTTTCTTGTGGCTTGAACAAGTACTAAACGTGTAAAACTTTGATGTATACGAAATCTTGC	Os01g0682500	AK104091	Conserved hypothetical protein.
3299	39	69	Os01g0935900|mRNA|AK058930|CDS+3'UTR	GCCAACTAAGGCACCAAACAATGTATTTCTTCAAGCAACGATCAGTTTGTCCCTAAAACC	Os01g0935900	AK058930	Conserved hypothetical protein.
3300	39	70	Os01g0917400|mRNA|AK112102|CDS+3'UTR	AAACTACAGGTTGTAAAATCTCTCTGAGGTGACCGATCTACGTAGATACTCCCTCGGTAA	Os01g0917400	AK112102	Zinc finger, CCCH-type domain containing protein.
3301	39	71	Os05g0344200|mRNA|AK104716|CDS+3'UTR	AGATTTCGCAGCTGCTGCCTTGTAATTTCCGAGATATGGATACAGTTCCCCTTTCGTGTC	Os05g0344200	AK104716	Conserved hypothetical protein.
3302	39	72	Os12g0414500|mRNA|AK110880|CDS+3'UTR	TCTACAAAGAAGAAAAATGATCTGTACTGAAAGTAAGAAATATATATAAACAAAATTGAT	Os12g0414500	AK110880	nucleic acid binding, OB-fold, tRNA/helicase-type domain containing protein.
3303	39	73	Os07g0427900|COMBINER|CI396069|6	CTTCATGGTTAATTATACTCTCTGGAACTTTCTCGGATTTTTCGGAGCTCAATTCCTAAT	Os07g0427900	CI396069	(No Hit)
3304	39	74	Os05g0533600|mRNA|AY224560|CDS	AAGGACATGAGGATAGATTTCAGCTGGGCCTCTTCAGCTTCCCAGTACGAAGATATCTAT	Os05g0533600	AY224560	Similar to Starch synthase IVa (Glycogen (Starch) synthase-like).
3305	39	75	Os07g0613300|mRNA|AK099895|CDS+3'UTR	GGTTTTTCACCCCTTTGTTAGCTGGGGTGCTGTACAGATTCTTTAATATAGTTGCGTCGT	Os07g0613300	AK099895	Similar to PAUSED.
3306	39	76	RC12		
3307	39	77	Os08g0486200|mRNA|AK063813|UTR	ATGATTGTGGTGATGGCGCTGATGCTGATTATGGGCAGATCTTGGTATTGACACACTGAT	Os08g0486200	AK063813	Similar to Splicing factor SC35.
3308	39	78	Os01g0864100|mRNA|AK064616|CDS+3'UTR	CTGGTGTGACTGCACGAGGTGGTTAATTTTTGTGCAGTAAATTCTGAGCTGGAGTGTACA	Os01g0864100	AK064616	Conserved hypothetical protein.
3309	39	79	Os05g0316200|mRNA|AK060608|CDS+3'UTR	GCAAAACCGAAGATTAAAGAGGGTTGAATGAATAAGCATAACCCTGTGTGTTATGCATTT	Os05g0316200	AK060608	Conserved hypothetical protein.
3310	39	80	Os11g0531300|mRNA|AK105736|CDS+3'UTR	TGAAGTAACCCCAGGATTAAGTTAGGTCGTAATTGGAACCTTCTGTTTATGGATCATGTA	Os11g0531300	AK105736	Similar to Universal minicircle sequence binding protein.
3311	39	81	Os04g0431400|COMBINER_EST|Os04g0431400|8	AGCGCAGATGGCGGCGCGGACGGTGCGGACATTAGTGCGGAGACGGAGGCGGCGGTGGAG	Os04g0431400		Hypothetical protein.
3312	39	82	Os10g0413400|COMBINER_EST|Os10g0413400|8	TCTTCCACGACGGCCGCCTCGCGCGGCGGCCGACTCCGCTGGCGGCGCTGCTCGCCGTGC	Os10g0413400		Similar to Glycerol-3-phosphate acyltransferase 6 (EC 2.3.1.15) (AtGPAT6).
3313	39	83	Os01g0714100|mRNA|AK060399|CDS+3'UTR	TGAAGGCGCAATAGCAATACAGCCTTCTCATGTATGTAGTGGTTCTAGCATTCATTTGGC	Os01g0714100	AK060399	Conserved hypothetical protein.
3314	39	84	Os01g0161300|COMBINER_EST|Os01g0161300|8	TCCAAACAGTGCAACTATTCAGGCATAGAAGCTGCAAGATCACCATCATCCTCTCGAGAT	Os01g0161300		Leucine rich repeat, N-terminal domain containing protein.
3315	39	85	Os02g0734700|COMBINER_EST|Os02g0734700|8	CGAGGTCTCCCGCCCCCGCCTCATCTGTGATAATGGCATCGGTGTGATGACCACAGAGGA	Os02g0734700		Conserved hypothetical protein.
3316	40	1	Os06g0119100|mRNA|AK099129|CDS+3'UTR	TTCATTTGTTGTGAAAATGTCTCTACTACTGTAAGTGCATGAGTATGTGTGGTTATAGAG	Os06g0119100	AK099129	Protein of unknown function DUF594 family protein.
3317	40	2	Os02g0801900|mRNA|AK109488|CDS+3'UTR	TCTTTGGGTAAGAATTTCTTAACTGAATAACATGTATATGTGAAATAATCATATGATTGT	Os02g0801900	AK109488	Conserved hypothetical protein.
3318	40	3	Os02g0638900|mRNA|AK111517|CDS+3'UTR	CATTTCAGAACTTCGGCTTTCCCGTTAGAGTATAGCATATGGACCTGGATGCTGAGTCAT	Os02g0638900	AK111517	WD40-like domain containing protein.
3319	40	4	Os04g0414800|COMBINER_EST|Os04g0414800|8	TGCTAACATTGACCGATGGGGAAATGTTTCTGAAACTAGAGCTGAGATGACAGGAAGAGG	Os04g0414800		Protein prenyltransferase domain containing protein.
3320	40	5	Os06g0613400|mRNA|AK119314|CDS+3'UTR	AGAATGTACTTACTGTCACATCGATTCTATGTAAATGACATCTGACATTGAAAAGCAGTC	Os06g0613400	AK119314	Conserved hypothetical protein.
3321	40	6	Os12g0580300|mRNA|AK102871|CDS+3'UTR	TGTTGCTAAACTTTTACTAACTTGTTAACAGACAGACAGAATGATAACATGGACTGTGGA	Os12g0580300	AK102871	Similar to TATA-binding protein TBP2.
3322	40	7	Os01g0350900|mRNA|AK058986|CDS+3'UTR	TTATGTGGAATTCGGTTCGGTGAAGCATCATAGTACATATTCCAAGCCATGTTGGGGCTT	Os01g0350900	AK058986	Similar to VIP2 protein.
3323	40	8	Os08g0388300|mRNA|AK066779|CDS+3'UTR	GTCTGTGCCAGAAATACCAGTACATAGATATTCTTTTGGTGTGATTTGCTTTTCTATTGG	Os08g0388300	AK066779	Disease resistance protein family protein.
3324	40	9	ETG09_48764		
3325	40	10	Os05g0302700|mRNA|AK061642|CDS+3'UTR	AAGCGTTTCTTGAGATTGTTATTGATGTGGTTCCTAGTCGATTATATAGATTATCACTCC	Os05g0302700	AK061642	Similar to ATP/ADP carrier protein.
3326	40	11	Os07g0256700|mRNA|AK063314|CDS+3'UTR	TAGATCGTGTTTTTGTTTGTGGAAAATTAATTACCGTAGGAAAGGCTTCCTACAAATGTT	Os07g0256700	AK063314	Protein of unknown function DUF231, plant domain containing protein.
3327	40	12	Os11g0645600|mRNA|AK101982|CDS+3'UTR	GTAGATCAATGAACTGTGGAAAATCCCCAAATTCCTCTCCTAAATTACAAAGAATGACCT	Os11g0645600	AK101982	Conserved hypothetical protein.
3328	40	13	Os07g0254400|COMBINER|CI098833|6	AGGATTAGACTGACGGACTCCTTGCAGCTTCGATCTCGTATCAGATGGTTTTTGGATAGT	Os07g0254400	CI098833	(No Hit)
3329	40	14	Os01g0887700|mRNA|AK058498|CDS+3'UTR	TAATTTAATTTTAAACTGTAACTGTTGATTAACCTACCTGTGTTTAAAGCTTCATCTTTC	Os01g0887700	AK058498	Zinc finger, FYVE/PHD-type domain containing protein.
3330	40	15	Os01g0109500|mRNA|AK058636|CDS+3'UTR	TGGAGTAGTAGACAAAGAAAAAGTTGTAGGTAGACGGGCAGATCAATTACATTCTACGCC	Os01g0109500	AK058636	Conserved hypothetical protein.
3331	40	16	Os01g0837500|mRNA|AK105439|CDS+3'UTR	TGCATATGAATTATCGTGTATTTTGGTTTCCCATGCTAATTAGTTCCAGATTCCGTTTGT	Os01g0837500	AK105439	Similar to Ruvbl1 protein.
3332	40	17	Os08g0208700|mRNA|AK068849|CDS+3'UTR	GTTGAAATCCTCACTGTGAGAAGGACATCAATTTTTGGTTGTATTTTGCAGTGTTGATAT	Os08g0208700	AK068849	Similar to Transposase (Fragment).
3333	40	18	Os08g0328600|COMBINER|CI426146|x	GGACTGTTAAAACTATTTGTCATATGGACTGTTATGGACTGTTAAACCTATGTAATGGAC	Os08g0328600	CI426146	Cyclin-like F-box domain containing protein.
3334	40	19	Os12g0456200|mRNA|AK069528|CDS+3'UTR	TAAAATGTGCTACACTTGAAAAGTTCAGTGGGTGCAAAGCAGTTTAAAGCATGGACAAGT	Os12g0456200	AK069528	Co-chaperone Hsc20 family protein.
3335	40	20	Os09g0333500|mRNA|AK072827|CDS+3'UTR	GGAAGACCATGTCGAGTTTCAGACTTTGATCAAATATTGGTTATCATAGATGTTTTACAG	Os09g0333500	AK072827	Similar to PDR-like ABC transporter (PDR4 ABC transporter).
3336	40	21	Os01g0822800|mRNA|AK065060|CDS+3'UTR	CGCTTACAGTTACGTACAGGCTTGTAATATTACCGTATAAGTAGTATCATTTTGCGAGGA	Os01g0822800	AK065060	Similar to RING-H2 finger protein ATL3C.
3337	40	22	Os08g0113000|mRNA|AK069503|CDS+3'UTR	TGCTACAGTTAGCAGCTGGTATAATTGTGGTACTGTATAGGAAAGATTGTAAAACAATCA	Os08g0113000	AK069503	Similar to Peroxidase 47 precursor (EC 1.11.1.7) (Atperox P47) (ATP32).
3338	40	23	Os02g0155400|mRNA|AK107566|CDS+3'UTR	GTGCTATATGATCAGACAATCATATCCAGATATTTTGGCTAAAGCAGTTCCAATAGAGAC	Os02g0155400	AK107566	Leucine rich repeat, N-terminal domain containing protein.
3339	40	24	Os09g0423700|mRNA|AK061595|CDS+3'UTR	TCTGTTCATATTCCTCTGTACGTACAAGTGGTACTATGATATTTTTGCACTGCCTCAGCT	Os09g0423700	AK061595	Conserved hypothetical protein.
3340	40	25	Os04g0347900|mRNA|AK102622|CDS+3'UTR	CCAGTCGCAGGTGTCTGATACAGCTAATGTATTTTGATTCCTGGAACTGTGCTATCCACA	Os04g0347900	AK102622	Conserved hypothetical protein.
3341	40	26	Os04g0282400|mRNA|AK120187|CDS+3'UTR	AGTCTTGTACTTTGTGGTTTGGAGCCATTGCTTGACTGATTCCGTGGCACGAATCAATCA	Os04g0282400	AK120187	Similar to FPF1 protein-like (RAA1).
3342	40	27	Os04g0662200|mRNA|AK107934|CDS+3'UTR	CCAGTGTAAATAACTGTACTACTGCGATTATTCTGCCACCATTTCAAGTGAATTGAAACA	Os04g0662200	AK107934	Auxin responsive SAUR protein family protein.
3343	40	28	Os08g0556700|mRNA|AK099902|CDS+3'UTR	GAGATAGATTCATACAGTTAACAGTATAATGCAGGATGTAAAAGGGATAAGGGACATTTC	Os08g0556700	AK099902	Myotubularin-related domain containing protein.
3344	40	29	Os09g0116400|mRNA|AK101139|5'UTR+CDS	CAGATTCTGATACTGAAGCCCTTGAAGGTGCTAACCATTCAGATGGCAATGACAGTGATG	Os09g0116400	AK101139	Armadillo-like helical domain containing protein.
3345	40	30	Os02g0726000|mRNA|AK099178|CDS+3'UTR	TCTGAGTCCAAAACTCCAAGTCGAATTATGTAATGATCTGATCAAACTGAAATGCATCTG	Os02g0726000	AK099178	Beta-Ig-H3/fasciclin domain containing protein.
3346	40	31	Os01g0651000|COMBINER_EST|CI474068|0	TTTCAGTTTACTTAGATGATTTCGAGGAGAAATAAGTTCAAGTAATGTCATGCTCGATGC	Os01g0651000	CI474068	Lipolytic enzyme, G-D-S-L family protein.
3347	40	32	Os06g0299100|mRNA|AK066533|CDS+3'UTR	GAGTTATGGACAGTATGTAATCAACAACTTAATTAGCACTATTTAATCTATCGTGATAGA	Os06g0299100	AK066533	Glucose/ribitol dehydrogenase family protein.
3348	40	33	Os11g0158600|COMBINER_EST|CI151191|6	TTGGAAGTGTATGTGGCATTTTGGCCAATCACAGTAATTTCAGTATTGGTTTTGGGATAT	Os11g0158600	CI151191	POX domain containing protein.
3349	40	34	Os03g0807100|COMBINER_EST|CI041409|0	GTCAGAGGGCCATGCTTTATTTTTCTCATGTCACCTTTACCTCCTTTGAATGTCAGTGGT	Os03g0807100	CI041409	Protein of unknown function DUF239, plant domain containing protein.
3350	40	35	(-)3xSLv1		
3351	40	36	RC11		
3352	40	37	Os01g0260000|mRNA|AK108460|CDS+3'UTR	AGGATAAAAGTTGGCCAAGCCTTTCTTCTTCAGTTAAAGGTACGGGCAACATCTAAACAG	Os01g0260000	AK108460	Protein prenyltransferase domain containing protein.
3353	40	38	Os05g0511700|mRNA|AK063707|CDS+3'UTR	AAGGGTTTAGACATGTTTAGGCATACCCTACTCTTGTTTCGTGGATTGGATCTGCCGGAT	Os05g0511700	AK063707	Putative rRNA methylase family protein.
3354	40	39	Os05g0582100|mRNA|AK058748|CDS+3'UTR	AAGGAAGGGTTTCCCTTTTGTAAAACGAAATATAAAGGGCAAGCCCCAATCTTTCTTTCT	Os05g0582100	AK058748	Cas1p-like family protein.
3355	40	40	Os05g0448300|COMBINER_EST|CI332456|0	CTCATGTTGTTCGTTGTGGACTTGTGGTATAACGACTTTGATCATTTCTTTGTCCTTTTA	Os05g0448300	CI332456	Conserved hypothetical protein.
3356	40	41	Os07g0270900|mRNA|AK058966|CDS+3'UTR	ATCAAACTCTCTGGTTTAAAATGATCATTGGATGGTTTCCACTGGAATTGGAATCTGATT	Os07g0270900	AK058966	Mak16 protein family protein.
3357	40	42	Os01g0153000|COMBINER_EST|Os01g0153000|8	GCTTCTTTTCTTGAGAGCGCCATGAACATAGCTGATCGAACAATCTGGCTGCATGAAGAA	Os01g0153000		Protein kinase-like domain containing protein.
3358	40	43	Os08g0483200|mRNA|AK068161|CDS+3'UTR	AATAAATGTGACCGGAAGAACTGTGACAACTGTCAAATTAATATATAGCCTTCACATCAG	Os08g0483200	AK068161	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
3359	40	44	Os02g0613200|mRNA|AK065051|CDS+3'UTR	GATGCTTATGTGTAGTGTGGTGTACAGTGCCGCATTTTCTGTGGCAGTTTGTGATGTCAT	Os02g0613200	AK065051	Conserved hypothetical protein.
3360	40	45	Os07g0539700|COMBINER_EST|Os07g0539700|8	CTCCTTTTCCCCAAAGAGGCAAGGGACGAGCTCCCCTTTTCTCTCCCTCTTTTCCCCTTT	Os07g0539700		Protein of unknown function DUF26 domain containing protein.
3361	40	46	Os06g0266800|mRNA|AK062516|CDS+3'UTR	GATGCATGCCTTTTTTTCTTTCTTCTTTTTTTTTTGTTTTTTTACCGTATGATTAATACC	Os06g0266800	AK062516	Similar to GAST1 protein precursor.
3362	40	47	osa-miR439b|Os10|Mature	TGTCGAACCGCGGTTGTTCGATGTCGAACCGCGGTTGTTCGATGTCGAACCGCGGTTGTT			miRNA
3363	40	48	Os05g0486300|mRNA|AK073521|CDS+3'UTR	AACCTGTTTTTACCTGTACCGTACCAGATATGTCGTTTAAACTTATCAGGCACCGACATT	Os05g0486300	AK073521	NOT2/NOT3/NOT5 domain containing protein.
3364	40	49	Os06g0506200|mRNA|AK067824|CDS+3'UTR	TGCATGCCTGCTCGTTGAATTTGAAGGACCTGGAAAGCCATTTCTTTCCATTCTTGATTG	Os06g0506200	AK067824	Protein of unknown function DUF250 domain containing protein.
3365	40	50	Os09g0472700|COMBINER|CI279886|6	TGTTCCAGCTGAATTCCGGTTGGTGCCAATAAAACAGATTGTATGAGAGAGCGAAAAGAA	Os09g0472700	CI279886	Barwin-related endoglucanase domain containing protein.
3366	40	51	Os05g0301500|mRNA|AK059501|CDS+3'UTR	CCGCCTGAAACTGATTGAAATTTTGCACTTAATAGCAAATCACGCGACCTTTCACCTTGT	Os05g0301500	AK059501	Similar to Ribophorin I (Fragment).
3367	40	52	Os01g0948600|mRNA|AK103603|CDS+3'UTR	CGTGTGATAGAAATTTTTCATGTATACTGCGTCTTGTGTTTGGTACGGCTTCGTGTGATT	Os01g0948600	AK103603	Non-protein coding transcript, unclassifiable transcript.
3368	40	53	Os08g0522300|mRNA|AK111038|CDS+3'UTR	TGTAAATATAAAAAACGAAAAGTTGTGCTTAAAGTACTGTAGATAATAAAGTAAGTTATA	Os08g0522300	AK111038	Conserved hypothetical protein.
3369	40	54	Os07g0130800|mRNA|AK066399|CDS+3'UTR	GGCCAATGTTTTGTTCATACCACTTGTTAGCTGCTATACTATGACCAAAGGAGTGGGTTG	Os07g0130800	AK066399	Similar to Resistance protein candidate (Fragment).
3370	40	55	Os02g0630300|mRNA|AK108598|CDS+3'UTR	CATCTGCCTATGGTAGGTGGTTTGTCTGTCTGCGTGAAAAAGTACAGATTCCGTGAACAT	Os02g0630300	AK108598	Similar to Gibberellin 2-oxidase 3.
3371	40	56	Os12g0186500|COMBINER|CI422499|6	CCAAGAATAAGAACTATCCTGAGCAGAGTGTTGAAGAGAAGCCCTTGTTAGTATGCTTGC	Os12g0186500	CI422499	(No Hit)
3372	40	57	Os03g0124100|mRNA|AK107007|CDS+3'UTR	TGTCGAGGTGTTCAAATAATCTGGCAAACAGGTGAAGACCAGAGGCTACGAGTGTTCAAA	Os03g0124100	AK107007	Fringe-like family protein.
3373	40	58	Os04g0390000|mRNA|AK067777|CDS+3'UTR	GTTGGGATGCATCATTTTGTGTTTCTTAACATCAAATTAAACCAAGTTGCATCCAATGCT	Os04g0390000	AK067777	Similar to 2-oxoglutarate dehydrogenase, E1 component.
3374	40	59	Os10g0580800|mRNA|AK104823|CDS+3'UTR	ATTGGTTGTGTTTGTCGTTGAAATTGCATGCGTTTGGTGTGCGAATGTGGATGGATTGAT	Os10g0580800	AK104823	Similar to NClpP4 (Fragment).
3375	40	60	Os04g0611300|mRNA|AK104924|CDS+3'UTR	GGTGGATACCGTATTGAAATCAGCGAAAGCAGTGAGCCAGTGACACCCTATTCAGGAGCT	Os04g0611300	AK104924	Conserved hypothetical protein.
3376	40	61	Os03g0171900|mRNA|AK061079|CDS+3'UTR	GTGTTGGCCTTAGGGGCAACATGTGTATCCAAAAGAAAAACTAATAAATGTATGCTTGTT	Os03g0171900	AK061079	Similar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
3377	40	62	Os02g0761000|mRNA|AK070121|CDS+3'UTR	TATGCGATACATCATATATGCACTTTGTTGCTATCTTAATTATGATGCGTCTTTTGCAGC	Os02g0761000	AK070121	Similar to Transcription factor MADS55.
3378	40	63	Os08g0104600|mRNA|AK119709|CDS+3'UTR	CGAGGGTTAATTGTTGTTGTTTAATTAATGTACGTTTTGCTGCACCTGCTTAATCATATC	Os08g0104600	AK119709	Ferredoxin I, chloroplast precursor (Anti-disease protein 1).
3379	40	64	Os03g0301000|mRNA|AK066115|5'UTR+CDS	CTATTACAGTTCTCCACTGTAACTGTGGGTCCCACGTGTCAGTTTTTTCACCCTTCTTCT	Os03g0301000	AK066115	Conserved hypothetical protein.
3380	40	65	Os05g0355400|mRNA|AK063864|CDS+3'UTR	CCCGGCACCAACGCCAAGGCCTCTTGATGCGCCAACTCCGCGGTCCAGGATGCAATCTGT	Os05g0355400	AK063864	Universal stress protein (Usp) family protein.
3381	40	66	Os02g0164300|mRNA|AK063785|CDS+3'UTR	TCATTTTGTATCGATCTCCTGTACTGTATACTGTATATGGCTGCCATGATGTATGACCAA	Os02g0164300	AK063785	Glycosyl transferase, family 31 protein.
3382	40	67	Os01g0532300|COMBINER_EST|CI542224|1	CAGTTGGCTAGTCTTGGGGTTAAATATTTCAAGGTTATAGGAGAGGTTGATTTCTCCTAA	Os01g0532300	CI542224	Conserved hypothetical protein.
3383	40	68	Os04g0505500|mRNA|AK121493|CDS+3'UTR	CTTGTTGTAAAATATTGTGTGGTCTTTGACAAAATTAAATAAAGTTTCCTCTTGCGATCA	Os04g0505500	AK121493	Conserved hypothetical protein.
3384	40	69	Os01g0834200|mRNA|AK100543|CDS+3'UTR	CTTTGTCCAAGTGACTGTCCCAGTATCCCTTACCACTTGAAAATGGAAGTTGCAGTCGTT	Os01g0834200	AK100543	Similar to T-cell immune regulator 1 transcript variant 3 (Fragment).
3385	40	70	Os07g0264100|mRNA|AK104725|CDS+3'UTR	GAATAATTGATCATTGAATCGCCTATCCTTGCAAGGATATAATAATAAGATGTTGCTCTG	Os07g0264100	AK104725	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein.
3386	40	71	Os05g0513800|mRNA|AK101866|CDS+3'UTR	ATGCAGGCTATGTTGTAGTATGCTCTGCTACTGGTGTATGTTATAAATATAAAATTCTGC	Os05g0513800	AK101866	Small GTP-binding protein OsRac2.
3387	40	72	Os10g0478000|COMBINER|CI552591|3	CCGAGCTTGCTCCAAGATCGCCGGAAAACGAGCTGCTAGCCTCCTACGCATGCACTAGTT	Os10g0478000	CI552591	Protein of unknown function DUF640 domain containing protein.
3388	40	73	Os02g0610500|mRNA|AK100097|CDS+3'UTR	AGTAGCTGTTTTTGCAACCGTGACCATGGTTCAGTGCTTCAAGTTCAAGGGCGTTAATGT	Os02g0610500	AK100097	Similar to CONSTANS-like protein CO9 (Fragment).
3389	40	74	Os06g0329700|COMBINER_EST|Os06g0329700|8	AAGTCATCTCAAACGGGCTGGAACTTAAAGCCGTTTGAGATCGAGCACAGAGATACAGAT	Os06g0329700		Conserved hypothetical protein.
3390	40	75	Os04g0490600|mRNA|AK063469|CDS+3'UTR	TTCCCTTTGTTCTTTTGGCAAAATCGATGTATGTTAACGGGACACAATTGTACTGAACAT	Os04g0490600	AK063469	Nucleotide-sugar transporter family protein.
3391	40	76	RC6		
3392	40	77	Os02g0294600|mRNA|AK101077|CDS+3'UTR	ACATAGTGTGGGGAAACCTGCTGGGTTTCATGCACGATCTCTCATGTATTCCATCTTACT	Os02g0294600	AK101077	Similar to WD-repeat protein-like.
3393	40	78	Os02g0805400|COMBINER_EST|CI516270|6	GAAGGCATAATATAGGGGTAAGCGTGGCAGAGAATACATCATGTAATCATCATTCAATCA	Os02g0805400	CI516270	Galactose oxidase, central domain containing protein.
3394	40	79	Os01g0350000|mRNA|AK071594|CDS+3'UTR	TGAGATCTGTTCCGCTAAATATTTTTTAAGTAGGGTTTTAGTTGGTCAGGACCTAGCAAA	Os01g0350000	AK071594	Transferase family protein.
3395	40	80	Os01g0273300|COMBINER_EST|CI220322|6	TGATTACTGCCCCTGTAAAATTTTCAATAGTATGGTAGGGTTCTTCTGTTATGAACTTAC	Os01g0273300	CI220322	BSD domain containing protein.
3396	40	81	Os06g0693200|mRNA|AK105794|CDS+3'UTR	TCTCCACTGGGCCCACTTGTAAATAGAAAGGATTTTCATCTTATCATCATCCAACAGGCT	Os06g0693200	AK105794	Protein kinase-like domain containing protein.
3397	40	82	Os05g0285900|mRNA|AK066158|CDS+3'UTR	GAAAAGTTTCTCCATGGCAGATTGAGGCTGTTATTTCCTGTAGATTTAGGTTTCGCTGTA	Os05g0285900	AK066158	Conserved hypothetical protein.
3398	40	83	Os12g0569700|mRNA|AK062695|UTR	TACCAAATCTCTGTTGCATATGGATCCACTCTTGGATATCGGTTTTCGCTTGAATGCCGT	Os12g0569700	AK062695	Similar to Non-cell-autonomous heat shock cognate protein 70.
3399	40	84	Os06g0682700|COMBINER_EST|CI375343|6	ATGAACAGAATTGGCTTATCAAATGATTGTACGATGCAAATATGTATTGTCACCAGTAGC	Os06g0682700	CI375343	Non-protein coding transcript, unclassifiable transcript.
3400	40	85	Os04g0639200|mRNA|AK070786|CDS+3'UTR	CTGTAACTAGAACATGTATCTTCTGAGGAAATAATAAATTCTAGAGTCTTGAGACTACGG	Os04g0639200	AK070786	Conserved hypothetical protein.
3401	41	1	Os01g0727700|COMBINER|CI209896|6	TGACATTTTGTAAAATTGGTTCGAAATGTGAGGTGAATATATATATGTCTGTTGATGGCT	Os01g0727700	CI209896	Protein of unknown function DUF584 family protein.
3402	41	2	Os03g0601900|COMBINER|CI018213|6	CAAGGAGGGAACAATAGTGAGGAGAAAGTACGTGCCGTAATTATTGTGTACACGATGTAA	Os03g0601900	CI018213	(No Hit)
3403	41	3	Os07g0529800|mRNA|AK120697|CDS+3'UTR	AAGTTTGTAAGAGGCACCATCACTATAGATGATGGCTTGTGTCCCTCTTTCATCAAGATT	Os07g0529800	AK120697	Protein translation factor SUI1 homolog (GOS2 protein).
3404	41	4	Os08g0224700|mRNA|AK121754|CDS+3'UTR	ACTGGTTTAGTGTGTGGAAAAATTGTTGGTATTAGTCACCAGAGTAAAATATTTCACCTG	Os08g0224700	AK121754	Similar to 26S proteasome subunit RPN2a.
3405	41	5	Os04g0607000|mRNA|AK059884|CDS+3'UTR	TGTGATTAATGTGATGGTTAAATTGTCCAGACTAATGAGCATGGTTATGGATTTTTGGTG	Os04g0607000	AK059884	PAP fibrillin family protein.
3406	41	6	Os03g0135100|mRNA|AK059955|CDS+3'UTR	GTCGTCTACGTTAATTGTCGTTTCGGCTAAGAATAATATGAAGCCTTCTTGAGGTCTCCT	Os03g0135100	AK059955	Glutathione S-transferase GSTF15.
3407	41	7	Os11g0157000|COMBINER_EST|CI225501|6	CCTGATGTTGAACTAAACAACTCTGAAGTTCATTTTGTTGTGAGTTGTGACAATTAAGAA	Os11g0157000	CI225501	Integrase, catalytic region domain containing protein.
3408	41	8	Os06g0661700|mRNA|AK067348|CDS+3'UTR	CATCACTGTATATTTGAACAACTCTTGGCTGATTTTGAAGTGCTGCTGGCCTTCCGATTT	Os06g0661700	AK067348	RabGAP/TBC domain containing protein.
3409	41	9	Os02g0633400|mRNA|AK073723|CDS+3'UTR	TCAAACAACTATGAACGTGTTTGCAATTGAAGCATCTTATTTTCTTATGACAGTACAGGC	Os02g0633400	AK073723	Similar to 61 kDa protein homolog.
3410	41	10	Os03g0818800|COMBINER_EST|CI364445|6	CTCCGTGTTAATACTGCTGCTACTGTACGTATCGTGCCATGAATATAATTAATGAATTCA	Os03g0818800	CI364445	Similar to Floral homeotic protein.
3411	41	11	Os04g0516800|mRNA|AK105554|CDS+3'UTR	TCCAATTCGGTTTGGTTTGCATTGCAAACATGTAAAAGAACAATCAAATTCCAATTCGTT	Os04g0516800	AK105554	Conserved hypothetical protein.
3412	41	12	Os02g0779500|mRNA|AK063877|UTR	CAACCCTCCTACTACACGAAGTAGTCTAAGAGGGTCCCATAATCGTATAAAAGTGGAGAC	Os02g0779500	AK063877	Non-protein coding transcript, putative npRNA.
3413	41	13	Os01g0589800|COMBINER_EST|CI434191|0	TGGATTTGGACTGATCGCGGATGTTTGACGTTATTGTTCTGTATAAGCATGAAGTACAAT	Os01g0589800	CI434191	Conserved hypothetical protein.
3414	41	14	Os12g0541000|COMBINER_EST|CI558304|0	CTCTGTTGAACGAAGCGGAGACAGTTGAAGAGTTCCATATGATAATTCAGAGTTATAAAG	Os12g0541000	CI558304	Lumazine-binding protein family protein.
3415	41	15	Os03g0379300|mRNA|AK061515|CDS+3'UTR	ATATTTCAATCTCCCTTTTGTTTCTGTAAACTCTAGTGAGAATAGAACCCGTTTTATCCC	Os03g0379300	AK061515	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
3416	41	16	Os05g0249100|mRNA|AK103049|5'UTR+CDS	CTCGTCTATATCAACATGAAGAAAGAATAGTGCCGTCTGTGATGCCAATGTACCGTTCGT	Os05g0249100	AK103049	Conserved hypothetical protein.
3417	41	17	Os02g0244700|mRNA|AK065425|CDS+3'UTR	AAGTTACATATGTAACTACAATACATATAGACTGTAACTGGGCTAAAACTGCAAGCATGC	Os02g0244700	AK065425	Similar to Phosphoenolpyruvate carboxylase 1 (EC 4.1.1.31) (PEPCase 1) (CP21).
3418	41	18	Os04g0537900|mRNA|AK103573|CDS+3'UTR	TGATTATGACCAAATATGTGCATGATGTTGTCTTCAGACTTGATAATAAACAAGTAGGCC	Os04g0537900	AK103573	Similar to C13 endopeptidase NP1 (Fragment).
3419	41	19	Os09g0518000|COMBINER_EST|AU183565|6	CATCGCTATGGTTGTTGAGTTGGATGATGTTGATTTAGGGATTGTCTAAATTTCAGGTGA	Os09g0518000	AU183565	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
3420	41	20	Os08g0245200|mRNA|AK069932|CDS+3'UTR	AGAGACAGGACACTGGGGAAGCCATGTACAAAAATGTTCAGACCTGTTTATTGTTCTTGC	Os08g0245200	AK069932	Similar to 4-coumarate--CoA ligase 1 (EC 6.2.1.12) (4CL 1) (4-coumaroyl-CoA synthase 1).
3421	41	21	Os01g0719600|mRNA|AK070988|CDS+3'UTR	CATATACAGAAGCACCGTCAGGATTGATCAGGAAATGTAACTAGGGAAGAAGCGCCATTT	Os01g0719600	AK070988	Heavy metal transport/detoxification protein domain containing protein.
3422	41	22	Os07g0167800|COMBINER_EST|Os07g0167800|8	GGGTCGGGAGCATGCCTAAAACCATGCTCAGCTACGAGGACAACAACAACGGCTTGCTCA	Os07g0167800		Hypothetical protein.
3423	41	23	Os01g0876500|COMBINER_EST|CI274204|6	TTAACGATGGTAAGGGGGTTACCTCTTCCTACCGCGGTAGCAAAACTGAGCAAACTTTAA	Os01g0876500	CI274204	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
3424	41	24	Os04g0675300|mRNA|AK111982|CDS+3'UTR	GTTTTTTAGCTGTAAAACTATAGGGCTGTAAATCGAGGGTGTAAATATACATTATAGTCC	Os04g0675300	AK111982	Hypothetical protein.
3425	41	25	Os01g0736600|mRNA|AK105189|CDS+3'UTR	CATGTCTTGAGTAAGGAATAGTTGTACATACATTGTGTTTGTTTCTGTGGCAGAGTTCCT	Os01g0736600	AK105189	Zinc finger, RING-type domain containing protein.
3426	41	26	Os09g0544100|COMBINER|CI081093|6	AACCTCTTGTCCTTGCCAATGATGTAACGAAAGTCTTTTTCGTGAAGGATATGTCTAGCA	Os09g0544100	CI081093	(No Hit)
3427	41	27	Os01g0185300|mRNA|AK104360|CDS+3'UTR	TAGACAGTTTAATATTTGTACCATTTGATATGGGAATAAAAGAAAAGATATACTCTCCAT	Os01g0185300	AK104360	Transferase family protein.
3428	41	28	Os06g0538900|mRNA|AK063825|CDS+3'UTR	TGTCTGTCCATGGATGATGCTGAAATAAATATATGTTCTTGTGGATTCCTAATTGCAGTT	Os06g0538900	AK063825	Protein of unknown function DUF538 family protein.
3429	41	29	Os07g0100300|mRNA|AK066040|CDS+3'UTR	GATTGTAAACACCCTCTAGTGGATGTTTGAATGGGAGGAACTTTGTAATTGTTAAATTCT	Os07g0100300	AK066040	Conserved hypothetical protein.
3430	41	30	Os03g0254700|mRNA|AK112052|CDS+3'UTR	TCTGTCGTGCTGTGAAAAAAGATGTTTGCAAGTAGCTTAAGCTGTAGCAACAATTTGTCT	Os03g0254700	AK112052	Lissencephaly type-1-like homology motif domain containing protein.
3431	41	31	Os08g0513100|mRNA|AK107793|CDS+3'UTR	CGACGAATGATCCGATCCGATCCGTGGTCCGGCCATCCCCATCCATGATCCATCCGCCAC	Os08g0513100	AK107793	Conserved hypothetical protein.
3432	41	32	Os01g0151400|mRNA|AK120703|CDS+3'UTR	TTTCAACATGTATATAGGCAAATAGTAATGCCAAATTGTAAAATTGCAAAATTTATAATG	Os01g0151400	AK120703	Gamma-glutamyltranspeptidase family protein.
3433	41	33	Os01g0818900|mRNA|AK063195|CDS+3'UTR	AACATCTGATTGTGTTGAAACACTATTGCTCCATTGTGAACTGTGAAGTGATTGGCGTCC	Os01g0818900	AK063195	Conserved hypothetical protein.
3434	41	34	osa-miR166l|Os09|3'seq	TTCATGGAGGCACAGGATGCTTGGTGATCTCGGACCAGGCTTCAATCCCTTTAACCAGCA			miRNA
3435	41	35	Os12g0555000|mRNA|AK061606|CDS+3'UTR	AAGAAATAAATCATAATTGTGATCGTGTTCTATATGTGTGCAAATGAACATGTTTGCTGC	Os12g0555000	AK061606	Similar to Probenazole-inducible protein PBZ1.
3436	41	36	Os02g0557200|mRNA|AK070026|CDS+3'UTR	TCTGTACTCACTTACCTGCATGTACATAGGAATGGAAATGGAACTGGACTGAACTGAACC	Os02g0557200	AK070026	Similar to Auxin response factor 1.
3438	41	38	Os04g0677800|mRNA|AK102572|CDS+3'UTR	ATTCACGTCGAGGTGAAAAGGGCCCTGTCATGAAACAATAACAAACTTCATCGTAACTAA	Os04g0677800	AK102572	Zinc finger, RanBP2-type domain containing protein.
3439	41	39	Os07g0212200|mRNA|AK104057|CDS+3'UTR	TCGCTTTTCGTTTTTCATTTTTCCATCACATATCCAATATGAGAATGGAACTTTGCAGAG	Os07g0212200	AK104057	Similar to MRNA-binding protein (Fragment).
3440	41	40	Os07g0475000|mRNA|AK068238|CDS+3'UTR	TACAGGCTTACAGCACAGTACTGTATAAGAGAGTGTGGTTAATTCAGGAATTTTTCAAGA	Os07g0475000	AK068238	Conserved hypothetical protein.
3441	41	41	osa-miR395b|Os04|3'seq	CTTTACGACACACTGTATTGAGAGTTGTCGTGAAGTGTTTGGGGGAACTCTTAGTGTCGC			miRNA
3442	41	42	Os03g0148700|mRNA|AK065978|CDS+3'UTR	TGCTGTGAGCAAGACAGACACAGATACTATATAATGGTATATTGGTTGAGGATGCAATTT	Os03g0148700	AK065978	Similar to Calcium/calmodulin-regulated receptor-like kinase.
3443	41	43	Os10g0485600|COMBINER_EST|Os10g0485600|8	GCCAATGCCAGAATTCGAATTTGTGGAACAAAGGTTCAGGGAACATAAGAACCAACCATA	Os10g0485600		DEAD/DEAH box helicase, N-terminal domain containing protein.
3444	41	44	Os03g0584400|mRNA|AK101987|CDS+3'UTR	ATATGACAGGAAACTACTCCGCGTTGGAGGGGTAAGAAATGGGACTCTGCATTTTCTGAA	Os03g0584400	AK101987	AAA ATPase domain containing protein.
3445	41	45	Os01g0930300|mRNA|AK103050|CDS+3'UTR	TTGTAACTTTATCCCGCACGTTTTGGGTGCGGATGAGTAATATATCTCCCTTTTCCCCGC	Os01g0930300	AK103050	Polynucleotidyl transferase, Ribonuclease H fold domain containing protein.
3446	41	46	Os10g0102400|mRNA|AK066584|CDS+3'UTR	TTTTTTGTTTGGTATTCACTCTTTCTTCTGACTTGTAACAAAGGGAACGGGAAGTTGTGA	Os10g0102400	AK066584	Conserved hypothetical protein.
3447	41	47	Os04g0368000|COMBINER|CI447876|x	CGCGCGTGGTTTGTAGGTGTGTGTTAGATTGAGTTTTCTTCCTAGTGATGAACTGAATCT	Os04g0368000	CI447876	EGF domain containing protein.
3448	41	48	Os06g0639500|mRNA|AK068750|CDS+3'UTR	CATCTGCAACGTGATGAACGGCATGCGAATATGGATGAAAATTGCCATAAACGCTGGCAA	Os06g0639500	AK068750	Protein kinase-like domain containing protein.
3449	41	49	Os02g0780600|mRNA|AK121526|CDS+3'UTR	ATGTCCAATCCGGTATTAGATTATTATATTATGGGATGGAGGGAGTACATCATTACCCGT	Os02g0780600	AK121526	Methyltransferase type 12 domain containing protein.
3450	41	50	Os04g0420900|mRNA|AK064414|5'UTR+CDS	GTGAAGCAACTATCTGATGCTTCTTCAGACAGAAATGGGGGAGTTCTTTACATTCGCCTT	Os04g0420900	AK064414	Similar to Receptor-like protein kinase.
3451	41	51	Os06g0573600|mRNA|AK059741|CDS+3'UTR	GGGAACAGCACTTAGAATTATGAATGATAAATTATTGTCACCTGATTTATACCAAGAGGG	Os06g0573600	AK059741	Similar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase).
3452	41	52	Os01g0792400|mRNA|AK062797|CDS+3'UTR	GTGGGATATATGGCGTAATATTCTTCCATTTTCATCCGAAAGGACTTTTTTCTATTTCTC	Os01g0792400	AK062797	Similar to Photosystem I assembly protein ycf4.
3453	41	53	Os03g0637800|mRNA|AK101339|CDS+3'UTR	ACCCTAAACATCTTTTGCATGTCTAGTCTTGCTTTTTCCTGCAAATTTCAATGCTGTATG	Os03g0637800	AK101339	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
3454	41	54	Os04g0626100|mRNA|AK067048|CDS+3'UTR	GTTGCATTTACAAGTGTGTATGGCACCTTGTAGAAGCTTTGTAGAACTGTACTTAAAGTA	Os04g0626100	AK067048	HMG-I and HMG-Y, DNA-binding domain containing protein.
3455	41	55	Os03g0355700|COMBINER_EST|Os03g0355700|8	CTTCGGCTCCGAGGCCGCGCTGCACCAGCTGCAGATGGAGCAGTACACCCCTATCCGGTG	Os03g0355700		IQ calmodulin-binding region domain containing protein.
3456	41	56	Os01g0814000|mRNA|AK073886|CDS+3'UTR	AACTGTGTTTTTGGTGTATAGTTGGCGTTCACAAATGATATTTATGTAGCTGCCTTTGAA	Os01g0814000	AK073886	Conserved hypothetical protein.
3457	41	57	Os02g0144100|COMBINER|CI138407|6	CTTGCTCTTCGACATCACTGACTTCGACTTCGCTTCAGGCTCGACAGAGGACGTCATCGG	Os02g0144100	CI138407	(No Hit)
3458	41	58	Os10g0535800|COMBINER_EST|CI542003|0	GAATAAAATTGGGGGCATTGGATGGTTTTGTATTCCTCCAAAAGAAAATCGATGGACTTT	Os10g0535800	CI542003	Protein of unknown function Cys-rich family protein.
3459	41	59	Os10g0567400|mRNA|AK065124|CDS+3'UTR	AAAGTCGATCGCATGTCACGCTATGATGCATATATATGATCATACTATTGATTATTGAGC	Os10g0567400	AK065124	Rieske [2Fe-2S] region domain containing protein.
3460	41	60	Os10g0150400|mRNA|AK104236|CDS+3'UTR	GTTTGGTATCAGCAAGTAATTAATATAATCAGGGATGTGCATAATATATGTGCAACTTGT	Os10g0150400	AK104236	Protein of unknown function DUF1210 family protein.
3461	41	61	osa-miR395e|Os04|Mature	GTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAA			miRNA
3462	41	62	Os02g0572400|mRNA|AK069475|CDS+3'UTR	CGACTGAGATCCAAGGCAATACTAGTATGAATCTAACTCCCAATATTGAAAGAATTTTTG	Os02g0572400	AK069475	Similar to Riboflavin biosynthesis protein ribA, chloroplast precursor [Includes: GTP cyclohydrolase II (EC 3.5.4.25); 3,4-dihydroxy-2-butanone 4- phosphate synthase (DHBP synthase)].
3463	41	63	osa-miR164b|Os05|Mature	TGGAGAAGCAGGGCACGTGCATGGAGAAGCAGGGCACGTGCATGGAGAAGCAGGGCACGT			miRNA
3464	41	64	Os07g0531500|COMBINER_EST|CI426967|5	TTTATATTTTTCATCGTTTGGATTTTCGAGTGATATTGATTATTACTTTTTACCCCTTGT	Os07g0531500	CI426967	Harpin-induced 1 domain containing protein.
3465	41	65	Os02g0261100|mRNA|AK121248|CDS+3'UTR	TGATTGTTCGATGAGCACTTGGAATGGTACTTTTATGTTCCAGAGTAACTGTGACAAAAT	Os02g0261100	AK121248	Ubiquitin-conjugating enzyme OsUBC5b.
3466	41	66	Os03g0136800|mRNA|AK068822|CDS+3'UTR	CCAGTTTTCAGGCATTCACTACCATGTATGTTGTTCCAATAGACTATAACGTCAGATTTT	Os03g0136800	AK068822	Heat shock protein DnaJ, N-terminal domain containing protein.
3467	41	67	PAtControl0003|mRNA|AY056447|3'UTR		
3468	41	68	Os10g0456500|mRNA|AK066867|CDS+3'UTR	GCACTTGGCAAACTCATCCTTCTAGAGAAAATAAAGCAATTCACCAATCAGGTTCTCGGC	Os10g0456500	AK066867	Similar to Nodulin 6l.
3469	41	69	Os11g0587600|mRNA|AK121517|CDS+3'UTR	TTTGCAGACCAATAGATCATCCTAAGATTGTATAAACCTCTAGGAATTGTAAAAGTTGGC	Os11g0587600	AK121517	Similar to PDR11 ABC transporter.
3470	41	70	Os10g0398100|mRNA|AK108922|CDS+3'UTR	TTGTAATGTGGTTTTTTTCTTGATCATATTCTAAATAAACAAAATCGTGTGTTTTGTGAT	Os10g0398100	AK108922	Plant disease resistance response protein family protein.
3471	41	71	Os01g0847600|COMBINER_EST|CI533985|3	GATCATGTCATTTGTATGCTTCGCCTCTGGCATCATTTATCCCATGCTACTTGTTTGTCT	Os01g0847600	CI533985	Aldo/keto reductase family protein.
3472	41	72	Os04g0498600|mRNA|AK100589|CDS+3'UTR	CGGGAGAAATGTTGTCAAAACATATGAATAAGTATTTGCGGGAAATTTCCTTTGCCTTCT	Os04g0498600	AK100589	S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50) (AdoMetDC) (SamDC) [Contains: S-adenosylmethionine decarboxylase alpha chain; S- adenosylmethionine decarboxylase beta chain].
3473	41	73	ETG10_236652		
3474	41	74	Os03g0407400|COMBINER|CI270826|6	TGATCTCACTTGCAAAACTATTCATTTCCTGATTTTAACAAGGTCAAATGACTTGGTTGC	Os03g0407400	CI270826	Conserved hypothetical protein.
3475	41	75	Os11g0602700|COMBINER|CI522869|3	AAATGGCAAGCATAGTGGCGTCTTAGCCCTCCTCCTCTGGCTGTAATTATTCCCTAATTT	Os11g0602700	CI522869	(No Hit)
3476	41	76	(+)E1A_r60_3		
3477	41	77	Os06g0282000|COMBINER|CI544971|0	GTCTACTTTGAGTCTCCAATTGGATTCGTATCATTTAACCATAATACAATATATTTTTAT	Os06g0282000	CI544971	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
3478	41	78	Os01g0188400|mRNA|AK060358|CDS+3'UTR	GATCGATTATAAAGAGTGCAATAAGAACATAGTTTTAGCTCCCATTGTAATGGGCAGCAT	Os01g0188400	AK060358	NADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME).
3479	41	79	osa-miR171e|Os03|3'seq	ATGCGTGCTTGCTAGCTCACTTGTGTTTCTGATTGAGCCGTGCCAATATCTTAGTGCTCT			miRNA
3480	41	80	Os11g0535600|mRNA|AK100890|CDS+3'UTR	GGAAAGAGTTGGATTCGATCTGTAAATTAACTGTGAATGCTTTAATCGCCAGGACGGGAA	Os11g0535600	AK100890	C2 calcium/lipid-binding region, CaLB domain containing protein.
3481	41	81	Os04g0478100|mRNA|AK061087|UTR	AATCCAGCCAACCAAAGACTTAATCCAAAGATGGTGGCGAAGAACATGCTGTCTTGGTAA	Os04g0478100	AK061087	"Non-protein coding transcript, uncharacterized transcript."
3482	41	82	Os12g0120500|mRNA|AK103389|CDS+3'UTR	AATCGACGAATTAACTCAAGAAGCTAGTATGAGACTGTAGTCACTAATTGTACTGTCGAT	Os12g0120500	AK103389	Protein of unknown function DUF567 family protein.
3483	41	83	Os08g0261000|mRNA|AK100590|CDS+3'UTR	AGAAGACCCAATCCCATATCTCTCCAAGCTATCAAATTTAACAAGTTTAAATCTTCGGAG	Os08g0261000	AK100590	Disease resistance protein family protein.
3484	41	84	Os01g0760600|mRNA|AK103133|CDS+3'UTR	TTGTACCAGTGGATTCAGAAAAAGTGGTGATTTCGAATCACCTAATAAGCTCCATCGGTG	Os01g0760600	AK103133	Aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) (Transaminase A).
3485	41	85	Os11g0707000|mRNA|AK064986|CDS+3'UTR	TTTTCTCTTTGTTCTGTGTATCAGATCGCGCCCAAGCCATAGCTGGGCATGACAAGTTTT	Os11g0707000	AK064986	Similar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments).
3486	42	1	Os09g0385300|mRNA|AK073247|CDS+3'UTR	CCATTGTGAAGTGCATTGAGACTGAATCTTGGAGATAAAATATTGAACTCTAATAGTGAG	Os09g0385300	AK073247	Hypothetical protein.
3487	42	2	Os03g0599800|mRNA|AF294725|CDS+3'UTR	GCTGAACCCCTCGACTGCTGCTGTCGAGAACGGCAAGGCCAAGTAGATTGATCCTGGGAG	Os03g0599800	AF294725	Reversibly glycosylated polypeptide.
3488	42	3	Os07g0184800|mRNA|AK102642|CDS+3'UTR	AGGCGGTATCATCATCTTCTCGCCTGTAATGATAGGATCCCATCATCCTCAAAAACCATA	Os07g0184800	AK102642	Similar to Variant of histone H1.
3489	42	4	Os07g0178100|mRNA|AK065742|CDS+3'UTR	GTAAATGACGCGTCCCTTATATTTAGGGGAGTTTCTGCTTTCCCTTCAGAGTAAAGTACA	Os07g0178100	AK065742	Similar to ETO1-like protein 1 (Ethylene overproducer 1-like protein 1).
3490	42	5	Os10g0464400|mRNA|AK062574|CDS+3'UTR	GCTCTTGACTACAATGAGAATACCAGTAAGGGTCTATGTTCGTCAGAAAGTTGAGTTAGA	Os10g0464400	AK062574	Haloacid dehalogenase/epoxide hydrolase family protein.
3491	42	6	Os03g0321900|mRNA|AK073317|CDS+3'UTR	AGAGAGAGAAAGACTGTAGAAATGGTTTGTGATATACGTGCATGTATGGTCCAATGCCAC	Os03g0321900	AK073317	CMP/dCMP deaminase, zinc-binding domain containing protein.
3492	42	7	Os06g0644500|mRNA|AK101292|CDS+3'UTR	GATACTCTTGTTGTGATCTATAGCTGTACTGACAGTCCAGAAAGTTGTAATAACAAAACA	Os06g0644500	AK101292	Zinc finger, DHHC-type domain containing protein.
3493	42	8	Os05g0522500|mRNA|AF372831|CDS+3'UTR	GCTCTGTATTTTCTCTTCGTAATAAAGAAGGGGACATAATCTAATTGCTCTTGTTTGATC	Os05g0522500	AF372831	Similar to Hexokinase 1 (EC 2.7.1.1).
3494	42	9	Os11g0210000|mRNA|AK071323|CDS+3'UTR	TCCTGCTAGCTGTAACCGGTTTTGTATCTGTAACAGCAGTAAACTAAACTCGCAATATGA	Os11g0210000	AK071323	Conserved hypothetical protein.
3495	42	10	Os08g0343600|COMBINER_EST|Os08g0343600|8	GGCTCGTCGGGGCCAAGACGCTCATCGATCGTTCCAACGTCTTCAGCAATGCGCAGAGCA	Os08g0343600		Similar to Nectarin 5 (Fragment).
3496	42	11	Os05g0511000|mRNA|AK061738|CDS+3'UTR	TTAGTTTTAACTTAAACAACTATTTGCCCCAATTTCAGTCACATTGTCAACACATTGCTG	Os05g0511000	AK061738	Protein of unknown function DUF887, TLC-like family protein.
3497	42	12	Os03g0666700|mRNA|AK061309|CDS+3'UTR	TCTGAAGAAATTTCTGTGGATCAGTTGCCCAACAGTACAACCTCAAATGCTATAGTATTT	Os03g0666700	AK061309	Protein of unknown function DUF887, TLC-like family protein.
3498	42	13	Os07g0563600|mRNA|AF140493|5'UTR+CDS	TACATCTAATGGCAAATATCATGTAACAGAATTTGTTACCTTCCATAATCACCAGCTTGG	Os07g0563600	AF140493	FAR1 domain containing protein.
3499	42	14	Os02g0822600|mRNA|AK058369|CDS+3'UTR	TCTAGAGCAACTGATACTTGTCTTGTAATCTTGTTTAAAGGTGCACGTTCTTTATAGTCA	Os02g0822600	AK058369	Similar to Chloroplast 50S ribosomal protein L9 (Fragment).
3500	42	15	Os05g0519800|mRNA|AK069435|CDS+3'UTR	TTTGTGTAACTACTTTGCACACTCGCATCTCAAACAAAGAGTTCTAAAAATTTTCCCTTC	Os05g0519800	AK069435	Protein of unknown function DUF28 family protein.
3501	42	16	Os03g0780700|mRNA|AK061888|CDS+3'UTR	GCCTCAGCTTCTTCCTCTTCGTCTTCGTACTCTTCATCGGCTGTGGCGTCCTGGTACTGC	Os03g0780700	AK061888	Hypothetical protein.
3502	42	17	Os01g0678500|mRNA|AB100696|CDS+3'UTR	AGTTGTCAAGGAGAACAGCAGATGTGTTCTCTTTCTGCTCCAAAGGAGACCTTAAAGGAG	Os01g0678500	AB100696	Similar to Two-pore calcium channel.
3503	42	18	Os09g0433500|COMBINER_EST|Os09g0433500|8	GCGAGGACGCTCCAGTACTTCAACTTCACCGCCGCGCTCAAGCCGTTCTACCCGGTGATT	Os09g0433500		"Glycosyl transferase, family 31 protein."
3504	42	19	Os08g0116700|mRNA|AK065511|CDS+3'UTR	TATGAGAACTTTATCAGTGATCGTATAAATTCAACAACTTGCAAGGTAGGTACGGTTTTG	Os08g0116700	AK065511	Conserved hypothetical protein.
3505	42	20	Os07g0498800|mRNA|AK072589|5'UTR+CDS	CAGAGATGGAAGGGATCCATGCAGATAATGTCAGAAAACCTTCTGAGGAATCAACAACAG	Os07g0498800	AK072589	Calreticulin interacted protein.
3506	42	21	Os11g0240900|mRNA|AK099694|CDS+3'UTR	TATAGCTCTGTCATGTACTAGTTGTCATCATTGAACTTTACCCCTCATCTCAAAAAGAAA	Os11g0240900	AK099694	Conserved hypothetical protein.
3507	42	22	Os01g0894600|mRNA|AK059715|UTR	TATTTATCCAGAATGAAAATGACTTAACTTATCAGGATGGTTTTCTCTGCAGGTTTAGGG	Os01g0894600	AK059715	RINGv domain containing protein.
3508	42	23	Os07g0541500|mRNA|AK111550|CDS+3'UTR	ATCAACGGAAGTCATGTTTGTACTGTTGCACACTGATACTGTAGCAAATAAGACACATGC	Os07g0541500	AK111550	Similar to KI domain interacting kinase 1.
3509	42	24	Os04g0433300|COMBINER_EST|Os04g0433300|8	TGAGCCTGTACCGGTCGTGCACGAGGTCCGTCGACTGCCTCGCCGACGCCGGCCAGCCGC	Os04g0433300		Conserved hypothetical protein.
3510	42	25	Os02g0666200|mRNA|AF022737|CDS+3'UTR	CAATCGTGTAATCCAGTACTCAGTCACTGTATGTTTTTATGTGATGGAGATCTTAATTCT	Os02g0666200	AF022737	Aquaporin.
3511	42	26	Os10g0351400|COMBINER_EST|Os10g0351400|8	AAGGCAACTTGCTCTCGGTTGGAAAATGTTCCAAAAGTTTTTGCATGCCTAGTAATGTAG	Os10g0351400		"Integrase, catalytic region domain containing protein."
3512	42	27	Os08g0234200|mRNA|AK121666|CDS+3'UTR	ATTTTTGCAGGTATTTGCCCTGTCAAGCTGATGATGTCTCAGTTGTCAATGTGAACAATC	Os08g0234200	AK121666	Conserved hypothetical protein.
3513	42	28	Os03g0251300|COMBINER_EST|CB619048|7	TACCGACACATTGAGCATTTGATTTGAGCAGCTATAGTAGCTAGCTAGCACCTCAGCGAT	Os03g0251300	CB619048	Conserved hypothetical protein.
3514	42	29	Os08g0444100|mRNA|AK073746|CDS+3'UTR	AAATATCACTACTATTTGCTATATCGGCTACGTGCCACTGAAATTTGGGGAAATTGGAAC	Os08g0444100	AK073746	Similar to Splicing factor 3b, subunit 5 (Splicing factor 3B subunit 10).
3515	42	30	Os06g0284800|mRNA|AK066358|CDS+3'UTR	GAGACCGTACTGACGGTAATCGATCAAGCACCAGATACTGGACACTTATTTAATTGGAGA	Os06g0284800	AK066358	Spectrin repeat containing protein.
3516	42	31	osa-miR395m|Os04|5'seq	GAGTTCTCCTCAAATCACTTCAGTAGATAGCTAGCTAGGCTTCATTGCATTACACTGTTA			miRNA
3517	42	32	Os04g0623100|mRNA|AK067276|CDS+3'UTR	CTCTTAATACTCTTACGTAATTTGATGTGTCATTATGGGTGATTGTAACTGTGGCAATTG	Os04g0623100	AK067276	Bromodomain containing protein.
3518	42	33	Os01g0673600|mRNA|AK122067|CDS+3'UTR	CAGTATCTGTGGTAGAACTTGGTGCTCCTCCAATATATTTATTACTTTATGTTGGAAAAC	Os01g0673600	AK122067	Similar to Ubiquitin-conjugating enzyme E2.
3519	42	34	Os05g0495100|mRNA|AK108028|CDS+3'UTR	TGCATCTTGTCTTTTATCGGAAAAATGTTCGAGCTAATCATGAATTAACACGATGAGAAT	Os05g0495100	AK108028	Conserved hypothetical protein.
3520	42	35	Os08g0498100|mRNA|AK104326|CDS+3'UTR	ATTGCCGCTTAAATTTTCCTATACGTGTTTCAATCAATGAGATTATTATATTCTTCGAGC	Os08g0498100	AK104326	Similar to Caffeoyl-CoA O-methyltransferase 2 (EC 2.1.1.104) (Trans-caffeoyl-CoA 3-O-methyltransferase 2) (CCoAMT-2) (CCoAOMT-2).
3521	42	36	Os05g0135400|mRNA|AK063587|CDS+3'UTR	TTGTTTTGTGTGGCAAATTGTGATTAAGAAAAGATTCTATTGTTAACTCAAACAAGAGAA	Os05g0135400	AK063587	Haem peroxidase family protein.
3522	42	37	Os02g0106000|COMBINER_EST|Os02g0106000|8	ATGATCTCCTTGGCAGGGAGAACGCCGTGCGCCACCATCTCCTTCAGCGTGGAGGCGGAG	Os02g0106000		Hypothetical protein.
3523	42	38	Os09g0329000|COMBINER_EST|Os09g0329000|8	AAACCCGGGAAAAAGGTTGATCCTACCAAATTCATATGTTTCATCATGCAAGATGGGGAA	Os09g0329000		BURP domain containing protein.
3524	42	39	Os12g0288500|COMBINER|CI228796|6	TTGTGGTCCTTCTCTTGCTTTTAGGTTGTTTTTCCCCTTTTAGGGCAGCATCCTTTCAGT	Os12g0288500	CI228796	(No Hit)
3525	42	40	Os05g0564500|COMBINER|CI140055|6	CTGATCACAACAGCAACATGCATGACGGTTTTAATTTTGATGCAATAACCAGTGGAGTAA	Os05g0564500	CI140055	Homeodomain-like containing protein.
3526	42	41	Os01g0777800|COMBINER_EST|CI444168|0	ACATCAGATCCATTCTTGTGTTGTCATTGGAGTAAAAATTAAGTGTGCAACATGATTTGG	Os01g0777800	CI444168	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
3527	42	42	Os03g0669200|COMBINER_EST|CI074795|3	GATCGGTCTCTTCTTGTTGTATAACTTCTTTTTGTAGTAGAAAGCTACCAACTTTTGCAT	Os03g0669200	CI074795	Similar to G-protein beta subunit 1.
3528	42	43	Os08g0440300|mRNA|AK103781|CDS+3'UTR	TGGTTAGTTAAATAAAACAATCTGAAATGGGAAAAAAAATTGAAACTTTCGTTGGTGAAT	Os08g0440300	AK103781	Ribonuclease CAF1 family protein.
3529	42	44	Os04g0203100|COMBINER_EST|Os04g0203100|8	AGCCCGTCTATTATATGGTGGACCTGAATTTACAGCATTTAGGGAAAAGCCTCCACCTCT	Os04g0203100		Protein of unknown function DUF239, plant domain containing protein.
3530	42	45	POsControl0040|art		
3531	42	46	Os03g0308700|COMBINER_EST|AU172825|6	TGTACTGTTGATCCTAATTGTTGTTTGTAATCACCTGTTGCAGCTATGGGATCATTATGG	Os03g0308700	AU172825	Conserved hypothetical protein.
3532	42	47	Os07g0563800|mRNA|AK067125|CDS+3'UTR	GAAGAGAGTCGATATTGTTCATGATGCCGATCTCTTTGAATAGAGGACGCCTTGTGGCTT	Os07g0563800	AK067125	Arf GTPase activating protein family protein.
3533	42	48	Os07g0452100|COMBINER_EST|CI535697|0	TCTGCATGCAGTTGGTGATCTAAATTTAGAGTGTATTGCGACTCGTACGTGTTCGTCGTT	Os07g0452100	CI535697	Glycoside hydrolase, clan GH-D family protein.
3534	42	49	Os03g0798300|mRNA|AK108034|CDS+3'UTR	TTTTGTGAGCAATTGGACTCCTAAAATTAATTCTGGGATGGTTACATGGATTACCTTTTG	Os03g0798300	AK108034	Similar to Cytosine-5 DNA methyltransferase MET1 (Fragment).
3535	42	50	Os01g0507400|COMBINER_EST|Os01g0507400|8	AAGCTGTCGAAGAGCCACGTCAAATGAGCACTCCACAGTCAACAGTCCAACAAAAACAAA	Os01g0507400		Conserved hypothetical protein.
3536	42	51	Os08g0331800|COMBINER|CI563307|x	ATCCGGTCAGCTAGCTTTTGTGGTTGAGTATTCAGTGTCTGGTGTCCAATGCCAAGTTAT	Os08g0331800	CI563307	Conserved hypothetical protein.
3537	42	52	Os06g0301400|COMBINER_EST|Os06g0301400|8	AGTGGACTAAAGGAGATTAACAAAAGGCATAAGCCAGATCTAGTTAACAAGAAATTTGCT	Os06g0301400		Conserved hypothetical protein.
3538	42	53	Os03g0107100|COMBINER|CI415840|6	GCCTATAAATAGAGAGATGGATGCAAGGGTGGAGGTTGCTTCTTTGGCAATCCTTTTGAG	Os03g0107100	CI415840	ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter family protein.
3539	42	54	Os11g0156800|mRNA|AK107423|CDS+3'UTR	TGTAGAAGGAAAGCAAGCATGCATGTATATTATCTTTGAGCTAATGGTAGTAGTTTTTAA	Os11g0156800	AK107423	Conserved hypothetical protein.
3540	42	55	Os05g0168500|mRNA|AK100711|CDS+3'UTR	TTTGTGAGCAGCCTTTGTTGGAACACTTTGACAGATATTCAATATTAAAGAGCTATTCGA	Os05g0168500	AK100711	Nonaspanin (TM9SF) family protein.
3541	42	56	Os05g0564200|mRNA|Y18348|CDS+3'UTR	TCGTTTGACGTGTAAACCGCCGTTTGTTTTTAAATATGCAATATTGGATCTTTTGTCAGT	Os05g0564200	Y18348	U2 snRNP auxiliary factor, small subunit.
3542	42	57	Os04g0526600|mRNA|AY166458|CDS+3'UTR	AAGTGAGCAGGACTGCCTCTGGCTGTCTGGCCCAGCCGGACTTGTTAAGTCCAAATGGAA	Os04g0526600	AY166458	Similar to Alpha-amylase/subtilisin inhibitor (RASI).
3543	42	58	Os01g0142800|mRNA|AK105664|CDS+3'UTR	TTAGTGTCGTTTGTGACCTTCAAATATGTTATAGTGTTCATTGCATTATGTCTGGTAGGA	Os01g0142800	AK105664	Similar to Peptide transporter.
3544	42	59	Os01g0955000|mRNA|AK119633|CDS+3'UTR	GTTGAGATCTCTCATGGATCGATCTATATACATGGCCGGGCTGTACTGTACAAATTGATG	Os01g0955000	AK119633	Phosphoesterase family protein.
3545	42	60	Os05g0446000|mRNA|AK070640|5'UTR+CDS	TGGAAAATCATTAACAGGAAATGATGTCACAGCCAATGAAACTGAGTACCATGGAATCAA	Os05g0446000	AK070640	Similar to Transcriptional activator DEMETER (DNA glycosylase-related protein DME).
3546	42	61	Os02g0265200|mRNA|AK119593|CDS+3'UTR	AATGGTAGCAGTAGGAGAGCATCAAATCCTTCCAGTTCTTGGCTGATCAAAACAACCCTT	Os02g0265200	AK119593	WRKY transcription factor 39.
3547	42	62	Os02g0244600|mRNA|AK069852|CDS+3'UTR	TTTCTGTCTCATTCACACTGTTCATGTGAATATGTGATAGTTGAAATTCCATATCTGACG	Os02g0244600	AK069852	Ataxin-2, C-terminal domain containing protein.
3548	42	63	Os03g0567600|mRNA|AK098896|CDS+3'UTR	ATTCTCTCTCTATCTCTCATGGCTTTCATGAGGAGATGCAAATTGTCTGAATTATAGAAA	Os03g0567600	AK098896	Protein of unknown function DUF563 family protein.
3549	42	64	Os12g0562800|mRNA|AK100001|CDS+3'UTR	ACGAAGGACGCCGCCGGGATGCCCCGCCGCTCCGTCACCCCCTGCGGCGTCGCCGCCGCC	Os12g0562800	AK100001	Hypothetical protein.
3550	42	65	Os10g0578900|mRNA|AK060631|CDS+3'UTR	ATGGAATGTGATGCTTGTACGAGTTGTTACAGCTTAATTACATGGGAGAGGCTTTGTTTC	Os10g0578900	AK060631	Similar to CTP:phosphorylcholine cytidylyltransferase (EC 2.7.7.15).
3551	42	66	Os01g0661800|mRNA|AK103579|CDS+3'UTR	TCATAGGCTTTCTTCTTCTACATTATCTGCTTTCTGCAAGTAAATCTAGTCCTACTCAAA	Os01g0661800	AK103579	Conserved hypothetical protein.
3552	42	67	Os03g0820400|mRNA|AY286473|CDS+3'UTR	GCACGCGCCGCCCGTTCTGCTCGAGCTCTTCGTTTAGATTCGTGCGATTGCTGCCTGTAC	Os03g0820400	AY286473	Similar to ZPT2-13.
3553	42	68	Os10g0104800|mRNA|AK071821|CDS+3'UTR	CAAGCGCTAATCATCACTAATTCTTTTATTTATCGATTTAAATTATAATTAGCTGGTTTC	Os10g0104800	AK071821	Protein kinase-like domain containing protein.
3554	42	69	Os10g0554200|mRNA|AK105765|CDS+3'UTR	CTGCATATGCGAGGTGCGGGCGCACCTCTCAATCTGATCAATAAATTAAACACAAAAAAG	Os10g0554200	AK105765	TGF-beta receptor, type I/II extracellular region family protein.
3555	42	70	Os09g0270800|COMBINER_EST|CB620688|7	TCACAGCAGGCTGTTCAGCGACCTCTTGGACCACTTCTTGGCTGCCAATTTCCTCAGTGG	Os09g0270800	CB620688	Putative gypsy type transposon domain containing protein.
3556	42	71	Os02g0801900|mRNA|AK109498|CDS+3'UTR	AGGATACTCTATGGTCAGGTAGTATTTTATCTTTAATGAGAAGGTTCGAGCAATTTGTGG	Os02g0801900	AK109498	Conserved hypothetical protein.
3557	42	72	ETG09_205211		
3558	42	73	Os07g0146800|mRNA|AK106695|UTR	GTATCTTCTAAAGGTCCTGAAGATGAACCTGTTATGTATGGCCTAGTATGTGCTGATGAA	Os07g0146800	AK106695	Non-protein coding transcript, putative npRNA.
3559	42	74	Os01g0713200|mRNA|AF030167|CDS+3'UTR	TAGTGCCGTGTGGTGTCCATGCATCTTTCCCAATTTGTGAAATATATACTCCCAGTGAAT	Os01g0713200	AF030167	Similar to Beta-glucanase.
3560	42	75	Os10g0131800|COMBINER_EST|Os10g0131800|8	CAAACTCGAAAGCCAAATAAAGAAGCTCCTGGATAAAAAGAGGTGTGTACATCCATCCAT	Os10g0131800		Conserved hypothetical protein.
3561	42	76	Os05g0542800|mRNA|AK105858|CDS+3'UTR	AGCTGTATACGACGTTTGTGTCAAGAATTTTTTAGAGGGCATTATGTGAAGTTAAAATGG	Os05g0542800	AK105858	Virulence factor, pectin lyase fold family protein.
3562	42	77	Os03g0752800|mRNA|AY551916|CDS+3'UTR	CACCGTCTTCCTCCCACCAGTAATTTACCCATGTAATATATGCGAGTAGCATGAACAAAT	Os03g0752800	AY551916	MADS14 protein.
3563	42	78	Os02g0785000|mRNA|AK103670|CDS+3'UTR	TTCCTTTTTCCTCCTTTAATCCCCATCAGTTTGTAATGAACACTTGATTCAAATACACAG	Os02g0785000	AK103670	Glycosyl transferase, family 31 protein.
3564	42	79	Os10g0396400|mRNA|AK070796|CDS+3'UTR	ATCAGATCTGTATTCCGGTTTACATATGCGTTAATAATCATCTTGGTTGGATCTGAACTA	Os10g0396400	AK070796	Leucine-rich repeat, cysteine-containing containing protein.
3565	42	80	Os10g0416800|mRNA|AK119555|CDS+3'UTR	TGGGCACGCATGGTGTTCTAATACTTATTGCGTATATATGCAGTGAGATGGATATTATAT	Os10g0416800	AK119555	Similar to Chitinase 2 (EC 3.2.1.14) (Tulip bulb chitinase-2) (TBC-2).
3566	42	81	Os02g0308900|COMBINER_EST|BI306720|7	TCACCTCCGTGTCCTTGAGCAGCCGGACGAAGGTGTTGTAGTGCCCGGCCTTCGTCATGA	Os02g0308900	BI306720	Conserved hypothetical protein.
3567	42	82	Os02g0714500|mRNA|AK103759|CDS+3'UTR	CCGAAATTCAATTTGGAAAAGGGCTATTCGTCAACTGATCCGTGCGTTAGCTAGACTTGT	Os02g0714500	AK103759	Tetratricopeptide-like helical domain containing protein.
3568	42	83	Os11g0208700|COMBINER_EST|CI420442|6	CCCCCATGCCAAGACTACTTGCAGCCATAACCGAAAGGTCTCATATATAGTTTCAGTGTT	Os11g0208700	CI420442	Curculin-like (mannose-binding) lectin domain containing protein.
3569	42	84	Os05g0104700|mRNA|AK108676|CDS+3'UTR	GCAACCAGCTAATGCTAATAATTAAGGTCCATTCTTGATGAACATGAGTGAAATTTAGTG	Os05g0104700	AK108676	Leucine rich repeat, N-terminal domain containing protein.
3570	42	85	Os11g0655800|mRNA|AK099612|CDS+3'UTR	AAGCTCCATATGAACATTGTAGACACGCCTTTATTGATGTACATAGCAATATCAATGGAA	Os11g0655800	AK099612	Lipase, class 3 family protein.
3571	43	1	Os03g0264600|COMBINER_EST|CI379334|2	CTTGGTTCCCATGTTGTTATGTACCTGCTACTACTGTTGTTGTTGGTCCTGCGTCAACTA	Os03g0264600	CI379334	Zinc finger, C2H2-type domain containing protein.
3572	43	2	Os01g0509800|COMBINER_EST|Os01g0509800|8	GGAAGAAAAGGTTCAGATTGATCACATTGGCACAGATGGTCAGCTAGCTGATTTACCCAC	Os01g0509800		"Lipolytic enzyme, G-D-S-L family protein."
3573	43	3	osa-miR399h|Os05|3'seq	TCGAGCTGATCAAACCACGCAAAAGCCACTGCCAAAGGAGACTTGCCCAGCAATGCAGAT			miRNA
3574	43	4	Os12g0263800|mRNA|AK066839|CDS+3'UTR	CCTTACCAACTTTGTGAGTAGTTTGTAACTCATCTCGTCTTTTCTGATATTGCAAATTCA	Os12g0263800	AK066839	Similar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
3575	43	5	Os06g0686800|mRNA|AK111045|CDS+3'UTR	CAATTGGCAATGGCAGTGAGAGCTCGCTCCTGATGTTGACAGATCTCAAGCTCTCTGATC	Os06g0686800	AK111045	Conserved hypothetical protein.
3576	43	6	Os02g0647300|mRNA|AK109613|CDS+3'UTR	AGAAAAGCAACGCCACGTGTCCCAAGTGCTTTCCGTGAAATATTGTGTTCTTTCTTTAAT	Os02g0647300	AK109613	Leucine-rich repeat, plant specific containing protein.
3577	43	7	Os01g0589500|mRNA|AB110176|CDS+3'UTR	GTTCCATCAGGAATACTTTATATCCAACTGTGTTCGTGACTTCGTGTTAAAGATTTTGAA	Os01g0589500	AB110176	Conserved hypothetical protein.
3578	43	8	Os02g0639800|mRNA|AK105980|CDS+3'UTR	GCAGAGATGCAGCATGCCATTTTGCGCACATCAGTGTTAAACAAGTGAGACCATTCATCT	Os02g0639800	AK105980	Zinc finger, RING-type domain containing protein.
3579	43	9	Os07g0614700|COMBINER_EST|CI561699|0	CATACAGACGAATTCATACGTGTTTTGGCTTTCAAATATTCAAATGTAATACGAATTTTC	Os07g0614700	CI561699	SPX, N-terminal domain containing protein.
3580	43	10	Os05g0595100|mRNA|AB087745|CDS+3'UTR	ATCCCATCTGATGGACCGCATTGTATAGGGGGCTTGTAGGGGTCCAGCAGCTTCATCATC	Os05g0595100	AB087745	Similar to UDPglucose 4-epimerase-like protein.
3581	43	11	Os09g0541900|mRNA|AK100985|CDS+3'UTR	CTCAAACCGCTTAGAAGGCAATGTATTCTTTCCTGAAATACTGTACCGTTCAATCCTTGG	Os09g0541900	AK100985	Similar to 26S proteasome subunit RPN3a.
3582	43	12	Os03g0171600|mRNA|AK072716|CDS+3'UTR	GATTCATATGTGGCTGCAACAAAGATATTCATCAATTATGAACACCATGCCTTATGTTTG	Os03g0171600	AK072716	Cyclin-like F-box domain containing protein.
3583	43	13	Os12g0506800|mRNA|AK099684|CDS+3'UTR	AAGAGAACCCTGGTTCCAAATTGTTATTATGAGAACTAGAAAATAATCCTATCAAAGGCC	Os12g0506800	AK099684	Autophagocytosis associated protein, C-terminal domain containing protein.
3584	43	14	Os01g0607300|mRNA|AK109289|CDS+3'UTR	TGCGTCCAATTGTTTGTACTCTGTAAAGAAAGATAGTATCCCTCTACATTATCTAATTCC	Os01g0607300	AK109289	Conserved hypothetical protein.
3585	43	15	Os01g0535900|mRNA|AK099631|CDS+3'UTR	TTTGTATGGCCTGTAAATTGTAACCTTATGAATGTGTGGCAGCAGTGGACATTTTGCTAG	Os01g0535900	AK099631	Putative methyltransferase family protein.
3586	43	16	Os05g0492200|mRNA|AF456243|5'UTR+CDS	TTTGCACCCACATTTAGAAATTATAGGCAAGGAAATTGTGAAGAAGTTGAAAGGCCTCCC	Os05g0492200	AF456243	Disease resistance protein family protein.
3587	43	17	Os06g0507100|COMBINER_EST|CI231887|6	GGTAGTGTGTACTAGCATATATACTTTGATAAATAAAGTGTCGCACATTATCGTGTGTGT	Os06g0507100	CI231887	Gliadin/LMW glutenin family protein.
3588	43	18	Os01g0106800|mRNA|AK073331|CDS+3'UTR	TATTAATGTTCTGTGGGTCACATATCAACTTGCTATTATTGTATTCAGCGGTTCTCTCTC	Os01g0106800	AK073331	Similar to RING-box protein 1A (Regulator of cullins 1a) (dRbx1).
3589	43	19	Os11g0419600|COMBINER|CI396069|6	CTTCATGGTTAATTATACTCTCTGGAACTTTCTCGGATTTTTCGGAGCTCAATTCCTAAT	Os11g0419600	CI396069	(No Hit)
3590	43	20	Os05g0162500|mRNA|AK067124|CDS+3'UTR	TTGTTACCCCTATACTGTACATACATATGTTTCTTATTTATCTTAAAGCCTGAAAATGGA	Os05g0162500	AK067124	Protein kinase-like domain containing protein.
3591	43	21	Os01g0793200|mRNA|AK071275|CDS+3'UTR	ATCTGGTATGCTGTTACAAATTAGTGTGGTTCAGGAGATCGATATAATAACCATACATTC	Os01g0793200	AK071275	Protein prenyltransferase domain containing protein.
3592	43	22	(+)E1A_r60_n11		
3593	43	23	Os03g0264800|COMBINER_EST|Os03g0264800|8	AACTCTAAGAGACTCGCGTCCACTGATCTTCAAATACAATGAGGGCTTCACAAATGCTGT	Os03g0264800		AAA ATPase domain containing protein.
3594	43	24	Os02g0595400|mRNA|AK099175|CDS+3'UTR	TGATACCCATGTTACAGTGCAGCTTACTAGTTTTTACATTGCGCAACGAGATTTTGTACT	Os02g0595400	AK099175	Conserved hypothetical protein.
3595	43	25	Os02g0566400|mRNA|AK101019|CDS+3'UTR	CAGATTCTGATGGAGCATTAGTTGTATGAAAAATAATGGGATGGGATAGTTGTCCAGCTT	Os02g0566400	AK101019	Conserved hypothetical protein.
3596	43	26	Os06g0622800|mRNA|AK106454|CDS+3'UTR	GTGAAACTAAAGTAGAGCTAGACTAGCCTTGTACCTAAAATGAGCAATGTTTTGTATCGT	Os06g0622800	AK106454	Armadillo-like helical domain containing protein.
3597	43	27	Os01g0768400|COMBINER_EST|CI118580|6	TCAAAGGACATGACTCTGAATTTGTTTGTTTTCAATTGGGATGATGTAATTAGAGTGCTC	Os01g0768400	CI118580	Conserved hypothetical protein.
3598	43	28	Os05g0112800|mRNA|AK108350|CDS+3'UTR	TATGTTTACGGTTGTAATCCAATTTATCTCATAATTAACTAAATAAATAATTCGCCAGAT	Os05g0112800	AK108350	Protein of unknown function DUF26 domain containing protein.
3599	43	29	Os04g0301600|COMBINER|CI071175|6	GGAAAATCTGCGGCAGCGGGCTTGTCATGGGTTAAGTGATAACAGATGTCTGGAAATATA	Os04g0301600	CI071175	(No Hit)
3600	43	30	POsControl0031|random		
3601	43	31	Os09g0567300|mRNA|AK066166|CDS+3'UTR	CTGTACATACACAAGACAGATTATAATTTGATATGCCCATTAATACGGATTCGATTTGCG	Os09g0567300	AK066166	Similar to Monodehydroascorbate reductase (EC 1.6.5.4) (MDAR) (Ascorbate free radical reductase) (AFR reductase).
3602	43	32	Os06g0722100|COMBINER_EST|CI368733|0	GAATGGGGGTTAAGGAGTTGTGCTTTTGCTGGGCATATATAGTTTTGTGACAAGAATCTT	Os06g0722100	CI368733	Conserved hypothetical protein.
3603	43	33	Os01g0894600|mRNA|AK073332|CDS+3'UTR	GTCTTTCCAGCTGTTAATTCTTTCTGAAGAGAAGTGGTCGATATCGAAATATTGAGCATG	Os01g0894600	AK073332	RINGv domain containing protein.
3604	43	34	Os06g0176600|mRNA|AK062794|CDS+3'UTR	TCTCTTGTAACTTTTATTCCTTCTTAATATACTCGGTTGGCCTCCTTCGGCCTTCCCGGC	Os06g0176600	AK062794	Similar to flagelliform silk protein-like protein [Oryza sativa (japonica cultivar-group)].
3605	43	35	Os01g0104400|mRNA|AK104820|CDS+3'UTR	ATGAACATGTCACGTCTGTGTGTGTGTGATACTGTTACTTGTGATGCATCTACGTACATT	Os01g0104400	AK104820	Ricin B-related lectin domain containing protein.
3606	43	36	Os08g0118000|mRNA|AK068379|CDS+3'UTR	CTCTAGGCTTCTTTTTCATTTTGTTGGATTACTCCACTTAATTTGCTCCTGGTGTACCCC	Os08g0118000	AK068379	HMG-I and HMG-Y, DNA-binding domain containing protein.
3607	43	37	Os03g0816200|mRNA|AK109021|CDS+3'UTR	GGGGGGTCAATCGATCCATGTTGGACTGTTTCGGTTCTTTTCTGCTGTAATTAGTTGTAT	Os03g0816200	AK109021	Ribosomal protein S26E family protein.
3608	43	38	Os05g0468000|mRNA|AK071412|CDS+3'UTR	TGAAGTTTGATGTTTCATCCATGAAAATGAAATGTTTCAATGGTATTTCAACTATGTTTC	Os05g0468000	AK071412	Non-protein coding transcript, unclassifiable transcript.
3609	43	39	Os11g0202300|mRNA|AK068673|CDS+3'UTR	ATGGATGCACCATTTAGATGTATCAAATCCGAGAAAACGCAAATAAATACCGAACCATGT	Os11g0202300	AK068673	Conserved hypothetical protein.
3610	43	40	Os10g0328100|COMBINER_EST|CB964844|7	CAGATTGGATTTGCAACCTTGGTTTGCAGGTTTACAGTCCGAGCTCCTCAGATTCAACAA	Os10g0328100	CB964844	Conserved hypothetical protein.
3611	43	41	Os07g0434500|COMBINER_EST|CI121245|6	TTGGTGCAGCGGTTAGCGTGCTGATCCTAGTCTCATTTCTTACTGAAAATCTCCAGGATT	Os07g0434500	CI121245	DEAD/DEAH box helicase, N-terminal domain containing protein.
3613	43	43	Os06g0361500|mRNA|AK120214|CDS+3'UTR	AACTTAGAGGCTAAATCTATTTCATATGGTCTTCATCAGGAGTTTGAGGAACTGCAGCTT	Os06g0361500	AK120214	Conserved hypothetical protein.
3614	43	44	Os03g0211500|COMBINER_EST|CI395536|3	TCTACTAAAAAAGGTACAGCTTTTGCATAATCACCAAGTGCTTTCAAAACGATGTGTTGT	Os03g0211500	CI395536	Conserved hypothetical protein.
3615	43	45	Os03g0556200|mRNA|AK062920|UTR	TATACACCATTTCTCACCCAAAAGTTGTAAGAACTAGGAGGCACTTCAAGTTTTGAAGTT	Os03g0556200	AK062920	Non-protein coding transcript, putative npRNA.
3616	43	46	Os06g0642500|mRNA|AK072307|CDS+3'UTR	AAATACTTTCTGCAAATTATAGTACCTATACTTACAAGATGTTTGGGAGGTAGGAACTCC	Os06g0642500	AK072307	Similar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2).
3617	43	47	Os11g0214100|COMBINER_EST|Os11g0214100|8	CCTCCTCAGCTCCTCCCTCATCCTCGCGGTCGCCGTCTTCCTCCGCCACCACATCGGCGC	Os11g0214100		Similar to Histidine-rich glycoprotein precursor.
3618	43	48	Os01g0126000|mRNA|AK109441|UTR	GTTAAGTAGATGGTACACCATGCATGTATGTATATATGATTATATATGTGGAGCTTCCAC	Os01g0126000	AK109441	Non-protein coding transcript, putative npRNA.
3619	43	49	Os04g0395600|mRNA|AK072338|CDS+3'UTR	GGGACGATGATTAGTTTCCTTCTCTTTGCTCCTGTGAATGCAGTCAGTGCCTGGAATAAT	Os04g0395600	AK072338	Similar to TRANSPORT INHIBITOR RESPONSE 1 protein (F-box/LRR-repeat protein 1).
3620	43	50	Os03g0345200|mRNA|AK073724|CDS+3'UTR	CGTGTGACTTGATCGGTTTATCCTGATAATGTTTTATCCATGTTGAAGCTTTATTACATC	Os03g0345200	AK073724	40S ribosomal protein S21.
3621	43	51	Os01g0916400|mRNA|AB059401|CDS	CTCCTTGGCCCATGAGATGAGATATCCTGGTGGAGATTGCACCTCTGATATATGGATATA	Os01g0916400	AB059401	Similar to Selenium binding protein.
3622	43	52	Os07g0238800|mRNA|AK106355|CDS+3'UTR	GATAGTGGTCCATGGGTTGTAATAGTGAAAACTACAGCTTGTTAACAACGTGCTTGTTTT	Os07g0238800	AK106355	Protein of unknown function DUF1723 domain containing protein.
3623	43	53	Os02g0670900|mRNA|AK119517|CDS+3'UTR	AAGTATACATTCTATTCTGTTCATTCTGTTTTGTCCCAAGCAAGTAAACTTGTAATGCCC	Os02g0670900	AK119517	Similar to Amino acid transporter protein-like.
3624	43	54	Os02g0831500|mRNA|AK065549|CDS+3'UTR	TGTGAAGATTTAATAAATGATTACTGTGGGAATAATAAAAAGATTAACATACTTGGTAGC	Os02g0831500	AK065549	Similar to Sucrose synthase.
3625	43	55	Os08g0248800|mRNA|AK065010|CDS+3'UTR	AGATCCTTGCAAGGATTTAACCATGTCTAGAACTCTAGATGCATAATTTTCGATGTAACA	Os08g0248800	AK065010	Similar to Aspartate carbamoyltransferase 3, chloroplast precursor (EC 2.1.3.2) (Aspartate transcarbamylase 3) (ATCase 3).
3626	43	56	Os11g0174000|mRNA|AK072825|5'UTR+CDS	TGAACTCTGTCACAGTATCTTCTAGGAGGCCTGTTGTTCTTGCAGATGGTACTTATGCCA	Os11g0174000	AK072825	Adaptin, N-terminal domain containing protein.
3627	43	57	Os03g0159000|COMBINER_EST|Os03g0159000|8	TACGGAGACGATATAATTGTCGGTATTCTTGATACAGGAGGGCTCGAAGCTAAACAAACG	Os03g0159000		Proteinase inhibitor, propeptide domain containing protein.
3628	43	58	Os01g0773700|mRNA|AK060476|5'UTR+CDS	GACCTCGAGGAGGACGAGGAGTCCGGCGGCCTCTCGCTCTAGAGAGCCTCTATACATGTA	Os01g0773700	AK060476	Similar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment).
3629	43	59	Os05g0512400|mRNA|AK120770|CDS+3'UTR	GATCTTGGATTAATCTGTCAATCATGTCCATTTTGATTAATCGAAATTCCCTGTGCTGCA	Os05g0512400	AK120770	Conserved hypothetical protein.
3630	43	60	Os03g0804100|COMBINER_EST|Os03g0804100|8	GAGAGCTTGCGATGTTCAACATTGTTTGCGACGAACTTATGCTTGGGATCCCACATTTTG	Os03g0804100		Conserved hypothetical protein.
3631	43	61	Os04g0555400|mRNA|AK120749|CDS+3'UTR	ATCCATTTTGTAATGTACTCCACCTTATACCCGAATTCAGCAGACTTTCGTGGTGCTGTT	Os04g0555400	AK120749	Similar to Serologically defined breast cancer antigen NY-BR-99.
3632	43	62	Os01g0818400|mRNA|AK059910|CDS+3'UTR	GTAAAAAGTGAAGCTGGTAACTTGCCGTTCATTTTGCTTACTGAAATTGCGAAGTTTGCC	Os01g0818400	AK059910	Homeodomain-like containing protein.
3633	43	63	Os02g0607700|mRNA|AK109261|CDS+3'UTR	AGCATCAACCCTGTCAGTTGACAGTGAAAATATATAGTACCACTATATGGCAGTATGCGT	Os02g0607700	AK109261	Glucose/ribitol dehydrogenase family protein.
3634	43	64	Os06g0619000|mRNA|AK065719|CDS+3'UTR	GCTATTTAGACCATTTTGAATGGTACGCAACATCTCAACTAGAAAAACTCTAAATGTCGT	Os06g0619000	AK065719	Disease resistance protein family protein.
3635	43	65	Os04g0678300|mRNA|AK102779|CDS+3'UTR	GGTTAACAACCAATACATCGATTTGTTTGTTCATATATTGTTTCTTGGTTATACACTGAT	Os04g0678300	AK102779	WD40-like domain containing protein.
3636	43	66	Os07g0210000|mRNA|AK066578|CDS+3'UTR	TCATGCAAGGAAAATTGTAACACATACTAATTCAATGATTGTTAAATTAACTTTTCATTA	Os07g0210000	AK066578	Exo70 exocyst complex subunit family protein.
3637	43	67	Os02g0754600|mRNA|AK108420|CDS+3'UTR	ATCTAGTAGCAAATAAAGGCATTCTATCAGTAAAATAATGGAGTGCCTACGAGTTGTACC	Os02g0754600	AK108420	Conserved hypothetical protein.
3638	43	68	Os06g0617800|mRNA|AK068485|CDS+3'UTR	TGTTAACTCGACGCAGGATATCCATTGTATCAAGTATAAGAGAATCAGTCTCGTGCAGTT	Os06g0617800	AK068485	Ribose-phosphate pyrophosphokinase 2 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 2). Splice isoform 1.
3639	43	69	Os03g0301400|mRNA|AK101988|CDS+3'UTR	TCAAAGTTGTAAAGACCAAAACATGTCCTGGTTTCCAACCTGGAAGAAATGAAACGTTCT	Os03g0301400	AK101988	Exonuclease domain containing protein.
3640	43	70	Os03g0711300|mRNA|AK102350|CDS+3'UTR	TTTGGCTGCTGCAACATGTAAGCTTTTTTCATTTGGTTGTTGAATCCAGTATAGCAACCA	Os03g0711300	AK102350	Protein kinase-like domain containing protein.
3641	43	71	Os12g0528500|COMBINER_EST|Os12g0528500|8	TAGTGAGAGCAGCACTGTGTTACTACTTGGTGTGGCTTGTTTGGATCCTGCTGATTCATT	Os12g0528500		Winged helix repressor DNA-binding domain containing protein.
3642	43	72	Os11g0543300|COMBINER_EST|Os11g0543300|8	ATGACCATCATGCAGACGGTCTACACCGTGATGTCGTTCTACCAGCAGGCGGAAGGGGGC	Os11g0543300		Protein of unknown function DUF247, plant family protein.
3643	43	73	Os12g0596200|COMBINER_EST|CI146323|6	ATCGGACGGCTAGCTTCTCGTACTACTACTCCCAATGTACTACTACTACACTATTCTGTA	Os12g0596200	CI146323	Similar to RING-H2 protein.
3644	43	74	Os01g0916300|mRNA|AK121997|5'UTR+CDS	GCAGAGATTAAGAGCAAGGGGTATTCTTAAAGATGAGGCGACAAATAATAGATTCACGAT	Os01g0916300	AK121997	Similar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein).
3645	43	75	Os05g0198400|mRNA|AK071272|CDS+3'UTR	AGTTCGATTGGTGTGATCATGTGATGTATACTCCCTCTGTTAACATAAGGGTTTAAATTT	Os05g0198400	AK071272	Similar to Zinc transporter 4, chloroplast precursor (ZRT/IRT-like protein 4).
3646	43	76	Os01g0242400|mRNA|AK108724|CDS+3'UTR	ACCAGCTAAAAGCTCAAGCAATAATATGCATGAACATATCCCTTTGATGTATGGTTCTCA	Os01g0242400	AK108724	Lateral organ boundaries, LOB domain containing protein.
3647	43	77	Os06g0198500|COMBINER_EST|CI423738|0	AGAAATCATGAGGCCTGAACCTTGCATATATCATCACTGTATCAAACTGGTTGTTTGGTT	Os06g0198500	CI423738	Protein of unknown function DUF985 family protein.
3648	43	78	Os01g0776800|mRNA|AK070639|CDS+3'UTR	ATGACAGTGTGATGCATGGAAGACTATTGATATCAGTTGTTTTGTACATTGTTGTCAAAG	Os01g0776800	AK070639	Conserved hypothetical protein.
3649	43	79	Os06g0203800|mRNA|AK073793|CDS+3'UTR	TTGGAATGCTGGAACTGGTATTACTAATAGTCTCTCGGTTTGGACAAATTCGCAGGGTGG	Os06g0203800	AK073793	Similar to ERECTA-like kinase 1.
3650	43	80	osa-miR166d|Os02|5'seq	GAAGCTTTTTCACTTTGAGGGGAATGTTGTCTGGCTCGAGGTGCATGGAGAAACCTCTGA			miRNA
3651	43	81	Os12g0429300|mRNA|AK058910|UTR	CGTTGCGACGCCTTATGAGATGATTGAGGCGTGATTAGTGGAGGATATGGTAGAGAAATT	Os12g0429300	AK058910	Non-protein coding transcript, unclassifiable transcript.
3652	43	82	Os10g0318900|mRNA|AK111448|CDS+3'UTR	TCTCATGATTTTGTTGCCAGCCTAGGTGAAATAGAGCAATGCTACACGTACTAAATTTTT	Os10g0318900	AK111448	Similar to ER6 protein (Fragment).
3653	43	83	Os05g0114700|mRNA|AK099223|CDS+3'UTR	CATGGTATATGTACTATGATTGTACTATGTGTCATATATTCAGTGTAAGCAGTGGTTTGC	Os05g0114700	AK099223	Myb, DNA-binding domain containing protein.
3654	43	84	Os11g0118300|mRNA|AK064985|CDS+3'UTR	CTGTAAATTGTAAGTTTGTGTCCGCAAAAACGAACTAATGTTTGGATTGGATTGGTCAAA	Os11g0118300	AK064985	NPH3 domain containing protein.
3655	43	85	Os03g0174700|mRNA|AK069179|CDS+3'UTR	CGGGGGCGGAAACGCGATACGGTGGCGAGGGCGAGGTGAGCGGCCGTGCGGCGCGTCGCG	Os03g0174700	AK069179	Non-protein coding transcript, unclassifiable transcript.
3656	44	1	Os08g0300200|mRNA|AK119574|CDS+3'UTR	TAAAAGAATGGTGGTTTCATGTTCCGACGGAAATGCGATGTGCTATGAATGGAGGGTTGC	Os08g0300200	AK119574	C2 domain containing protein.
3657	44	2	Os01g0170000|mRNA|AK061224|CDS+3'UTR	TCATTGTTACGGGTTTTAAACGCTGGTTAATGTGAATTAATGCAACTATGCAAGTGTTAC	Os01g0170000	AK061224	Raffinose synthase family protein.
3658	44	3	Os07g0244400|mRNA|AK106280|CDS+3'UTR	GTGTTCTTTTTCGCCTAACAATGTCTCCAAATATGTACTCTTTTATAGATTGTGCTGGAT	Os07g0244400	AK106280	Protein prenyltransferase domain containing protein.
3659	44	4	Os02g0212300|COMBINER_EST|Os02g0212300|8	CGTCGAATTCTTAATGCGGGTGAAGATGGGAGACACAATCCTCCCTTCTCCCCGGGACAC	Os02g0212300		Hypothetical protein.
3660	44	5	ETG10_236652		
3661	44	6	Os07g0476200|mRNA|AK067379|CDS+3'UTR	TATAGATCTAAAGTAACGGATTTTTTCATGCGATTTGTTTTCAAGTTGCACCTTTTGGGC	Os07g0476200	AK067379	Tetratricopeptide region domain containing protein.
3662	44	7	Os05g0296900|mRNA|AK100725|CDS+3'UTR	TAGCGTATACTTCTAGTATTCTGATTATGATTGTACATTATTTTTAATCAGCATACGCTT	Os05g0296900	AK100725	Conserved hypothetical protein.
3663	44	8	Os02g0288000|mRNA|AK109705|CDS+3'UTR	GTCGAAGATTAATGTACTATGCATCAAGAATATATATTACCTGATGCTATCTTTGTCTGC	Os02g0288000	AK109705	Cyclin-like F-box domain containing protein.
3664	44	9	Os06g0590100|COMBINER_EST|Os06g0590100|8	AGCTATTTACGAAGGAGGGGAGAGATGTCATGGTCGGCATCACGTATGAGCGCAGACGGC	Os06g0590100		Retrotransposon gag protein family protein.
3665	44	10	Os06g0700000|mRNA|AK102835|CDS+3'UTR	CTTGTGCTCCTGGCTGTAAAATATATGTGGGCTTTGAAGCCTCTATGAAATGATCTGGAG	Os06g0700000	AK102835	Proteinase inhibitor, propeptide domain containing protein.
3666	44	11	Os07g0616400|COMBINER_EST|AU089812|7	TGTCAACAATCTTACTGGGATACAACATGCCTTCACCCATAATTGTCGCTCCAATGTGGA	Os07g0616400	AU089812	Conserved hypothetical protein.
3667	44	12	Os02g0301400|mRNA|AK121646|CDS+3'UTR	TCATACATGCCATTGTTGGATTCATGCGTTCTGAATGTGCAGTCCGAAGTTCTGAATGTT	Os02g0301400	AK121646	Thioredoxin-like fold domain containing protein.
3668	44	13	Os06g0537700|mRNA|AK109530|CDS+3'UTR	CTTTTCAAGCTTCCCCTTTTCCCTCCTGTTATTTAATGAGCATTTAAAGGGGTCCTTGCC	Os06g0537700	AK109530	X8 domain containing protein.
3669	44	14	Os03g0724700|mRNA|AK064412|CDS+3'UTR	AATTGGATGTAACCAAATTGCAAATCGTCGTCGTCGTTGTTGTTGATGTTGTTGGTACCA	Os03g0724700	AK064412	Maf-like protein family protein.
3670	44	15	Os01g0758000|COMBINER_EST|Os01g0758000|8	AGCGCGCCCGACGTCCTCGTACAACTACTACAAGCATGGCTACGACGACTCGCGCCTCTA	Os01g0758000		Heavy metal transport/detoxification protein domain containing protein.
3671	44	16	Os12g0105800|mRNA|AK070979|CDS+3'UTR	TAACGAATCTGGAATATCTCTGTCTAGATTTATTGTACTAGAATACGTCACATCTAGTGC	Os12g0105800	AK070979	Protein kinase-like domain containing protein.
3672	44	17	Os01g0654500|mRNA|AF155333|CDS+3'UTR	TATCCCTATCAGTTAGCGTCCGACTGGAAAATTATCTATGTTCCTCATTTGGATGGTTTG	Os01g0654500	AF155333	Similar to NADP-isocitrate dehydrogenase.
3673	44	18	Os11g0187500|mRNA|AK103083|CDS+3'UTR	TTTGCTAAAACTAATCTAGGTCTAGTGACTACTTATCTAAATGAGCTAATGCGGAAGATG	Os11g0187500	AK103083	Similar to Heat shock protein 70.
3674	44	19	Os01g0270100|mRNA|AK119511|CDS+3'UTR	GTGTAACTTCTCAAGGGAACCGTGGGTCTATGCCATACAGCTTGTGAATGTGAAATCCTA	Os01g0270100	AK119511	Similar to Cysteine protease inhibitor.
3675	44	20	Os08g0290500|mRNA|AK102868|CDS+3'UTR	GTGCCCTGGTCATGGCTAAATAAGGGAGTTGGACACACATGTTCATTCTGCCTATTCTAA	Os08g0290500	AK102868	Similar to AF-10 protein.
3676	44	21	Os06g0620000|mRNA|AK111088|CDS+3'UTR	ACTCTGCCTCTCAGTGTTTACTGGAGTAGCAGTGTTGTTACTCTGCAATGTCAGCTCTTT	Os06g0620000	AK111088	Conserved hypothetical protein.
3677	44	22	Os09g0508500|mRNA|AB114419|CDS+3'UTR	CATGCTTTGTCGCATGAAAAATTTTAAGCTCATGAGAATGCACATTACATTTCTTTCCCT	Os09g0508500	AB114419	Conserved hypothetical protein.
3678	44	23	Os03g0139100|COMBINER_EST|CI054604|0	GTGATGCTATCGTTTGTTTGCCCGTTGCAGTTTTGTAGTGAACAGAAGTTGCCATCCATA	Os03g0139100	CI054604	60S ribosomal protein L17 [Oryza sativa (japonica cultivar-group)].
3679	44	24	Os03g0647800|mRNA|AK061238|CDS+3'UTR	AAACTTCTGGAGTGAATCATGATATTAACAGCTTTCATCTATGTACCAGTCGCCACATGT	Os03g0647800	AK061238	Conserved hypothetical protein.
3680	44	25	Os04g0469700|mRNA|AK068788|CDS+3'UTR	CCTAAAGCCCTTCTTTTTCATGACAAAAATTACAGCAACAGGGGTCGATTTGGCCTTGTT	Os04g0469700	AK068788	Conserved hypothetical protein.
3681	44	26	Os01g0770200|mRNA|AK065830|CDS+3'UTR	ATTCTTCACTTAATCTCTTGACTAAATTAGTAGAGAGATTAATTGTGTTGCATTATTTAA	Os01g0770200	AK065830	Similar to Tyrosine decarboxylase 1 (EC 4.1.1.25) (ELI5) (Fragment).
3682	44	27	Os07g0636200|mRNA|AK069020|CDS+3'UTR	CCATGCTGTATTTTGTATTACCCAGCTAAATGCCCGTGCGTTGCAATGAAAATTAAGAAT	Os07g0636200	AK069020	DEAD/DEAH box helicase, N-terminal domain containing protein.
3683	44	28	Os02g0810000|mRNA|AK060586|UTR	ACAGCATAGATTGATAATGTGCTCTGGAGAACGCGTAGTTGATTGGATCTCCTCGAGGAA	Os02g0810000	AK060586	Non-protein coding transcript, unclassifiable transcript.
3684	44	29	Os09g0314200|COMBINER|CI155889|6	TCTTGTGGTGCCTTTTTCCTGCTTTTCAGCTTTCTAGGACAGCATCTCTACTTTCAGTTT	Os09g0314200	CI155889	(No Hit)
3685	44	30	Os09g0258600|mRNA|AK105087|CDS+3'UTR	CTGTGTACTGAATCTATTACTATGTTCTCAAAACGCAAATCTTGGAGGTGTTTGGATTTT	Os09g0258600	AK105087	Similar to 60S ribosomal protein L17-1.
3686	44	31	Os05g0365600|mRNA|AK105546|CDS+3'UTR	ACATTGGTAAAATTATCACGAAACCTGAGATTGAGGCCATTCGCATGGTTTCGGGTGTGC	Os05g0365600	AK105546	Similar to Hydroxyisourate hydrolase.
3687	44	32	Os09g0404500|COMBINER|CI351387|2	GTCGTGCAATCAATTCTACTCATTCCATTCTCTCCATTTGTAAGAACACCAGGTGGAAAA	Os09g0404500	CI351387	Conserved hypothetical protein.
3688	44	33	Os11g0147500|mRNA|AK105759|CDS+3'UTR	AAAGGAGAACTCAACTTCCTTGAAGGCGAAGGTAGGTATAGTAATTATCTATAGTTTTTC	Os11g0147500	AK105759	Heavy metal transport/detoxification protein domain containing protein.
3689	44	34	osa-miR160a|Os02|5'seq	GTGTGCCTGGCTCCCTGTATGCCACACATGTAGACCAACCCATGGTGTCTGGTTGCCTAC			miRNA
3690	44	35	Os02g0598400|mRNA|AK109577|CDS+3'UTR	GGTCAGGCCCCATGGGCTTGTGTGATGTTTAGTTTCTTTACTTGCTCTGAACCTTTTGTA	Os02g0598400	AK109577	Lipovitellin, superhelical domain containing protein.
3691	44	36	Os01g0736900|mRNA|AK062151|CDS+3'UTR	AAGCATAGTTACTATATCTGGATGCTAGAAGTATTATGGTACTATCAATGCCCCAAGTGA	Os01g0736900	AK062151	Reticulon family protein.
3692	44	37	Os01g0713200|mRNA|AB027430|CDS+3'UTR	TAGTGCCGTGTGGTGTCCATGCATCTTTCCCAATTTGTGAAATATATACTCCCAGTGAAT	Os01g0713200	AB027430	Similar to Beta-glucanase.
3693	44	38	Os04g0629500|mRNA|AK121437|CDS+3'UTR	GTGGCTTTACCATGCTCTATGAAATTTACTTACATGTGTTTCCAGTTGAAAAATATGTGG	Os04g0629500	AK121437	Similar to Thioredoxin h.
3694	44	39	Os05g0445100|mRNA|AK105131|CDS+3'UTR	CACAAATAGTAGTCACTACAGTCTAAACATACATACACTACATGAGTACGTCTCTTTCAT	Os05g0445100	AK105131	Cytochrome P450 family protein.
3695	44	40	Os12g0580300|mRNA|AK102871|CDS+3'UTR	TGTTGCTAAACTTTTACTAACTTGTTAACAGACAGACAGAATGATAACATGGACTGTGGA	Os12g0580300	AK102871	Similar to TATA-binding protein TBP2.
3696	44	41	Os07g0588400|COMBINER_EST|Os07g0588400|8	TGACACGTGGATGTATGCACCAATCGCTTACAATGGAGTCAACATCAGCAATATTGATCT	Os07g0588400		Basic helix-loop-helix dimerisation region bHLH domain containing protein.
3697	44	42	Os01g0637600|mRNA|AK106980|CDS+3'UTR	ATAGCTTTCGGTTCTGGCAGTTTTTCAAAACATCCTGCTGAGCTTCACATTGAAGATTGT	Os01g0637600	AK106980	Similar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase).
3698	44	43	Os05g0215000|mRNA|AK103934|CDS+3'UTR	TCATAAATTTACGCGTGTGCGCGCGACGATCCGACATGCCCACACTAACGTGTTTTACTT	Os05g0215000	AK103934	BURP domain containing protein.
3699	44	44	Os07g0115800|COMBINER|CI082308|6	GATGCATTACGCCTGGCTTGGATTAGAAAGGAAATCGCAGCATTAGAGTGAGTACTTTTG	Os07g0115800	CI082308	(No Hit)
3700	44	45	Os08g0326700|COMBINER_EST|CI259750|6	TTGCTGTAAAGTTGTCGACGGTTTTTTCTCCAAAAGATTTTCACTTTGTGGACCTTTAGA	Os08g0326700	CI259750	"Peptidase S8 and S53, subtilisin, kexin, sedolisin domain containing protein."
3701	44	46	Os05g0372100|mRNA|AK107148|CDS+3'UTR	TTTTAGCAATAATCGGTAACAATGTGGTTAACCTTGTTAGTAAAGCTGACCTTTGAAAGC	Os05g0372100	AK107148	Similar to Receptor protein kinase-like protein.
3702	44	47	Os02g0703600|mRNA|AK067007|CDS+3'UTR	GCTAAGCCAGGCCACGGGAGAGCGACTCCTCTGTACCGTTTCGTCCAACTCAAGAGAAAA	Os02g0703600	AK067007	Similar to Cytochrome P450 90C1 (EC 1.14.-.-) (ROTUNDIFOLIA3).
3703	44	48	Os03g0648300|mRNA|AK067192|CDS+3'UTR	TCTTGTGCACGGTTGTGGGTATGTCGTGCCATATTTTTCTTTTGCATTTCCATCAGTTTT	Os03g0648300	AK067192	IQ calmodulin-binding region domain containing protein.
3704	44	49	Os01g0502900|COMBINER_EST|CI092009|6	CATATGCTTCTCTCCTTCCCTTTCCCCTCTCGTTTGCTAGGTGGCAGTAGTTGCAAGCTT	Os01g0502900	CI092009	Histone H2B.
3705	44	50	Os01g0612500|mRNA|AK069125|CDS+3'UTR	CCACGTTACAGTTGTAGTTTTCTACTGATGTACTTTGTTACCGCTAAAGAGGGATGCGTA	Os01g0612500	AK069125	Phospholipase/Carboxylesterase family protein.
3706	44	51	Os12g0242900|mRNA|AK064505|CDS+3'UTR	AACTGTTCTGATCTTGTTCCACATGACCACATCCCATTGTGAATAAGAATCAGGAAGCTA	Os12g0242900	AK064505	DNA polymerase epsilon subunit B family protein.
3707	44	52	Os03g0376800|mRNA|AK067678|CDS+3'UTR	CAGTTTGGTCGAATTAGCCGATCATTCTTATGTACTGATTGATGTCCACTGTTGTTGGTG	Os03g0376800	AK067678	KH domain containing protein.
3708	44	53	Os12g0405100|mRNA|AK111511|CDS+3'UTR	CTGAATTATTTGTTCAATAAAAGAATCGGCCATGGCTGCGCGATCTGGGTCATTGTTCTC	Os12g0405100	AK111511	Similar to Floral homeotic protein HUA1.
3709	44	54	Os01g0713200|mRNA|AB027429|CDS+3'UTR	TAGTGCCGTGTGGTGTCCATGCATCTTTCCCAATTTGTGAAATATATACTCCCAGTGAAT	Os01g0713200	AB027429	Similar to Beta-glucanase.
3710	44	55	Os09g0463700|mRNA|AK060708|CDS+3'UTR	TTTGAAATTTGATGCTACTATAAGCTCTTCTCTGCATAGGATTGCAGACTTGCAGCAATG	Os09g0463700	AK060708	Similar to AHM1.
3711	44	56	Os01g0253400|mRNA|AK108904|CDS+3'UTR	GAATTGTAAAGCACTTGATTCGTGATTACATCTCAACAAGTTTCAATTTAATTTACTTGG	Os01g0253400	AK108904	Protein of unknown function DUF1218 family protein.
3712	44	57	Os01g0876900|COMBINER_EST|CI063025|6	GGTTGCGTAGATCGCTAAATGTAAGCTACTAATGCAACTACTGTTGAACTATTACCTTAT	Os01g0876900	CI063025	Conserved hypothetical protein.
3713	44	58	Os12g0596900|mRNA|AK100450|CDS+3'UTR	AGCTGCCCTATTTTATTGATGTCAAAACTGAAATGCAAGACAAGTTGGATTATTTCGTCC	Os12g0596900	AK100450	Conserved hypothetical protein.
3714	44	59	Os05g0558800|mRNA|AK066898|5'UTR+CDS	TCATTGCAAGCATCAAATGTTGTTGCTGTGCCATATCAAGTCCCGTCTCAGGTTTCAGCT	Os05g0558800	AK066898	Protein of unknown function DUF1675 family protein.
3715	44	60	Os06g0226000|mRNA|AK121923|CDS+3'UTR	AGCTCAACTAGTGTTACTGGAGTGTTATCTTTAGCTGGACTAATATTTCAATATATGTGC	Os06g0226000	AK121923	Similar to Transposase (Fragment).
3716	44	61	Os07g0562700|mRNA|AK109399|CDS+3'UTR	GGGGTTTGCAACTTATGTGTCAGCTGCTGCTTTAAGCTTAGTTAACTCTTTTGATGTTTT	Os07g0562700	AK109399	Similar to Type III chlorophyll a/b-binding protein (Fragment).
3717	44	62	Os06g0113900|mRNA|AK102259|CDS+3'UTR	AAGACAATTGTAACTGATGATATGGTTCTTTGTTCATCGCCACCGAAATTCTCTCTGGCA	Os06g0113900	AK102259	Conserved hypothetical protein.
3718	44	63	Os01g0878000|mRNA|AK104289|CDS+3'UTR	CTGTTGCTGATTGAATTGCTGTATAGCGGAGACGCTGTAAATAATAAACGCAGGGGAGAG	Os01g0878000	AK104289	Conserved hypothetical protein.
3719	44	64	Os01g0293200|COMBINER_EST|AU030398|6	ATATCACTCAAAACCTTTCCTTTCATTGAACTATCTAAACATGTTTGCATCATGTCATGC	Os01g0293200	AU030398	Protein of unknown function DUF860, plant family protein.
3720	44	65	POsControl0014|genome		
3721	44	66	Os04g0208800|mRNA|AK120001|CDS+3'UTR	GCTTTGCTTGGTTGGGTTGGGTTGTGTAGGTGAGGATGCTCGTGCAATGGAGTTATTGCA	Os04g0208800	AK120001	Conserved hypothetical protein.
3722	44	67	Os02g0123100|mRNA|AK101344|CDS+3'UTR	GAGAACAGAAGGTACCTCCTGGCTATCCCTCTGTGTAATTCAAGCCAATTGAAAGATCCT	Os02g0123100	AK101344	Similar to Cell division control protein 28 (EC 2.7.1.37).
3723	44	68	Os04g0556400|mRNA|AK101107|CDS+3'UTR	CATATGCAATATGCAACTTATTAGTAGTACTGTATGAGAATTGGACATCATTTGTGGACC	Os04g0556400	AK101107	Similar to Cis-zeatin O-glucosyltransferase 1 (EC 2.4.1.215) (cisZOG1).
3724	44	69	Os04g0529100|mRNA|AK107680|CDS+3'UTR	ATTCCCTTTATTTCGTATCTTCCCAAGATTGTGTGTGTCAGATATTCGTTGAACTCGACT	Os04g0529100	AK107680	Pathogenesis-related transcriptional factor and ERF domain containing protein.
3725	44	70	Os08g0104900|mRNA|AK101575|CDS+3'UTR	GTTGTTCGTATAGAGCTAATAGAACTTCCTTCTTGTCATCTGAACATGCTGGGGTGCTCC	Os08g0104900	AK101575	Protein of unknown function DUF6, transmembrane domain containing protein.
3726	44	71	Os03g0241400|mRNA|AK062662|CDS+3'UTR	TTCGCGGATGGGGAAAAAAAATTAGGGTTGCGGGAGGGGAAGAAGAGAAAAAAGGGAGCC	Os03g0241400	AK062662	Conserved hypothetical protein.
3727	44	72	Os10g0495300|mRNA|AK059840|CDS+3'UTR	TCCGTATTAATAATGTTGAATATGATATATACAGGCCACGCGCCTGCAATCCCCATTAAT	Os10g0495300	AK059840	BRO1 domain containing protein.
3728	44	73	Os01g0545100|mRNA|AK065915|CDS+3'UTR	CAAATGTTTTTCGCCAGAATAGCTATATACATATATACATTTGATGAAATTATTAATTTT	Os01g0545100	AK065915	Conserved hypothetical protein.
3729	44	74	Os05g0591200|COMBINER|CI321280|6	GTATGCAAGATGGAAAACAGATATGGGACACTCTAGAGAAGCATCTCCCAATGGATTTAC	Os05g0591200	CI321280	(No Hit)
3730	44	75	Os02g0205300|mRNA|AB033537|CDS+3'UTR	ATTTTAAGATGCACCTATGATAATATGATGTTGAAAAGTTTAATTTATTGAATTGGCTAG	Os02g0205300	AB033537	Similar to TAT-binding protein homolog (Fragment).
3731	44	76	Os11g0539100|COMBINER|CI421626|6	CTCACTGAAACCAGGAGGATCCATCACCATATTATTGTTGCATGATCTATGCTTCATGAT	Os11g0539100	CI421626	Hypothetical protein.
3732	44	77	Os11g0543100|mRNA|AK108274|CDS+3'UTR	TTACCGCTCAGTGGAAAATTTCACCGTGTCCTCTTTTGGCCTTCCGGGTCAAGAAAAGCT	Os11g0543100	AK108274	Conserved hypothetical protein.
3733	44	78	Os04g0506900|mRNA|AK102222|CDS+3'UTR	AGTTGGCAGCATCCTGGTGTCTTGAGCTCTATGTCAAATTCGTCAATCTGAACGTCTGAA	Os04g0506900	AK102222	Conserved hypothetical protein.
3734	44	79	Os11g0657900|COMBINER_EST|CI459501|0	TTTTTTAATCAAACGTCTTGATCAACAATCCTTTGCAAACATGGTTCTCCGGTCCTTAAT	Os11g0657900	CI459501	Disease resistance protein family protein.
3735	44	80	Os04g0190900|COMBINER|CI098833|6	AGGATTAGACTGACGGACTCCTTGCAGCTTCGATCTCGTATCAGATGGTTTTTGGATAGT	Os04g0190900	CI098833	(No Hit)
3736	44	81	Os01g0974200|mRNA|AK062796|CDS+3'UTR	ACTACATATGCCATGTACTAGCTACCTAGCTTGCATGCAAGTCCTTAATTTGCTGCTAGC	Os01g0974200	AK062796	RicMT (Metallothionein-like protein).
3737	44	82	Os09g0426500|COMBINER_EST|AU095100|7	TATGGATAATTTTCAAATGTAACTATTGTATAATTATTCTGTAACTATCTTATAGTTTTT	Os09g0426500	AU095100	Conserved hypothetical protein.
3738	44	83	Os05g0371200|mRNA|AK112020|CDS+3'UTR	ATAATTCAGTGAACTTAACGCCAGTTACATTTGGGTTATGAAAGCTTACCACTTGACAAC	Os05g0371200	AK112020	Similar to 26S proteasome non-ATPase regulatory subunit 14 (26S proteasome regulatory subunit rpn11).
3739	44	84	Os01g0251200|mRNA|AK063298|CDS+3'UTR	TTTGGGCTATAGACGGTTCTGTTGCTGTCAACTCAAAACTCCTTTTAATACGAAGTTATG	Os01g0251200	AK063298	Steroid nuclear receptor, ligand-binding domain containing protein.
3740	44	85	Os01g0949300|mRNA|AK072758|CDS+3'UTR	TGTAAGCCTAACGTTGCTGTGTGAATCGGACTTGTATCTTGCTGCGATCGAGCTACTATA	Os01g0949300	AK072758	EF-Hand type domain containing protein.
3741	45	1	Os05g0410100|mRNA|AK108696|CDS+3'UTR	AGGAGTAGGGTCGTGTGTGGACTTGTAGAGCGACTAGACCAACCGAATAGCGAGTGTTCT	Os05g0410100	AK108696	Conserved hypothetical protein.
3742	45	2	Os06g0128300|mRNA|AK064342|CDS+3'UTR	GGCAAAATTTTCCTCTTTGAGGAAACACCCAACAGTTCGACATGTTTCCATGATGTAAGC	Os06g0128300	AK064342	Similar to Mitochondrial half-ABC transporter.
3743	45	3	Os04g0165900|COMBINER|CI198027|6	ATACTAAGTTAATTAATTCGCGTGTGTGTCTCTCCAGGGGAGTGACGCAGAACCATCTGT	Os04g0165900	CI198027	Conserved hypothetical protein.
3744	45	4	Os10g0555100|mRNA|AB164463|CDS+3'UTR	TCATTTGGACAGAATCACATTCTCTAATTCTTGATTCATTCTGACGATTTTGGCTCAGGC	Os10g0555100	AB164463	Similar to DNA chromosome 4, ESSA I CONTIG fragment NO. 6 (Glucosyltransferase like protein).
3745	45	5	Os08g0184700|COMBINER_EST|CB661803|7	CATCCCATTGCTACAAAAGCCTTTGGGTTTAGTGAACCTAAATTTGTGACCAGTTCAAGC	Os08g0184700	CB661803	Hypothetical protein.
3746	45	6	Os06g0125800|mRNA|AK104425|CDS+3'UTR	AAACCTTAACTCCCAAAAAAAACAGAGAAGGGAAGAAAAAGAAAGCAAAAAGGAAAAAGG	Os06g0125800	AK104425	Zinc finger, RING-type domain containing protein.
3747	45	7	Os01g0843500|COMBINER|CI168914|6	TATCTTGAAATTCTGCTTGTTCATATCCTGTTCTTCTGATTAAAGACAGCTTAGCTTGAG	Os01g0843500	CI168914	(No Hit)
3748	45	8	Os12g0596100|COMBINER_EST|CI130302|6	AGTAACAGGGGAGATCAAGTGGGTGAAGCTTGCACAGCTTCGAGTCATCGGCTTGGGGAC	Os12g0596100	CI130302	Hypothetical protein.
3749	45	9	Os07g0670800|COMBINER|CI430561|3	CTCTTAAACACACTTGTGCTCGTAATTCTGCTGATGTTTATGAATCTAGTTTTGCAATAC	Os07g0670800	CI430561	Similar to 60S ribosomal protein L19-3.
3750	45	10	Os10g0532800|mRNA|AK068817|5'UTR+CDS	ATCGAGGAGCTCACCCTAGAGCTGCCCCGGGATGATAAAATGAAATATAAATTCCCATGT	Os10g0532800	AK068817	Conserved hypothetical protein.
3751	45	11	Os04g0527000|mRNA|AK104433|CDS+3'UTR	CCACGGCAAAAGTGCCATCATATACATGTGGTATGTACAAGATCAATGAGAAATCCAAAA	Os04g0527000	AK104433	GRAM domain containing protein.
3752	45	12	Os12g0586000|mRNA|AK119516|CDS+3'UTR	TACAGATGATGTGTATATTTTTCCCTGTCTAATACAGGATGGAGGAACAATCCACTCTGC	Os12g0586000	AK119516	Similar to Disease resistance protein ADR1 (Activated disease resistance protein 1).
3753	45	13	Os07g0536500|COMBINER|CI436641|6	GGTAAGCACAAGGAGGGCAAGAATGAACTTTATCATGACACCAAGTTTGCATGCGCACAA	Os07g0536500	CI436641	(No Hit)
3754	45	14	Os03g0363900|mRNA|AK066313|CDS+3'UTR	ACCAAGAGTTGATAACTTACTTGATAGAATCTGTTGACAGCATATGGGAATGAGAATTGT	Os03g0363900	AK066313	Zinc finger, DHHC-type domain containing protein.
3755	45	15	Os02g0138200|mRNA|AK068239|CDS+3'UTR	CTGTTAAGAATGATCTGTCTTTGTTTGTGAAGCACAATGCTATGTACGAGTTTTGTTCAA	Os02g0138200	AK068239	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
3756	45	16	Os10g0548400|COMBINER_EST|Os10g0548400|8	TGCGGCTTCCGGCGTTGCGGGGCAGCACGGCCACGGCGGGGTCGACACGCGCTTCCCCGA	Os10g0548400		Conserved hypothetical protein.
3757	45	17	Os08g0501200|COMBINER|CI404454|6	ACATGTGTAATAATCATAACGCTGTGAACCATATTAGCGAGAATGATGAGTCTAATGTGT	Os08g0501200	CI404454	(No Hit)
3758	45	18	Os04g0500700|mRNA|AK072528|CDS+3'UTR	ATGTACGATACGACTATAACAGCCTGATTGCCTATGAACTGCAAGTAAATGCATGTGAAT	Os04g0500700	AK072528	Similar to Hydroxyanthranilate hydroxycinnamoyltransferase 3.
3759	45	19	Os04g0103900|mRNA|AK100989|CDS+3'UTR	TATCTTTCAATGTGTATCATCATTGTGTTCCTCAAAATTCACAGAACTACATGCCACTAC	Os04g0103900	AK100989	Similar to Chalcone synthase.
3760	45	20	Os11g0423200|mRNA|AK111297|CDS+3'UTR	TACTCCTTTATATCTTTAATTTCAAAATCAAATTCTTGGAGTGGAAGAACCCATCTAATT	Os11g0423200	AK111297	Hypothetical protein.
3761	45	21	Os05g0523200|mRNA|AK119973|CDS+3'UTR	GGCGGCGAACGGCGCGTGCGTGTCAGCGTGGCTCCACTTTTTAGCCCACCCACCCCGTAA	Os05g0523200	AK119973	Conserved hypothetical protein.
3762	45	22	Os01g0200700|mRNA|AF147786|CDS+3'UTR	TATGCGTGTATCAACGTATGAATTTGTGTGATGTGATGTACCCGTGCTATTCTCAGTGAA	Os01g0200700	AF147786	Similar to Metallothionein-like protein type 3 (MT-3) (MWMT3).
3763	45	23	Os01g0853600|mRNA|AK107747|CDS+3'UTR	AGGTTACTGTTGTTTGAAAGGGTAATGGCGATACTGATCGATGTTAGTCATGGATGGTGA	Os01g0853600	AK107747	Conserved hypothetical protein.
3764	45	24	Os03g0827500|mRNA|AK067674|CDS+3'UTR	CCTTTTTCTTTTCGCTCGTAGATATCAAAGTTGGATTTATATTTACTGTGTTCTTTGGTT	Os03g0827500	AK067674	SPX, N-terminal domain containing protein.
3765	45	25	Os10g0191300|COMBINER_EST|CI555572|0	TGGGATCGACGTCCGTGAACAATAAAGCATGTAATGATCTTAATAATAAATAATTTCTTG	Os10g0191300	CI555572	Similar to PR-1a pathogenesis related protein (Hv-1a) precursor.
3766	45	26	Os03g0318600|mRNA|AB051294|CDS+3'UTR	AGTTATGGTGAATTTATGATTGGCAGATTGTACAATTGTATTAGCAATAAAATAAAAGGT	Os03g0318600	AB051294	Similar to Transcription factor HBP-1b(C38) (Fragment).
3767	45	27	Os03g0722800|mRNA|AK065777|CDS+3'UTR	AGCACAAACGTTCCACGACACGACAATTTGGGGGAATTGAGGGGTACTGCGGCTGTAAAA	Os03g0722800	AK065777	Cyclin-like F-box domain containing protein.
3768	45	28	Os08g0379400|mRNA|AK104318|CDS+3'UTR	TGTGATGAACTGCTGAGCAATGTCCACAACCCCTCTCTAGCAATGTCCAGTTGATTTGAA	Os08g0379400	AK104318	Similar to Quinone oxidoreductase-like protein.
3769	45	29	Os08g0474700|mRNA|AK064878|CDS+3'UTR	ATAGGCTGCAAGGATTCTGCCTCCACTATAAATTCAAGAAGGAACATTCATGATTGTGTA	Os08g0474700	AK064878	Similar to COPII subunit Sec23 (Fragment).
3770	45	30	Os07g0641700|mRNA|AK059154|CDS+3'UTR	ACTTGCAAAAGATTGTTGCTTCCTTTTATCTGTTGCGATGAAATTCAGTAAACGTTAACG	Os07g0641700	AK059154	Similar to 10 kDa chaperonin (Protein CPN10) (Protein groES).
3771	45	31	Os06g0613900|COMBINER_EST|Os06g0613900|8	ATTAATGGCTACAAGTGGGATATTGTCTGACGAGGAAAGCAAGCTTGACTGCAGAGAGCT	Os06g0613900		"Peptidase, trypsin-like serine and cysteine proteases domain containing protein."
3772	45	32	Os05g0315100|COMBINER_EST|CI269750|6	AATGGCCAACTGTGGATAGTGTAACAGTTTGAGCATCATACTACTAGTTATTGCACAGGA	Os05g0315100	CI269750	Tetratricopeptide-like helical domain containing protein.
3773	45	33	(+)E1A_r60_n11		
3774	45	34	Os01g0619000|mRNA|AK068707|CDS+3'UTR	AGTTTAACAATCCAGAATTTCTCTGATTAATGATGAGTTGCTGAGCACTGTCATCTTTCT	Os01g0619000	AK068707	Nucleotide-binding, alpha-beta plait domain containing protein.
3775	45	35	Os10g0160000|mRNA|AK111889|CDS+3'UTR	CATCTACTCATGTTCTTATTTTACTGGAATCATATCTGCTACATACTATAGGTCTTGACG	Os10g0160000	AK111889	Similar to Ubiquitin carboxyl-terminal hydrolase 12 (EC 3.1.2.15) (Ubiquitin thiolesterase 12) (Ubiquitin-specific processing protease 12) (Deubiquitinating enzyme 12).
3776	45	36	Os02g0578000|mRNA|AK064085|CDS+3'UTR	TACTAGCGTGTACTGTTATTCTAGTGTTGGTTGGTATACTCCAGCTTGGCCGGGGTCTCA	Os02g0578000	AK064085	Similar to Glucosyltransferase (Fragment).
3777	45	37	Os01g0176200|mRNA|AY625694|CDS+3'UTR	TGGTTGATACAGATGGGAATAAGCATTTTTTTTAATCATGATGAGCATGAAGTGGAGGAC	Os01g0176200	AY625694	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
3778	45	38	Os06g0729300|mRNA|AK111500|CDS+3'UTR	CGTATGGACCTGTTTCATCATTTCAAAATGGTCAATTGTCTTGTTTGCATTTGGATTTTC	Os06g0729300	AK111500	Similar to AGO1 homologous protein.
3779	45	39	Os12g0445200|COMBINER_EST|Os12g0445200|8	TCGCCGGGGCTCCCGTTGGCGCCGGCCCCGGCGTGGAGTACGTCGCCGGCGACATGTTCG	Os12g0445200		Winged helix repressor DNA-binding domain containing protein.
3780	45	40	Os05g0148600|mRNA|AK066168|CDS+3'UTR	GCATTGTATTGGATTTGTAGAAAGTACTCCCTCTTTGTTAAATTTAAATGAAGGTGCCAC	Os05g0148600	AK066168	Similar to Na+/H+ antiporter.
3781	45	41	Os08g0323800|mRNA|AK108337|CDS+3'UTR	TAGTATACCATTGCTTGTGCAAATCCGATCGTGCATTGTCTTGCTCGTGCGTTATTAAGC	Os08g0323800	AK108337	Hypothetical protein.
3782	45	42	Os01g0120900|mRNA|AK110709|CDS+3'UTR	ATGCACGACGGCGTGATCCCCATGAGAACTAGAGAGAGAAGAGAATGAGAATGAGATGGT	Os01g0120900	AK110709	Conserved hypothetical protein.
3783	45	43	Os01g0881100|mRNA|AK109822|CDS+3'UTR	GAGCGATGAGAAATTTCAATGCTAACTATGATACACGCTAAATGAAGCTGATTTTGCACC	Os01g0881100	AK109822	Epsin, N-terminal domain containing protein.
3784	45	44	Os05g0118900|mRNA|AK109043|CDS+3'UTR	CTACAGTATTTGTGTTTTTTTTAATCTTGTCAGTTGATGAAGAACTACAGTGCCCGCCTC	Os05g0118900	AK109043	Conserved hypothetical protein.
3785	45	45	Os12g0225200|COMBINER_EST|AU092694|6	TTTGCACGAGTCCATATGTAATCCGTTCAGCTCATCTCTCTTGCAGAATGGAATGGCATT	Os12g0225200	AU092694	PDZ/DHR/GLGF domain containing protein.
3786	45	46	Os10g0103700|mRNA|AK066743|CDS+3'UTR	TAGCTAGCTAGCTAGCTCACACACATATATATACTGTACTCTGTACGTGATCCATGTATT	Os10g0103700	AK066743	Similar to HD-ZIP protein (Fragment).
3787	45	47	Os01g0553400|mRNA|AK102543|CDS+3'UTR	AGGGCTGGACTTACATGCCCTTGTACTTTTTCAGAAACAATAATAATAGTGCATCTTTTT	Os01g0553400	AK102543	Cyclin-like F-box domain containing protein.
3788	45	48	Os08g0129200|mRNA|AK101577|CDS+3'UTR	AGAGACAAGCCATGGATTTGCACTGTCTGATCTATCTATGAATCTATCTATTATGAACCG	Os08g0129200	AK101577	Similar to Cold shock protein-1.
3789	45	49	Os06g0488200|mRNA|AK069690|CDS+3'UTR	TTTTTTCTTTTCCTCTTCCAGTCATTGGGTTACCTACGTTGTACTGATCGTGTGTATAAC	Os06g0488200	AK069690	Similar to Myosin heavy chain (Fragment).
3790	45	50	Os05g0586600|mRNA|AB096011|CDS	CATCACCCTCTCCAACTTCACCCGCTTCCCCTTCGCCATGGAATCCGAGAGGCAGGAGAT	Os05g0586600	AB096011	Plastid sigma factor SIG5.
3791	45	51	(+)E1A_r60_1		
3792	45	52	Os04g0129500|mRNA|AK071986|CDS	CACCTGAACTTGTGAACAACATTCTTGGAGTCAGCTTGGCAAACTTCCCCGATCTATCAA	Os04g0129500	AK071986	Zinc finger, Sec23/Sec24-type domain containing protein.
3793	45	53	Os06g0160100|COMBINER_EST|CI447171|0	TCCATGGTTGCAATGTAACTGCTGGTTATTCTGAAATTGCAATCGAAGTAATCTGTTTTA	Os06g0160100	CI447171	Similar to Histone H3.1 (Major histone H3).
3794	45	54	Os08g0472400|COMBINER_EST|Os08g0472400|8	AAGGAGCGGCCGCGGCCCGCCGTTCAGCTACCGCCGGAGATCGCCGTCAAGGTGGAGCGG	Os08g0472400		Conserved hypothetical protein.
3795	45	55	Os01g0127100|mRNA|AK106749|CDS+3'UTR	AAACTGTATTGTACACTTTTTGTTGTTTCACTGTTCAAAAACGAGGCTTGACATTCGTTC	Os01g0127100	AK106749	Conserved hypothetical protein.
3796	45	56	Os04g0166000|mRNA|AK107133|CDS+3'UTR	TAATTGCAAACGAATGGACATAAATTAAATATTGATGCTGCATCGTGGTGATGCTGCAAC	Os04g0166000	AK107133	Conserved hypothetical protein.
3797	45	57	Os06g0476100|mRNA|AK065281|CDS+3'UTR	GGCAAACGCCGCTCCCCGCCGCCACTACTCTAGCCCTCGTCCCCTCGCCGCCGTCGCTGC	Os06g0476100	AK065281	Non-protein coding transcript, unclassifiable transcript.
3798	45	58	Os04g0295500|mRNA|AK107143|CDS+3'UTR	GCTGCTACCCGTTTGTGTGTGATTTGTCACTATGTGTGGACTGTTGTACCTTTCTTACTT	Os04g0295500	AK107143	Conserved hypothetical protein.
3799	45	59	Os04g0409900|COMBINER_EST|CI479575|6	GTTTCGGCCTATCGTCATATTTGTAGAATATGTTATAGGAATGATGAGTTCTTGTTGTAC	Os04g0409900	CI479575	Similar to Neutral/alkaline invertase 4 (Fragment).
3800	45	60	Os02g0137500|COMBINER_EST|CI141281|6	TAGGTTTCTGGAACTCTTATTGTTGATGAAAAATTGGTCTAGCTGTTCCCCCTCCAGCAC	Os02g0137500	CI141281	Similar to P300/CBP acetyltransferase-related protein 2.
3801	45	61	Os04g0462900|mRNA|AK059483|CDS+3'UTR	GAACGGAATGTGCTAATCTTTGTGATCCAAATAAGTTCTGGGTCTAAGACTCATTTATGT	Os04g0462900	AK059483	Similar to Prohibitin.
3802	45	62	Os01g0166100|mRNA|AK103697|CDS+3'UTR	TTGTAAAACTGAAACTGGTAGAGGATGTCCAAGTGAATTCAATGTTGTTCAGGAACTTCA	Os01g0166100	AK103697	Similar to Ca(2+)-dependent nuclease.
3803	45	63	Os04g0612600|mRNA|AK099008|CDS+3'UTR	ATCTTGAATGGTGACGTTTGTGGTCAGCATCGACATTTTGTTATATTCTGCTGGATTGTT	Os04g0612600	AK099008	Similar to Coatomer-like protein, epsilon subunit.
3804	45	64	Os12g0212100|COMBINER|CI385542|6	GATCGGAATGATACAATAAACCAAATTTAGGGGTCCTGATGTATGCTTTGCAAGTTCGTG	Os12g0212100	CI385542	(No Hit)
3805	45	65	Os04g0488000|mRNA|AK099095|CDS+3'UTR	GACCGCTCGTCCATTTCTTTGGGATGGTTGAGGTGTAACGCCTTCTCTTAAATGACATTA	Os04g0488000	AK099095	Similar to PITSLRE serine/threonine-protein kinase CDC2L1 (EC 2.7.1.37) (Galactosyltransferase associated protein kinase p58/GTA) (Cell division cycle 2-like protein kinase 1).
3806	45	66	Os02g0200900|mRNA|AK062067|CDS+3'UTR	GATCCCTGTTTTTACCGGCATATTGTTGAGGACTGTAATCTTTGCAACCTTCTCAGAATA	Os02g0200900	AK062067	Leucine-rich repeat, cysteine-containing containing protein.
3807	45	67	Os03g0321700|mRNA|AK101653|CDS+3'UTR	CCTTGCATGTCACCATGAATTTCTTAGTTGAATTGAAATACCAGTGCTAATTTACATTCC	Os03g0321700	AK101653	Similar to WRKY transcription factor 55.
3808	45	68	Os01g0185300|mRNA|AK061343|CDS+3'UTR	TAGACAGTTTAATATTTGTACCATTTGATATGGGAATAAAAGAAAAGATATACTCTCCAT	Os01g0185300	AK061343	Transferase family protein.
3809	45	69	Os06g0268800|mRNA|AK059623|CDS+3'UTR	AATGTGTATAAATTCTACACTTGTGTATATGCAATGAGAATATTGCGAGCTTTATTTTTG	Os06g0268800	AK059623	Protein of unknown function UPF0005 family protein.
3810	45	70	osa-miR156a|Os01|5'seq	GGAGGGTGACAGAAGAGAGTGAGCACACGTGGTTGTTTCCTTGCATAAATGATGCCTATG			miRNA
3811	45	71	Os11g0678000|COMBINER_EST|CI543380|0	CAGTGATGACCGATGAAATTTCGGCAGTCATCGAATACAATGCTGTATTCACCCTATTAA	Os11g0678000	CI543380	Protein kinase domain containing protein.
3812	45	72	Os05g0502500|mRNA|AK060111|CDS+3'UTR	GCGCCTTCTTCTCGTTGCAACTTGTAAATTGCAATTACCTCTGCTTGTGTAAAAGTAACA	Os05g0502500	AK060111	Conserved hypothetical protein.
3813	45	73	Os06g0226700|mRNA|AK064240|CDS+3'UTR	TTAATTTTCTCCGTTTTTGTTTGAGTTGTTGTCTACTAATGTCTATGGCTTTCTTCCTCG	Os06g0226700	AK064240	Similar to PCF1.
3814	45	74	Os01g0762600|COMBINER_EST|Os01g0762600|8	CAGCACAGGTTATCAAGAGTTGCAACTAAATATGAAAATGGAAAACACTATCGGGTATGG	Os01g0762600		NLI interacting factor domain containing protein.
3815	45	75	Os06g0715300|mRNA|AK121369|CDS+3'UTR	GTCGGTGATCTGTATGTGAAAAGGGTAATTAGTACTGTACTAGTACTTATACTTACTAAC	Os06g0715300	AK121369	Similar to CEL5=CELLULASE 5 (Fragment).
3816	45	76	Os01g0840800|COMBINER_EST|C99566|7	CATGATTCTTCACATTGATCTCTGCTACGTTTGTCTTTGCCGAGTAAAACATTTGCCGAT	Os01g0840800	C99566	Hypothetical protein.
3817	45	77	Os02g0147800|mRNA|AK065257|CDS+3'UTR	AGAGTTAGTTTAACTGTAATCTTTCAGCTGGAACTTTGTTCAGCGAGTAATAGGTCATGG	Os02g0147800	AK065257	Similar to Homeo protein (Fragment).
3818	45	78	Os02g0522100|mRNA|AK100876|CDS+3'UTR	ACGCGTCGCTGATTGAGTTGCCTTGTACCTTTAAAAAGGAACTCTCTTGTCTGAGAGAGA	Os02g0522100	AK100876	Conserved hypothetical protein.
3819	45	79	Os01g0187000|mRNA|AK064094|CDS+3'UTR	ATCACGAATGTAGGCTTTTAGTTGTGTACTGATTGTCTGCAATAGTTATGTACTGTTGAG	Os01g0187000	AK064094	Conserved hypothetical protein.
3820	45	80	Os05g0202300|mRNA|AK109150|CDS+3'UTR	GCTAGTCAATGTGTACGTGGACGATGGTGAAATATTTTTCCATATGTGAGACTTTTTAGG	Os05g0202300	AK109150	Conserved hypothetical protein.
3821	45	81	osa-miR414|Os11|5'seq	GTTGCCGCTGCCGTCATCCTCATCATCATCGTCCTTGCATGAAACCGCCAGCAAATCCTT			miRNA
3822	45	82	Os01g0829400|mRNA|AK109566|CDS+3'UTR	GTGTGTGACAGTGCCCAATTGAAACTTCCAAGTTCTTAGCATTTGCTAACCAACGTTTCT	Os01g0829400	AK109566	Glutaredoxin domain containing protein.
3823	45	83	Os03g0197300|mRNA|AK102651|CDS+3'UTR	CCTTCCAAGAACCCGCCTGTAAACGGTTAAGTAAGCTGTTAATGTGTATAAACGTAGCTT	Os03g0197300	AK102651	Cupin, RmlC-type domain containing protein.
3824	45	84	Os07g0612400|mRNA|AK119994|CDS+3'UTR	TACTTGATCTAAGTTGTACATTGTCTTATGGCACAGGGTAAAACTTGTACCTTTTGAGAT	Os07g0612400	AK119994	Alpha/beta hydrolase family protein.
3825	45	85	Os01g0117700|COMBINER_EST|Os01g0117700|8	GTTTTTCTCAGCTGATAGCCATCCTGTGCTGCAAGACTCAGGACATGCTGGCATAATATA	Os01g0117700		Similar to LRK14.
3826	46	1	ETG10_234183		
3827	46	2	Os03g0176600|COMBINER_EST|CI009945|6	GACTCCTGCGGATGATTATGAAATGGGTGATGCAACAGAGTTGGATCCAAGATCGAAACA	Os03g0176600	CI009945	Conserved hypothetical protein.
3828	46	3	Os09g0455500|mRNA|AK065686|CDS+3'UTR	TGAGAGCCAATACCTTTGATTTTTTGTTACCTCTCTACTCCATATAAGCTTATAGTAAGC	Os09g0455500	AK065686	Esterase/lipase/thioesterase domain containing protein.
3829	46	4	Os01g0949500|mRNA|AK104094|CDS+3'UTR	CATTCTTGTTTCGATTGTTCACCATCTGGAATTCTGGATGTCAGTTAATCTGATCTTAAT	Os01g0949500	AK104094	Similar to Calmodulin (CaM).
3830	46	5	Os05g0122600|mRNA|AK101972|CDS+3'UTR	AAAGCTAGTTAAGTTAATTACTACTGGTTGGTTAGTTGGTTTTGCTGCTGTGGTCGCAGT	Os05g0122600	AK101972	Prefoldin domain containing protein.
3831	46	6	Os02g0153300|mRNA|AK121860|CDS+3'UTR	CTGCTTTTGCAATTTGCATCCTCCCTCGATTATGTGATTGTTCAATTGGTATTAAACAAT	Os02g0153300	AK121860	Conserved hypothetical protein.
3832	46	7	Os03g0718000|mRNA|AK105178|CDS+3'UTR	TGTCGGACATGCAAACTTCTACGTCCTATATTATCAGTTGTTCAGTTTGTATCTCAGGCT	Os03g0718000	AK105178	Similar to Anthranilate synthase beta chain.
3833	46	8	Os01g0849100|COMBINER_EST|Os01g0849100|8	CAATTGATCTAGTTAATCCTGAAGTAATGGGGGTGATAATCAGCGGTGGTAAGATGATCG	Os01g0849100		Protein of unknown function DUF315 domain containing protein.
3834	46	9	Os04g0613800|mRNA|AK072038|CDS+3'UTR	CTCAGGGTCACTGCTCTGCCAGCACAAAGACCCTTCATGTGTATTACTACTACATGTAAT	Os04g0613800	AK072038	Methyl-CpG binding domain containing protein.
3835	46	10	Os06g0216800|mRNA|AK068112|CDS+3'UTR	CTGTTAAAGCCGAGACATTGAACTGAACAGCACGGTTTCCACTTTTCAGACTTTGCTGCA	Os06g0216800	AK068112	Similar to Cyclophilin-40 (Expressed protein).
3836	46	11	Os07g0661100|COMBINER_EST|CI343604|6	CATGAGATCTGAGGTGTGGCCTTATGAGGTTGCTACGATAGAGTTCCTGAAGCTTTTGAT	Os07g0661100	CI343604	Glycosyl transferase, family 4 protein.
3837	46	12	Os04g0691100|mRNA|AK100269|CDS+3'UTR	AGAGACCACTAGATGATGGATGTAACTGCAGGGTATGTTCAGGCACAATCACCATTTTAC	Os04g0691100	AK100269	Serine/threonine-protein kinase SAPK5 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 5).
3838	46	13	Os08g0314500|COMBINER|CI164552|6	GTGTTCGCTAGATGTGGCGAACCATTGTATATTCGGGAATCTGCCGCAAACCCTTTTATT	Os08g0314500	CI164552	(No Hit)
3839	46	14	Os02g0827500|COMBINER_EST|C98891|7	TCAGATGTATAGCTAACTTTCCTGGACGGTATGCATGCATGATTTAATTTTTGATGTGGA	Os02g0827500	C98891	Conserved hypothetical protein.
3840	46	15	Os02g0817200|mRNA|AK104007|CDS+3'UTR	AAGTGTTTCGCGGTATTCTGTGTAAAATAACCACACGTGGAATTCACCCGAATGCTTTCA	Os02g0817200	AK104007	WD-40 repeat containing protein.
3841	46	16	Os09g0450600|COMBINER_EST|C98224|7	GAGGATGGCGTGCACCGAGGAACGGATCGAATGTATGTTTGTTAATTAATCTGACGAAGG	Os09g0450600	C98224	TB2/DP1 and HVA22 related protein family protein.
3842	46	17	Os12g0448900|mRNA|AK100592|CDS+3'UTR	ATTAAATATGGCTGGGAAAATAAGTAGGAGGAGACCATATAACATCTTCCTACAATCTTC	Os12g0448900	AK100592	Similar to Pathogen-inducible alpha-dioxygenase.
3843	46	18	Os10g0565100|COMBINER_EST|CI060434|6	ATGTATTGTTGCTCATTACATTGTTCACGCCCTTTGGAATGTGATTTGTACCTTGGTCAA	Os10g0565100	CI060434	Similar to Metacaspase 1.
3844	46	19	Os10g0561900|mRNA|AK060104|CDS+3'UTR	TATCTGTAATAAGTTGACTTCTACATGTACAGAGGTAAATGACAAGGTATCTCAAATCGC	Os10g0561900	AK060104	Dual specificity protein phosphatase domain containing protein.
3845	46	20	Os03g0222700|mRNA|AK109454|CDS+3'UTR	GTTAAAATGAGTAAAATGACTATGTAATTCTTGGTAATGTGGATCATGGAAATCGCACGG	Os03g0222700	AK109454	"Heat shock protein DnaJ, N-terminal domain containing protein."
3846	46	21	Os12g0635400|mRNA|AK063156|CDS+3'UTR	AGAAGAAGCTAAGATAAGCAGAGTGAGAGAGAGGAGGAAGAAGAAGAGAGGGCAGAGCAG	Os12g0635400	AK063156	VQ domain containing protein.
3847	46	22	Os06g0726900|COMBINER_EST|CI258024|6	AATTAAGTCTCTATACTATGCTATGGTAAATGTATAAGAGAAGTCGTTGTTGAGTTTTAA	Os06g0726900	CI258024	Similar to Arm repeat containing protein.
3848	46	23	Os06g0680500|mRNA|AK099745|CDS+3'UTR	TTTGGGAATGCCATGAACTGTGAAAAGTGTATCTGTTTAGGTGCTTCTCTGAAGCACATG	Os06g0680500	AK099745	Similar to Glutamate receptor 3.4 precursor (Ligand-gated ion channel 3.4) (AtGLR4). Splice isoform 2.
3849	46	24	Os04g0280800|mRNA|AK064967|CDS+3'UTR	AACTAATTCAAGAAACGGCTCAGAGAATCGAGCGAATCGGGCGGAGGAATCGGCAGCGGT	Os04g0280800	AK064967	Non-protein coding transcript, putative npRNA.
3850	46	25	Os04g0118500|COMBINER_EST|CI039748|0	CGACCCGCTTTTGTTTCGACATTTGAGCACATGGTATGGCATGTTTCCGTGATGAACATT	Os04g0118500	CI039748	Similar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (MdPin1).
3851	46	26	Os04g0519100|COMBINER_EST|Os04g0519100|8	GTCGTATCCTGAGTTTGTTATGGAGTTCGACCGCCTTCTGCCGACTGACATCGTGTGGGA	Os04g0519100		Conserved hypothetical protein.
3852	46	27	Os01g0500500|COMBINER_EST|Os01g0500500|8	AGGCAGTGCATCGTAGAGCTCGTGAGAATTAATGATTTGATCTGCCTGTGGCCTTATATC	Os01g0500500		Protein of unknown function DUF632 domain containing protein.
3853	46	28	Os12g0597300|mRNA|AK066276|CDS+3'UTR	CAAACATGATGAGTACCGCACCAAATATGTGATACTCTTGATGTTACATCGCAAGTATGA	Os12g0597300	AK066276	Similar to Mutator-like transposase-like protein.
3854	46	29	Os06g0697200|COMBINER_EST|CI518305|0	CCAATGGTTCAGTTTACTGTACATATGTGAAGTTGTACCTGCTCTAATAAATTGTCTGTA	Os06g0697200	CI518305	DEAD/DEAH box helicase domain containing protein.
3855	46	30	Os01g0922600|mRNA|AK062581|CDS+3'UTR	TGTAGGGGCTAGTTCAGCAGGAACTAGACATAAGTTAACTGTACTTGAATAGTCAAATTA	Os01g0922600	AK062581	Similar to SBP-domain protein 4.
3856	46	31	osa-miR167f|Os10|Mature	TGAAGCTGCCAGCATGATCTGTGAAGCTGCCAGCATGATCTGTGAAGCTGCCAGCATGAT			miRNA
3857	46	32	Os01g0705000|COMBINER|CI550979|x	TGGGATGAAAACTGGGTTAACACCGCTACGTCAGCAAAACCACCCTTCAAAATTGCTAGA	Os01g0705000	CI550979	(No Hit)
3858	46	33	Os06g0228200|mRNA|AK112022|CDS+3'UTR	GTCAGTCTCTTTGGCTTTGTATTAAAAATCAATCTGAGTTAATGAAGGAGCTGAGCTTTG	Os06g0228200	AK112022	Similar to NOD26-like membrane integral protein ZmNIP2-2.
3859	46	34	Os06g0221000|COMBINER_EST|Os06g0221000|8	GGCAATAGTATTCCACTGCCCAGTTGGTCTGAAATCCTACTTGATGAAGAACTCATGGGT	Os06g0221000		Similar to P-type R2R3 Myb protein (Fragment).
3860	46	35	Os01g0740800|mRNA|AK070494|CDS+3'UTR	CGCCTACGCCGCGCTGTCCACGGCGCTCCGGTCGGGGGGTAGCACCGACCACGCTCGCCG	Os01g0740800	AK070494	Conserved hypothetical protein.
3861	46	36	Os01g0311600|mRNA|AJ698082|CDS+3'UTR	ACGATGATGACCATGTAATAAGTACAGTACATTTTGCAATATTGTTACAACCACTGGTGG	Os01g0311600	AJ698082	Sulfotransferase family protein.
3862	46	37	Os07g0527600|COMBINER_EST|Os07g0527600|8	AAGAACCCACTGCTGTCAGCATCAGTACGTCTCAGGATTACCATGGCCAAGAATTTCTTA	Os07g0527600		Similar to 2-Hydroxyisoflavanone dehydratase.
3863	46	38	Os03g0813700|COMBINER|CI464077|6	ATTATTCCCCTTATGTGTAACACCTTATTTGTGTACTAAGCTTTGCCCTGGAAAACCGCA	Os03g0813700	CI464077	Peptidase C1A, papain family protein.
3864	46	39	Os01g0124400|mRNA|AK099279|CDS+3'UTR	TCTCGTGTGAACGATGGTCTAGCCAGTGACCAAGAGCAAAATAAATGAATAAATGTTGCC	Os01g0124400	AK099279	Similar to Bowman Birk trypsin inhibitor.
3865	46	40	Os03g0448500|mRNA|AK069598|CDS+3'UTR	CAAGGCTATGATATCCTTTATGTATTGAAATTACCATCCTACATGTTCATGGCTCCTTTT	Os03g0448500	AK069598	Similar to Aldehyde dehydrogenase family 7 member A1 (EC 1.2.1.3) (Antiquitin 1) (Matured fruit 60 kDa protein) (MF-60).
3866	46	41	Os05g0516400|mRNA|AK068854|CDS+3'UTR	GGTAAGTGGTATAATTGTACATGCGTAAAAGTGGCTAATAGTGGATGAATTTTTCAGCTC	Os05g0516400	AK068854	Similar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor.
3867	46	42	Os04g0416400|COMBINER_EST|Os04g0416400|8	TGATTCAGCATTCTACCATTAACAACCTTGCTATTGGCCGTAGCGTGGATGAGACGCTTA	Os04g0416400		Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen domain containing protein.
3868	46	43	osa-miR445a|Os07|Mature	TAAATTAGTGTATAAACATCCGATTAAATTAGTGTATAAACATCCGATTAAATTAGTGTA			miRNA
3869	46	44	Os01g0869800|mRNA|AK058284|CDS+3'UTR	GACGTACCTTGTTTAATTAGTTGTTAATTAATGCCCATGGAGAAAATTAACGTGAGATTT	Os01g0869800	AK058284	Similar to Photosystem II subunit PsbS.
3870	46	45	Os12g0104800|mRNA|AK058259|UTR	GGAACACCATTGTCTGTATGTTACTTGTTTACGGTCTCATGTCCAGCTGTTTGAATTTTG	Os12g0104800	AK058259	Similar to Clathrin heavy chain.
3871	46	46	Os08g0159500|mRNA|AK111759|CDS+3'UTR	TAGTGCTCAAAATTCGTCGAATCGTCTGTATGACCGAACAAGATTGACATATTATATACA	Os08g0159500	AK111759	Similar to Zinc-finger protein Lsd1.
3872	46	47	Os04g0536800|COMBINER|AU077425|6	AATTTCTAAGATTATTGGATTTTTGGTCTAAAGGAAAAAGGATTTATTTAAATCCTTTTT	Os04g0536800	AU077425	(No Hit)
3873	46	48	Os01g0313000|COMBINER|CI222854|6	TTCCGAGGCCTTCGGGCCCCCTTCTTGTATAGACTGATTTAATCTGTAATCAAATAAAGA	Os01g0313000	CI222854	(No Hit)
3874	46	49	Os03g0841900|COMBINER_EST|Os03g0841900|8	TCGCAAACACGCTAGTCTCCGTGTCACAACATTCAGAGCTTCTTGATGCTGTTGGAATTT	Os03g0841900		Amine oxidase domain containing protein.
3875	46	50	Os06g0652300|COMBINER_EST|Os06g0652300|8	ATCCAGGACCTCTACCGCTTCTACCTGCGTCACGAGTGCGGCGGCCAAGCTCATCATGCA	Os06g0652300		Similar to GDP-4-keto-6-deoxy-D-mannose-3, 5-epimerase-4-reductase (GER1); 21556- 22494.
3876	46	51	Os07g0254900|COMBINER_EST|CI280619|6	ACCTCATCTTCCGACATCAAGGAAGTCCCCTTGTTCAGTTTAGTTGGCCACTATCGATTT	Os07g0254900	CI280619	Hypothetical protein.
3877	46	52	Os03g0401900|mRNA|AK120311|5'UTR+CDS	GCAGATGCGGGCGACGACGGCGGAAGGGATGCAGGGCACGGCGTGGTGGATGCGAGCGAG	Os03g0401900	AK120311	Non-protein coding transcript, unclassifiable transcript.
3878	46	53	Os01g0920100|mRNA|AK069808|CDS+3'UTR	GTGCTGTATCCATGTTAAATCAACTGTAAGGTGAGGATATCTAGCTCAAGAAATGATCAT	Os01g0920100	AK069808	Conserved hypothetical protein.
3879	46	54	Os06g0348800|mRNA|AK065184|CDS+3'UTR	TATTGGCCGTGAGTTCTCAGCAGCTAAGAATAAATTAAATAATGGTCCTCCGAGTAGGGT	Os06g0348800	AK065184	Homeodomain-like containing protein.
3880	46	55	Os01g0225300|COMBINER_EST|CI395068|6	TGGCTGTGTGCATAGAATTTTTTATCAATGTATGTAGAGCAGAGTCCAGAAAGCAAGAAA	Os01g0225300	CI395068	Hypothetical protein.
3881	46	56	Os02g0158400|mRNA|AK104768|CDS+3'UTR	TTGCAAAATGGTGGAGTCTTACAAAACTACTCAAACGTAGTTGAGTGGTTATGGCTTTAA	Os02g0158400	AK104768	ssDNA-binding transcriptional regulator family protein.
3882	46	57	Os03g0263800|mRNA|AK061795|CDS+3'UTR	CAACAGTCTATTGTTAAACTGTACCACTAGTATGGACCAACATGAGATGCCACTGGATCG	Os03g0263800	AK061795	Zinc finger, RING-type domain containing protein.
3883	46	58	Os04g0515300|mRNA|AK121631|CDS+3'UTR	GTGTTTAGACCTTGTGCCACAAATTCTATTCAGAATCTAAGATAGTATGCCATATGTTGT	Os04g0515300	AK121631	Ribosomal protein L14 domain containing protein.
3884	46	59	Os04g0448800|mRNA|AK069397|CDS+3'UTR	TCCATTCAATATACCACTGTATCATATCTCTCTATTGTGCTAGTATTAATGAAGCTGTCG	Os04g0448800	AK069397	Similar to Mitochondrial phosphate transporter (Fragment).
3885	46	60	Os08g0151700|mRNA|AK073149|CDS+3'UTR	GCCCTTTGGCTAAGTCTGAAACCTATTTGGGTTTCATTGTACTGCCAACTACTCCAGCAA	Os08g0151700	AK073149	Zinc finger, RING-type domain containing protein.
3886	46	61	Os10g0521000|mRNA|AK108163|CDS+3'UTR	TTTTTTGTAACTTGCCCTTTGCTGTAACTCGTATCAAAGCTCAAAGCAAGAAGAATCTTC	Os10g0521000	AK108163	Similar to TRE1 protein (Fragment).
3887	46	62	Os08g0531700|mRNA|AY551921|CDS+3'UTR	TTGAACTAGTTTCGTATGTAGCCTGTTTGTGTGTAACTTGTGTGAGATACTACCTTAAAA	Os08g0531700	AY551921	Similar to Developmental protein SEPALLATA2 (Agamous-like MADS box protein AGL4).
3888	46	63	Os05g0453700|mRNA|AB110169|CDS+3'UTR	TGCTTGTGTGCTCAACCATGTGAATCACTTTATATATATAGACCGAATTTGAGGTTTTAC	Os05g0453700	AB110169	Similar to ENOD18 protein (Fragment).
3889	46	64	Os12g0104800|mRNA|AK058226|CDS+3'UTR	ATCATCCACTTGTGAAGAGTTCATTTAGATAAGAATTTCAATTTACACAGAAGAGGAGGC	Os12g0104800	AK058226	Similar to Clathrin heavy chain.
3890	46	65	Os12g0595800|mRNA|AK101874|CDS+3'UTR	GCCTAGTTCTAAGACATGGCAAAGTATTTCATATGCCGAATTGAAAAAACGTTTGCTGTA	Os12g0595800	AK101874	Protein kinase-like domain containing protein.
3891	46	66	Os12g0507500|COMBINER_EST|CI262497|6	GATATGAATGGTGCCTTGTGCTGGTTTAAGAATGGTGAACGTGTTCTTGGAACACACATC	Os12g0507500	CI262497	Similar to SWIb domain-containing protein (Fragment).
3892	46	67	Os03g0211900|mRNA|AK121380|CDS+3'UTR	AGCACATTTGCATGGCACCGACAGTCCTGGTGTAATGTAACCAGTGTGCTCAATGATATT	Os03g0211900	AK121380	Leucine rich repeat, N-terminal domain containing protein.
3893	46	68	PGmControl0002|mRNA|AF035254|3'UTR		
3894	46	69	Os06g0163600|COMBINER_EST|CI275854|6	TGTTAAATTGTGGTTTCCTTTGACTATGCTGCGACGCCGCGAGACACTCATGTAAGTGTA	Os06g0163600	CI275854	Hypothetical protein.
3895	46	70	Os10g0364600|mRNA|AK109451|UTR	ATATCAAGTCATCAACAAACAAAGAGGATATGGCAAGAAGAGAAGAGAGAGACCGTATCC	Os10g0364600	AK109451	Hypothetical protein.
3896	46	71	Os02g0781700|mRNA|AY224477|CDS+3'UTR	TGCCAAAACATTGTAGTACACTCAATTATATGATGATGTAATTCTATCGAGATCCTCCAC	Os02g0781700	AY224477	Conserved hypothetical protein.
3897	46	72	Os01g0707500|mRNA|AK106119|CDS+3'UTR	CGCACAACGTACGCGTGGTCTCGTCGTCTATATACATGTAGTAACATGCTGCTGTTTTCT	Os01g0707500	AK106119	Similar to Transcription factor LAX PANICLE.
3898	46	73	Os08g0324800|COMBINER|CI512902|6	AATCAACCTCAGTTGAAGAAAAAGGATCCGAAGGAGAAGACATTTGGCTTATACCCCAGT	Os08g0324800	CI512902	(No Hit)
3899	46	74	Os07g0599100|COMBINER_EST|Os07g0599100|8	CGATGAGGTCAAGGACGGATCCTCCTTTAGATCACATGGGAAACCTACTATCTTCATCTT	Os07g0599100		Disease resistance protein family protein.
3900	46	75	Os09g0459800|mRNA|AK070246|CDS+3'UTR	GGGATCATCTAACTATCTAAGCACACATAAGGATGTGCTTGCAAGTTGCAATCCAGGCCT	Os09g0459800	AK070246	Similar to ARP protein.
3901	46	76	Os06g0176000|mRNA|AK059984|CDS+3'UTR	GAACCCTTCTTAGTGATTATATGGTTATATTGAGTATATTTATAGAGCCCAAATACCTTG	Os06g0176000	AK059984	Proteasome subunit alpha type 4 (EC 3.4.25.1) (20S proteasome alpha subunit C) (20S proteasome subunit alpha-3).
3902	46	77	Os12g0175800|mRNA|AK100895|UTR	CCAATTTCTTACCAGCTTCAAGAAGCTTAGGAGACTCTTGGGTGAGATTAACATGAATGA	Os12g0175800	AK100895	Non-protein coding transcript, uncharacterized transcript.
3903	46	78	Os04g0592300|mRNA|AK059702|CDS+3'UTR	TGGAGCAGAGTCATTTTTGCATCCAATTCTTTCATTGCTGATTCTAAGGACTCGCCCTTG	Os04g0592300	AK059702	Conserved hypothetical protein.
3904	46	79	Os02g0274000|mRNA|AK061802|CDS+3'UTR	CATCCAAATGGACCGTATTATTGCAGGTGTTGAAATTGGAATGCTTTTTGGAATGTTGAA	Os02g0274000	AK061802	Conserved hypothetical protein.
3905	46	80	Os10g0554800|mRNA|AK063684|CDS+3'UTR	TGTCTTGTTTTAGTTTCACTGTTTCGGATTCAAATTTAAGATGGAACCTGAACAATCCAG	Os10g0554800	AK063684	Similar to ExtA.
3906	46	81	Os02g0226000|mRNA|AK121976|CDS+3'UTR	GTTATGACTTATGATGAACCCAAAGTATGATTTGATATCTATGGATGAGCTTGGCCTGCC	Os02g0226000	AK121976	Similar to Peroxisomal membrane protein PMP22 (22 kDa peroxisomal membrane protein).
3907	46	82	Os04g0197500|COMBINER|CI419862|6	ATTGACGGGTTTATACAGCAGCTTATTTTCCACGTCGCTGATGGCAACTCTGATACTGCT	Os04g0197500	CI419862	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
3908	46	83	Os03g0845800|mRNA|AK109535|CDS+3'UTR	CCAATGCTTCTTTTTCCCCCCTTTTTCAGGTTAATTCCAGTGGCCAGTTTGTAGGAATAT	Os03g0845800	AK109535	Hypothetical protein.
3909	46	84	(+)E1A_r60_a97		
3910	46	85	Os10g0124500|mRNA|AK101708|CDS+3'UTR	TAGCCGTCGCTGTTTGAGGTTACTCCAGCATTTGTAGCTCTCTGACAACATTGTTCTGTT	Os10g0124500	AK101708	Cyclin-like F-box domain containing protein.
3911	47	1	Os01g0316100|COMBINER_EST|Os01g0316100|8	AAGGACTTCGTGATCGACTTCCTCGGCGGCGAGTTCGGCGACGACGTGGTGGTCGGGGCC	Os01g0316100		FAD dependent oxidoreductase family protein.
3912	47	2	Os03g0146100|mRNA|D25534|CDS+3'UTR	TGCATGCATTTGCCTGAGTTCCTTCGTTTTTTCCTAGTCAAATTCGATCGCTATTCGCAA	Os03g0146100	D25534	Similar to Tonoplast intrinsic protein.
3913	47	3	Os09g0406400|COMBINER|CI343198|1	GCCCCAGCTGACAAGTTTAAGTTGATGGATGAATCCTTCAAAGTGGCTGTTATGCAGGTA	Os09g0406400	CI343198	(No Hit)
3914	47	4	Os03g0836500|mRNA|AK120568|CDS+3'UTR	AGGCATATTGTTTTATGTATTGAAGCTGCGTGCTTAGCTTTTTCTAGCATTATCATTGAC	Os03g0836500	AK120568	Conserved hypothetical protein.
3915	47	5	Os04g0223000|mRNA|AK067177|CDS+3'UTR	ACCTCTTGTTGAATGTGCAAACTTGAACGACACCAGTTATTTCTCTTTCAAATCCACTGT	Os04g0223000	AK067177	Sec1-like protein family protein.
3916	47	6	Os01g0786700|COMBINER_EST|CI414520|6	TTTTTTAGAGGGCATCTACACAACGAAATCCTGTTATTATGAGATACTAGTACTTCAAGC	Os01g0786700	CI414520	Conserved hypothetical protein.
3917	47	7	Os01g0881000|COMBINER_EST|Os01g0881000|8	ATGAAACTGACAGCGCTCTGCAGCTGCAAATAGTTACAGTACCGGACATTGATGCAGATT	Os01g0881000		Zinc finger, FYVE/PHD-type domain containing protein.
3918	47	8	Os07g0237700|mRNA|AK062400|CDS+3'UTR	ACGATTCATTATCATGAATGTTTACAAATACATCAGGGCTCCCACAGGAGTTCGCCTTTT	Os07g0237700	AK062400	Hypothetical protein.
3919	47	9	Os04g0596500|COMBINER|CI358793|6	AGGCTGGCAAACCAAGCAAAACTGCACCTCGTTTTCTTAAGTCAAAGCAGAATGCAGTTG	Os04g0596500	CI358793	(No Hit)
3920	47	10	Os08g0148600|mRNA|AK068714|CDS+3'UTR	AGTAGGTGATAGCTTCGATAACTTTTGGAAATATTTAGAAACAACGTGTAGTTGAACTGG	Os08g0148600	AK068714	Similar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-).
3921	47	11	Os12g0631100|mRNA|AK066784|CDS+3'UTR	AGTCAGATTCGTTTTGTTTGCTTCAATTCAGATCATGCAGTGAGCTTGCTTTTTACATTC	Os12g0631100	AK066784	Ras small GTPase, Ras type family protein.
3922	47	12	Os03g0109700|mRNA|AK100123|CDS+3'UTR	ACTGGTCCTGAAACAAACAAATTTGGTTGTTTAACTAAAAAGAGGAAACAGTCGAGTCCG	Os03g0109700	AK100123	Conserved hypothetical protein.
3923	47	13	Os04g0668700|mRNA|AK062068|CDS+3'UTR	GATGGGTGTGGAGAAGGGCTATTATGCATGTTGATTAACTATGTTAAACAGGTGCTTCTT	Os04g0668700	AK062068	Phosphatidylinositol 3- and 4-kinase, catalytic domain containing protein.
3924	47	14	Os03g0267700|mRNA|AK071979|CDS+3'UTR	ATACTATTGAAAGATGGCCTCCAAGATGATCTGTTTATCCATGTTGTCCTAGTGAGCTTA	Os03g0267700	AK071979	Mitochondrial substrate carrier family protein.
3925	47	15	Os02g0731200|mRNA|AY224482|CDS	ACTCCATACAGCTTTCGTATCATACAAAATGCTAATATGCCTCCTAGTCTTGAATTGAGC	Os02g0731200	AY224482	Transcription factor MADS57.
3926	47	16	Os03g0181800|mRNA|AK058391|CDS+3'UTR	TCTCCGATACTCTTCATGTTTGCTCAATACGAAGTACAAATCTGAAAGCTTTGCAATTTT	Os03g0181800	AK058391	Protein of unknown function DUF936, plant family protein.
3927	47	17	Os07g0582800|mRNA|AK069022|CDS+3'UTR	GCGTGGTGTGGTTGTATTTTCTTTTTCCTGACTGCAGTCTCCCAGGATCGTAATCTTGTA	Os07g0582800	AK069022	Conserved hypothetical protein.
3928	47	18	Os09g0123200|mRNA|AY311344|CDS+3'UTR	GAAACAGCAGGAATTGAATTATACTCAGCTACAGACTCCTGGTGCTATTGATCCCAGTAG	Os09g0123200	AY311344	Paraneoplastic encephalomyelitis antigen family protein.
3929	47	19	Os06g0707800|mRNA|AK099567|CDS+3'UTR	TTTTCACCAATGGATGTGCGATAGCAGAATGGTGCTAAGTGAGTCACATCGTTGAGGCTT	Os06g0707800	AK099567	Similar to NBS-LRR disease resistance protein homologue.
3930	47	20	Os02g0703300|mRNA|AK060227|CDS+3'UTR	AGAAAGTAAAGGTTGTACATGAATTAATTACAGCATCTTAAGACATAGCCGAGTTCGAAC	Os02g0703300	AK060227	Protein of unknown function DUF1218 family protein.
3931	47	21	Os07g0611700|mRNA|AK109158|CDS+3'UTR	TGTGCTGTTTGGATTTTGCCTCAGTCTTTGTAGTACCATAGTCTAAAATCCTAAACTGCA	Os07g0611700	AK109158	Peptidase C1A, papain family protein.
3932	47	22	Os11g0237900|COMBINER_EST|Os11g0237900|8	AAGGAGATTATCAAGTCTGTTATCGGTGACAAAATCAAGATGCTTCCCCATAATCCCAAG	Os11g0237900		Disease resistance protein family protein.
3933	47	23	Os02g0469600|mRNA|AK071907|CDS+3'UTR	GCAATGCTACACGCTATTTGGAGGTAGCTTTAAGTATTATCGCCATTCACGAACTTGTAT	Os02g0469600	AK071907	Similar to Cysteine proteinase 1 precursor (EC 3.4.22.-).
3934	47	24	Os06g0553200|mRNA|AK121675|CDS+3'UTR	GTGCTTAGTTGCATGCTTTGTTTGCTTTTCTTAGTTTCTTGGCGATGTACTTATTAAGAG	Os06g0553200	AK121675	Conserved hypothetical protein.
3935	47	25	Os01g0723700|COMBINER_EST|CI542998|3	GATACATCTTCTGATGACAGAAGAAGAAGAAATTACCCCAAAACTTGTTAAGTGGCACTG	Os01g0723700	CI542998	t-snare domain containing protein.
3936	47	26	Os06g0184900|mRNA|AK109842|CDS+3'UTR	TAATTAAGCCGAATTTATAACGATTTTGTTAAAAATATATTGATTTTTCCCGAAAAAAAA	Os06g0184900	AK109842	Transferase family protein.
3937	47	27	Os02g0245100|mRNA|AK111709|CDS+3'UTR	GGGCATAGGGAGATATGTGAAGCACATTAAAATCTATAATGTATACAATTCTGTTTGCAG	Os02g0245100	AK111709	Similar to Peroxisomal targeting signal type 2 receptor.
3938	47	28	Os03g0409100|mRNA|AK120517|CDS+3'UTR	TTGCACGCTGAAAGCTTATATTTTCGATCCGGATTCAGATTCGGATTCAAATGTTTTGAT	Os03g0409100	AK120517	Conserved hypothetical protein.
3939	47	29	Os10g0438800|mRNA|AK063228|CDS+3'UTR	GCTTATGAGATGAAATGGCCAATCTCTACCTGTCCTGGTGGTAGAGCAAAACGGCATGGC	Os10g0438800	AK063228	Similar to RING-H2 finger protein ATL2E.
3940	47	30	Os07g0663300|mRNA|AK070340|CDS+3'UTR	ATTTGGTCAAGCATAAGGTAGTTCCGACATTCGATTATGGAACAAATATGTTATAGACTC	Os07g0663300	AK070340	Similar to RNA-binding protein BRUNOL5 (Fragment).
3941	47	31	Os06g0528600|mRNA|AB098063|CDS+3'UTR	TGTACAAATGTATATTGTCACAGCACTGATGTGTTTATTATATGGATGTGGAGTGAATCG	Os06g0528600	AB098063	Aminopropyl transferase.
3942	47	32	Os11g0168100|COMBINER_EST|CI486963|0	AGCAGACAGCTTAAGTACATTGCATGTAATTGTGTCGGTAGTTTGTTCCTTCTGAAATTG	Os11g0168100	CI486963	Similar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1).
3943	47	33	osa-miR439g|Os08|5'seq	TCCTGTCGAACTGACGCAGTTCGACATGTACCTGTCGAACTGTGGTTGTTCGATAGGTAT			miRNA
3944	47	34	Os04g0681900|mRNA|AK105775|CDS+3'UTR	CAATGTTGGCCAGGTCTGTAAATCATGGGCACCTAATTTCTGAATGAGCATGATCGGACT	Os04g0681900	AK105775	Similar to Acyl-CoA binding protein.
3945	47	35	Os07g0632700|mRNA|AK060066|CDS+3'UTR	CGTGCGCCCTAGCTTTGTCCAGTTGAAAGTTGGAACAGTTGTAAAATGTCATCAGGTTGA	Os07g0632700	AK060066	emp24/gp25L/p24 family protein.
3946	47	36	Os06g0111500|mRNA|AF486280|CDS+3'UTR	GGAGCAGCCCAGGGTGGAGAGAACATGGATATTTATCATTGGAACCTTTGTTGTGATCTT	Os06g0111500	AF486280	Cytosolic 6-phosphogluconate dehydrogenase.
3947	47	37	Os12g0106200|mRNA|AK109211|CDS+3'UTR	TCTTTGTGCTTGTTGTCTTCTCTTACGTAATTTCCGGAAAGAATGAAAATGAAGAACAAC	Os12g0106200	AK109211	Similar to LOB domain protein 4.
3948	47	38	Os10g0451900|mRNA|AK064070|CDS+3'UTR	AGTGGTAATGTAAACTACTATGTAATGTTACTGGTGCAATGAATAACCTCTTGCCTTATG	Os10g0451900	AK064070	Conserved hypothetical protein.
3949	47	39	Os03g0223000|mRNA|AY224516|CDS	CCGCCGCTCCAGCCTCGGCGACCGTCCGGCCACCGACAGCGCCGGCGAGGGCGAGGAGCC	Os03g0223000	AY224516	Similar to Atypical receptor-like kinase MARK.
3950	47	40	Os07g0656200|mRNA|AK068499|CDS+3'UTR	TCAATACAGATTTGTTCATCAGAACCGTAGGCTATTTGTACAATAAAGAGCTGACAGAAG	Os07g0656200	AK068499	Similar to Beta-glucosidase.
3951	47	41	Os04g0387600|mRNA|AK063862|CDS+3'UTR	GTACTAGTACTACTAATTTGGTGCTGTACTACTGTGATATTGTTTCAGTGTTTTTGGTTG	Os04g0387600	AK063862	Conserved hypothetical protein.
3952	47	42	Os05g0184000|COMBINER_EST|Os05g0184000|8	TGCGAATGCGCAGAGAGGAGGATGGCAGTGGCAGTGGCAAGGTGTTGACGGTCATTACAT	Os05g0184000		Conserved hypothetical protein.
3953	47	43	Os08g0131000|mRNA|AK100132|CDS+3'UTR	GGGTGAACAATAGATCCTTTCTTTTCTGAGGGTAACAATTAGATAGTATTGTAGTTCATG	Os08g0131000	AK100132	Protein prenyltransferase domain containing protein.
3954	47	44	Os02g0198800|mRNA|AK105560|CDS+3'UTR	GCAGGATGTTTGGATCGATTTGTTTACATGAAATCAAAAAAGCTTATTCGTTTTTTTTGC	Os02g0198800	AK105560	Protein of unknown function DUF868, plant family protein.
3955	47	45	Os09g0551300|mRNA|AK073242|5'UTR+CDS	AAACGGAATGGCCCTGGCAGTGGTAAAAAAGAAACACACAACGAAAAAGAAGAGCCTACA	Os09g0551300	AK073242	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein.
3956	47	46	Os11g0256300|mRNA|AK066271|CDS+3'UTR	GGGTGAAGTATTTGCAGCAAGATGGGTGTTGTGGTGTTTTGTAATGAACTTTGTCAGGTT	Os11g0256300	AK066271	Zinc finger, GRF-type domain containing protein.
3957	47	47	Os02g0805200|mRNA|AK071591|CDS+3'UTR	ATGTTAGGTTTAGTAGATTTGTGAGTTTATGACTGCATTGCTGTAGCATGATTGTGCTGC	Os02g0805200	AK071591	Proliferating cell nuclear antigen (PCNA) (Cyclin).
3958	47	48	Os05g0226900|mRNA|AK100217|CDS+3'UTR	ACATTCTATTGTCTATTGGCATTATTCTCATTGTAAAATCTTTTGGTAATATTATTTGTC	Os05g0226900	AK100217	Conserved hypothetical protein.
3959	47	49	Os06g0717100|mRNA|AK071437|CDS+3'UTR	GCTGATGATGTACTACCACTTTTGTGCTGAATGATGCAATGTACGGAAATCTGTGGTGTT	Os06g0717100	AK071437	Senescence-associated family protein.
3960	47	50	Os03g0165900|mRNA|AK063721|CDS+3'UTR	GTTGTGTACTTATGTAGAGTTGATAAGTGCATGGCTTGGTGAAGGATATAAATGTGTACA	Os03g0165900	AK063721	Tetratricopeptide-like helical domain containing protein.
3961	47	51	Os07g0661800|mRNA|AK107041|CDS+3'UTR	TTCAGATAGCTTAATTACCATCTTATCGTAGTATCGCCTGTGAAATCCCAAACATGTATA	Os07g0661800	AK107041	Similar to Nucleolar protein.
3962	47	52	Os08g0332700|mRNA|AK067028|CDS+3'UTR	TTGCCCATTTTGGTTCTGAATGTCTTACATTTCAAAGTCCTGATCAAATTTTTATGGACC	Os08g0332700	AK067028	Pentatricopeptide repeat containing protein.
3963	47	53	Os09g0506700|COMBINER_EST|Os09g0506700|8	CGAAAAGTTCCCTCGACAGTTAAATTAGCTGTTACGAAGCCTTGCAGCCGTTGTCATGTT	Os09g0506700		Cyclin-like F-box domain containing protein.
3964	47	54	Os06g0276300|mRNA|AK105315|CDS+3'UTR	TAGCAGTAGCAGCTCATGTCCGTCTTATGCTACCATGTGTCGAATCGATTTACCGTTGAT	Os06g0276300	AK105315	NB-ARC domain containing protein.
3965	47	55	Os01g0503700|COMBINER|CI046962|6	CCCTCCTAGTTCGAATCTAATATCATCTATGTAACCGCAATGCAAATAATTGTATCATGT	Os01g0503700	CI046962	Similar to mutator-like transposase [Oryza sativa (japonica cultivar-group)].
3966	47	56	Os12g0620400|mRNA|AK063843|5'UTR+CDS	TCGATAGCCCAGAAGGGGAGAAGATCCCGAAACGTTCTAGGAACTCATCTGGCAGAAAGG	Os12g0620400	AK063843	Methyl-CpG binding domain containing protein.
3967	47	57	Os03g0582900|mRNA|AK062644|UTR	GGAGAAGCTTAGCAAACCGTTTCTTCAGCTATGAAATGATAAATCAAAATAAACAGAGTG	Os03g0582900	AK062644	Non-protein coding transcript, uncharacterized transcript.
3968	47	58	Os04g0612600|mRNA|AB042115|CDS+3'UTR	ACTCTGAACCCCTGCTGTATAAACAAATATAATGTAGAATCTTGAATGGTGACGTTTGTG	Os04g0612600	AB042115	Similar to Coatomer-like protein, epsilon subunit.
3969	47	59	Os04g0414100|mRNA|AK101471|CDS+3'UTR	TGAAATGTCAATATACTTTCCACTGTATGGAGTGATAACAAAATAAAATTCACTTCTTCC	Os04g0414100	AK101471	Ovarian tumour, otubain domain containing protein.
3970	47	60	Os06g0149400|mRNA|AK071177|CDS+3'UTR	TTAAGTTTGTGTAATTATCTGGAATCTGCCGGTGGAACTTTTACTAGTATTCATTTGAGC	Os06g0149400	AK071177	Similar to Chitinase A.
3971	47	61	Os03g0339400|mRNA|AK065305|CDS+3'UTR	TTCTTTGATTTTCATTTCCTCTTGTAATAGTGATGAGTTCAAAAGTTAAATGCACTGAGT	Os03g0339400	AK065305	Haem peroxidase, plant/fungal/bacterial family protein.
3972	47	62	Os01g0919800|mRNA|AK066552|CDS+3'UTR	GTATCGAGTTCTATGGAATACTTTTAACACGTTATGTAACAAGAATGTATACTTATTCTG	Os01g0919800	AK066552	Similar to Efflux carrier of polar auxin transport.
3973	47	63	Os03g0825500|mRNA|AK058472|CDS+3'UTR	GTCGGACAAGGAAAGTCATGTAGAAAACAAGGTTCAAACTTTTTAGGTTGGTATTTTTAG	Os03g0825500	AK058472	Bacterial transcription antitermination protein NusG family protein.
3974	47	64	Os06g0346600|mRNA|AK061139|UTR	TTGGTGTCATTTCAAATTTGTATGTATGCACTATTCCCACAATTCCTAGCTGAGCTATGT	Os06g0346600	AK061139	Non-protein coding transcript, uncharacterized transcript.
3975	47	65	Os05g0157200|mRNA|AK065771|CDS+3'UTR	TTGTACTTTGTGCTTGCACTCTCTGAGCCTGACTATGAAATGGATCCTGCTGTTTTTCTT	Os05g0157200	AK065771	Universal stress protein (Usp) family protein.
3976	47	66	Os01g0514300|mRNA|AK121086|CDS+3'UTR	TCCTAGGTCAAACTTTCTGTATAGAAAACAGGTAAATCATGTTGTACATTCTGATCAGAG	Os01g0514300	AK121086	Lissencephaly type-1-like homology motif domain containing protein.
3977	47	67	Os07g0160000|COMBINER_EST|Os07g0160000|8	TTGGATGGGCATCAGAGCTTTATGTGCAACAAGGTGTCCTGGACAAACTGTGTTCTGAAT	Os07g0160000		Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
3978	47	68	Os06g0185200|mRNA|AK109116|CDS+3'UTR	CGGCGAGGTCTCGGTCTCGTTCACGTTCACGTTGATCCGTGTGCCGCGCGCTACGTTTTT	Os06g0185200	AK109116	Transferase family protein.
3979	47	69	Os01g0204000|mRNA|AK067829|CDS+3'UTR	CATCCATGACATACCAGGTCAACCTCATGTAGAAAGTTAAAAACAAACAGTCATCTGTTA	Os01g0204000	AK067829	Conserved hypothetical protein.
3980	47	70	Os05g0145900|mRNA|AK061196|UTR	GTGTATCATGCATGGATGTTTCAGGAACATTGGGTTAATTGTGTTGAGTATATAGTATTG	Os05g0145900	AK061196	Conserved hypothetical protein.
3981	47	71	Os06g0632700|mRNA|AK101148|CDS+3'UTR	CTCAGGCAAGGAAAGGAATATATATAGACTGTAGTTACTTGAAAAACCTTTGTCAGAGTA	Os06g0632700	AK101148	Ferritin/ribonucleotide reductase-like family protein.
3982	47	72	Os04g0466700|mRNA|AK119336|CDS+3'UTR	CACCGAAAGGTTTACATTTCAACCTACATGTCCATGTAAGAATCCCGATGTAAATGTAGA	Os04g0466700	AK119336	Armadillo-like helical domain containing protein.
3983	47	73	Os03g0659300|COMBINER_EST|CI428984|4	ACTGAATGAACTGCTCCATGCTGTAATATAGCTCTATATGTTACTGGATTGCACTAAAAT	Os03g0659300	CI428984	Glyoxalase/bleomycin resistance protein/dioxygenase domain containing protein.
3984	47	74	osa-miR394|Os02|3'seq	ACAGAAATCTCATATCTGTTGATCTTGGAGGTGGGCATACTGCCAATGGAGCTGTGTAGG			miRNA
3985	47	75	Os02g0169400|mRNA|AK106247|CDS+3'UTR	TAGCAGCTGTAGGATTACTGATAAACATTGTTCCTGTACCGATACTTTAGAAGAAATGAA	Os02g0169400	AK106247	Similar to Argonaute 4 protein.
3986	47	76	Os11g0704100|COMBINER_EST|CI108015|6	TGATTTGTTAAGCTTACTTATATAGCTACATATTCTACTAGCTCCTGCATGCACTGAAAG	Os11g0704100	CI108015	Disease resistance protein family protein.
3987	47	77	Os12g0409600|mRNA|AK105494|CDS+3'UTR	GCTCTTGCCAAGCTGAATAATGTGTGTATTCAAGACTTCAAGGTTAATGCATGAATGTTT	Os12g0409600	AK105494	Hypothetical protein.
3988	47	78	Os02g0619600|mRNA|AK072178|CDS+3'UTR	TTCTGCTGTCGCCTTGCCGTGAATTGCAAGTATTATCCACTACATGCACGTCCTTACTTT	Os02g0619600	AK072178	Zinc finger, RING-type domain containing protein.
3989	47	79	Os02g0662700|mRNA|AK120317|CDS+3'UTR	TCAAATGGTTGTGTGGTACAGAATTAATATTATACTGCTGTTGCTCTGTAATTCTTTGGG	Os02g0662700	AK120317	Similar to Scl1 protein (Fragment).
3990	47	80	Os02g0125300|mRNA|AK061564|CDS+3'UTR	ACACATCTTCATTTGCGACTAATTTGTTTGCCTTTTGGTGATTGATGATGATCCTTTCCC	Os02g0125300	AK061564	Bax inhibitor-1 (BI-1) (OsBI-1).
3991	47	81	Os03g0195800|mRNA|AF493792|CDS	TGTGATCCTGAAGCTCCGATCAGCGAAATTCACGGATCTCATCGGTGAAGACAAGATATT	Os03g0195800	AF493792	Similar to Sulfate transporter (Fragment).
3992	47	82	Os08g0560000|mRNA|AK107117|CDS+3'UTR	TCGATCCATTCTTAATTGGATCATCTCTACACTATAATTAACTGGATCGGAGTACTCCTG	Os08g0560000	AK107117	2OG-Fe(II) oxygenase domain containing protein.
3993	47	83	Os03g0810400|COMBINER_EST|Os03g0810400|8	ACCCGTTCGGGCCACAAGGTCACACATGCTACCCACACCGCCCGGGTTGGCCGCCGCCGC	Os03g0810400		Hypothetical protein.
3994	47	84	Os06g0134400|mRNA|AK108212|CDS+3'UTR	ATGTTTCTGAGGATTGATGGTTCCCCAGACACTTTCTATAATGAGGTGATGATCAATCAC	Os06g0134400	AK108212	Conserved hypothetical protein.
3995	47	85	Os01g0310700|mRNA|AK120861|CDS+3'UTR	AGCCAGAGGGGAGGAGAGGAGAGGGGAGGGGGCCGGAGGAGGAGATGGGGGTGAGAGAAT	Os01g0310700	AK120861	Non-protein coding transcript, unclassifiable transcript.
3996	48	1	Os10g0191000|COMBINER_EST|Os10g0191000|8	CAATTTGTTTGGCTTGAAGGATTCCCAGATGTTGTTTGTAATTTGGTAGCTAGTGATTCA	Os10g0191000		RNA-directed DNA polymerase (Reverse transcriptase) domain containing protein.
3997	48	2	Os03g0424000|mRNA|AK107031|CDS+3'UTR	TTTTTTAGCACGCCCGTTGGGTATATTCACTTTCAGAAGCTTGGTCTATTTGTAGCCATA	Os03g0424000	AK107031	Protein kinase domain containing protein.
3998	48	3	Os08g0185900|mRNA|AK108323|CDS+3'UTR	GTTTCCTCTCTTTCTCTTGTCACAAACCACTGTTGCTGATGGACACAACTACTCCCCCGT	Os08g0185900	AK108323	Ubiquitin domain containing protein.
3999	48	4	Os03g0286200|mRNA|AK105065|CDS+3'UTR	ATGGCACAGTACCTCAAAATTATTTGCTGTGTCTTTGAAATTCTTATGGCGGTATTGGAA	Os03g0286200	AK105065	Similar to Prephenate dehydratase-like.
4000	48	5	Os02g0325400|COMBINER_EST|Os02g0325400|8	CGGTTATTTCTTTGGCTGAAGCGTCGATTTGGAGCTGGCATCTCAGATAGTGTTGACTGA	Os02g0325400		Hypothetical protein.
4001	48	6	Os08g0154000|mRNA|AK063541|CDS+3'UTR	CTTTAAGTCCGGGGTTAAATCCCTAAGTCTGACCTTAATTGGTTGTACTTGGCAATGGAT	Os08g0154000	AK063541	O-methyltransferase, family 3 protein.
4002	48	7	Os11g0170700|COMBINER|CI352294|1	CTTGTATTTGCTATAAATAAGGAGAAGAAAAAACCTGAAAAGCTGCAAGCACTTCGTAGC	Os11g0170700	CI352294	Reverse transcriptase, RNA-dependent DNA polymerase family protein.
4003	48	8	Os09g0563700|mRNA|AK106611|CDS+3'UTR	AAAGCTTCTGCGTGCAAAGAAATGGATTGAGTTTCTCTATAGTTATAGTGCTGTTAGTGC	Os09g0563700	AK106611	Conserved hypothetical protein.
4004	48	9	Os05g0164400|COMBINER|CI148718|6	TTCAAGCTCAAGGTCTGATCGAGCTTTGTAGAGGCGTTGATCCATCTCCATTTCTGTGAA	Os05g0164400	CI148718	(No Hit)
4005	48	10	Os11g0173500|mRNA|AK111677|CDS+3'UTR	TATATACCTCTCAATACCTTTCTAGAACCACGCAAAACCTCTCTTTTACAGTGTTATATC	Os11g0173500	AK111677	Protein kinase-like domain containing protein.
4006	48	11	Os05g0455400|mRNA|AK063498|CDS+3'UTR	ATTTCCTGGTGATCATTGCTCGCCGGAGCAGTCTATGTAACAACCCAATTGCTAAAGTAA	Os05g0455400	AK063498	Conserved hypothetical protein.
4007	48	12	Os04g0444900|mRNA|AK098960|CDS+3'UTR	TTCTGCCTCCTTGGTTGGATGGATTGGTTAAGTGTCTAAACTCTCTGATTAATGATGTGA	Os04g0444900	AK098960	Similar to Alfin-1.
4008	48	13	Os06g0693400|mRNA|AK106435|CDS+3'UTR	TTTCATGCCTTTGTAACAGAATATTTGGTCATATTGTAGCCATGCGATTCAAAATTATTC	Os06g0693400	AK106435	Conserved hypothetical protein.
4009	48	14	Os07g0236700|mRNA|AK068542|CDS+3'UTR	ATATAGCTGTGTGTTAGTGTTAAGCAAAGCTCTAGAAATATTGTATCTAGGGATGAATGG	Os07g0236700	AK068542	Similar to Dof2 (Fragment).
4010	48	15	Os03g0300500|mRNA|AK070513|CDS+3'UTR	TATTTACGTGTTGTACGGGTTGTTACGAATCGATTATTGTTTTTACTGATCGACAAATGG	Os03g0300500	AK070513	Similar to Pectin methylesterase 6 (Fragment).
4011	48	16	Os06g0195800|mRNA|AK111076|CDS+3'UTR	ATTAATTTAGGAGTAAGAACATGTTTCTATTTGATCATTGATCGTAATGAGCTGAATTTG	Os06g0195800	AK111076	Conserved hypothetical protein.
4012	48	17	Os07g0614500|mRNA|AK059384|CDS+3'UTR	GCACTCTACTTCTACTGAGATCGTTTTCTCCTCCTTTAATGTTTAAAGACCAATCAGGTT	Os07g0614500	AK059384	Similar to Elongation factor 1 beta 2.
4013	48	18	Os06g0112100|mRNA|AK061381|CDS+3'UTR	CTTGTAAGCATGCATGTGCGATCATTTTATTGCAAATGGAATAGCAGATGATGTTGCTTT	Os06g0112100	AK061381	Conserved hypothetical protein.
4014	48	19	Os03g0848200|mRNA|AK072278|CDS+3'UTR	GGCATCTCTGCTGTTGTATACGTGTTCTTGTAAGACATCTGAAGAATGAATGAAGCTTAA	Os03g0848200	AK072278	Similar to Phytase.
4015	48	20	Os04g0595800|mRNA|AK120076|CDS+3'UTR	TTGGTTACCGTTAAATGAGCTAAGGCTATTCTCGCTCGGGAAAATAGACACAAAATTGCA	Os04g0595800	AK120076	Similar to Secretory carrier membrane protein.
4016	48	21	Os01g0276400|mRNA|AK106403|CDS+3'UTR	CTGCTATTGCCATTTTACATATGTGAAACAAGAAAGAGGAAATGATTGGCATTTTTTTTC	Os01g0276400	AK106403	Similar to Presenilin 2 (PS-2) (Fragment).
4017	48	22	Os06g0168400|mRNA|AK109865|CDS+3'UTR	CAAATCAAGGATTTGATGTGTAACATTTACCTGTTCTAATGGATGTTGATCTTATCCCAG	Os06g0168400	AK109865	Conserved hypothetical protein.
4018	48	23	Os03g0784700|mRNA|AK103965|CDS+3'UTR	TGTAATTCATAAGCTTCTGCATCACATGATGAACGAAAGGAAGCATGTAACTTTTGCCTG	Os03g0784700	AK103965	Ferredoxin--NADP reductase, root isozyme, chloroplast precursor (EC 1.18.1.2) (FNR).
4019	48	24	Os02g0167200|mRNA|AK106491|CDS+3'UTR	TCAACTTGTACTGGGGAGCAGAGATTTTTATCTTCTGTACCTAGTACAAATATCATTTGC	Os02g0167200	AK106491	Protein prenyltransferase domain containing protein.
4020	48	25	Os01g0874100|mRNA|AK101275|CDS+3'UTR	GAAGGTAACCCTTTACCAGGATCTGCTCTGAACTCTCTGGATTTCAGAAGAGCAATGTCT	Os01g0874100	AK101275	Deoxynucleoside kinase family protein.
4021	48	26	Os01g0310900|COMBINER_EST|Os01g0310900|8	GCAGATGGAGGGGCGAGTTGCGGCGGCGGCGCACGGAGGGAGCGAGCGGCCGTGCCGGCT	Os01g0310900		Conserved hypothetical protein.
4022	48	27	Os03g0661900|mRNA|AK072616|CDS+3'UTR	GGGTACAATGATACCCCAGAGAGAGATGGTACAATGGTACCCACATTTTCCTCTTGATAT	Os03g0661900	AK072616	Peptidase, trypsin-like serine and cysteine domain containing protein.
4023	48	28	Os12g0616200|mRNA|AK098937|CDS+3'UTR	GTTAAACCTGAAACTGCAACTGAACTCTTGTGCTTTCTGATCTCAAAGTGTTTCGGTTCA	Os12g0616200	AK098937	HUELLENLOS-like protein.
4024	48	29	Os06g0551800|mRNA|AK065388|CDS+3'UTR	CTTCAAAGATATCAAGCTCAAGATTGAAAACACGTACTCCTGTTTTCCTATACTATGGCA	Os06g0551800	AK065388	Similar to Resistance protein candidate (Fragment).
4025	48	30	Os06g0726200|mRNA|AK099339|CDS+3'UTR	ACAATCATCAGTAATGCCCACAATGGCTGATGGAAAATATATTGTGCTTCCGATTATTAA	Os06g0726200	AK099339	Endochitinase precursor (EC 3.2.1.14).
4026	48	31	Os03g0816000|COMBINER_EST|CI419583|4	CAAAGCAGATCATCATACAGTGCTTGTAGCTGCCAAGGATCTCCTATGGTGCTTCAGATT	Os03g0816000	CI419583	Conserved hypothetical protein.
4027	48	32	Os12g0639800|COMBINER_EST|Os12g0639800|8	TCGGTATCATCATCGCGCTCATCCTCATCATAATCCTCTCCGTTTGCCACGGCTTCAAAT	Os12g0639800		Similar to Vesicle-associated membrane protein 722 (AtVAMP722) (Synaptobrevin- related protein 1).
4028	48	33	Os06g0556300|mRNA|AK101552|CDS+3'UTR	TGTGCTGTTCTTGAGTAGAAGCTGAAACTGCAGCCTGAACTGAAACACTGCTGAAACTTG	Os06g0556300	AK101552	Cyclin-like F-box domain containing protein.
4029	48	34	Os01g0948400|mRNA|AK070184|CDS+3'UTR	TTATCCGAATAATTTGCTGCACTTTAGTGGCACGAAATCTGGATGATGTTAGATTGATAC	Os01g0948400	AK070184	Similar to Pyrroline-5-carboxylate reductase (EC 1.5.1.2) (P5CR) (P5C reductase).
4030	48	35	Os03g0770700|COMBINER_EST|CI444018|1	AGTAGAAGGGTTTTTGTAATATTGGGGCAATGCAACAGCAGCAGCATAGTAGTAGATCAG	Os03g0770700	CI444018	Similar to ANT (Ovule development protein aintegumenta).
4031	48	36	Os12g0105700|mRNA|AK067668|CDS+3'UTR	CACAAGATGAATAGCTGTATTTTCCTTTTCCCCTCACTATGACCCTCAGCTCTTGGTCTT	Os12g0105700	AK067668	Bacterial surface antigen (D15) family protein.
4032	48	37	Os01g0222900|COMBINER|CI444697|x	AGATGGCACCGATTTTGTAATGTTCTATGATGCACAAACTTACTTGCATTTGGATGATGG	Os01g0222900	CI444697	Curculin-like (mannose-binding) lectin domain containing protein.
4033	48	38	Os07g0141400|mRNA|AF022732|CDS+3'UTR	GATTGTACATGAGAATTAAGAACAAGTTAAGGAGAGAGGTCGATCCATCGATTTCCCCTG	Os07g0141400	AF022732	Similar to 23 kDa polypeptide of photosystem II.
4034	48	39	Os06g0210300|COMBINER|CI268249|6	CCATGGAGTTAACCTCCTTACAACTGCTTGTTTCATTTGTAAAAGTTACTTGAAAAGTAC	Os06g0210300	CI268249	Pathogenesis-related transcriptional factor and ERF domain containing protein.
4035	48	40	Os07g0217800|mRNA|AK108654|CDS+3'UTR	AAACCATTTAGGGTCTCTAGTATCTTTGACATAATATACTTGCTCAGCTTGTGTTGCCAA	Os07g0217800	AK108654	Conserved hypothetical protein.
4036	48	41	Os11g0640600|mRNA|AB017914|CDS+3'UTR	TTTGGATGTACTTAATGTTAATCTTATTAAAACTAGCTGGGTGGCTCGCGCAATTGTGCG	Os11g0640600	AB017914	Disease resistance protein family protein.
4037	48	42	Os02g0326200|COMBINER_EST|CI495851|6	TTTCTTCCACATATATACATTTCAAGAGGAAGAACCGAAGAATACACAAAGCTCAGTTAC	Os02g0326200	CI495851	Nucleotide-binding, alpha-beta plait domain containing protein.
4038	48	43	Os02g0677700|mRNA|AK119947|CDS+3'UTR	TTACTCCGCTCCAGGGCCACGAGAAGGTGCTCGCTTCCCAGATCAATGCGCTCGTCTGGT	Os02g0677700	AK119947	Quinonprotein alcohol dehydrogenase-like domain containing protein.
4039	48	44	Os10g0470900|mRNA|AK062625|UTR	CTGGTTAAATCAGTATTTCTCCGGGTTGGATGCGATGCCATTTCCTTTTAGAGCATGTCC	Os10g0470900	AK062625	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
4040	48	45	Os06g0731000|COMBINER_EST|Os06g0731000|8	CAGGCGGATATGGAGAAGGTCATGGCTCAGGTTACGGGGGTGGTGGCGGACATGGCCATT	Os06g0731000		Eggshell protein family protein.
4041	48	46	POsControl0018|genome		
4042	48	47	Os01g0288700|mRNA|AK106473|UTR	TGGAATGTTTTCTAGGCTGATAGTTCTAGCTGTAGTTTCTTCCTATATCCGGCAAACGGC	Os01g0288700	AK106473	Non-protein coding transcript, unclassifiable transcript.
4043	48	48	Os04g0650800|mRNA|AK120939|CDS+3'UTR	GCAGTGTCTTGATTAATCTGGCTTAGGTTTGAACATGGTGCTTATTAATAAGAAGCCCTC	Os04g0650800	AK120939	Similar to Phosphoglycerate dehydrogenase.
4044	48	49	Os03g0845300|COMBINER|CI516826|x	GGAAAGTTTTTGTACCGGATTTTGCATGCTTTTCGGCGTTAATTCTCTCATTTTTTGTAA	Os03g0845300	CI516826	Hyaluronan/mRNA binding protein family protein.
4045	48	50	Os03g0712700|mRNA|AJ417522|CDS	AATTGATCAAGGAGATTCGGTCAGATGTTTCTGATGTGGTTGCCGCAGATGAGTTTGAGT	Os03g0712700	AJ417522	Similar to Phosphoglucomutase, cytoplasmic 2 (EC 5.4.2.2) (Glucose phosphomutase 2) (PGM 2).
4046	48	51	Os03g0333400|mRNA|AK120545|CDS+3'UTR	GTTCAGCTGACATGGTGAGGATTACACGGTTGGCTTGGGGACATGCAACTCCCTAGAGTT	Os03g0333400	AK120545	Conserved hypothetical protein.
4047	48	52	Os07g0687500|mRNA|AK073511|CDS+3'UTR	GTTCTCATGCTGCTGTCATGTACTAGCAGTTCTCTTGAAATTTTATATGGAGGATATATC	Os07g0687500	AK073511	PpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein.
4048	48	53	Os02g0753400|COMBINER_EST|CI426801|6	AACCTTTTACTAGATGCTAGTACACGGTGAATAGTACTTTTGTTTGTGAAATGTAACGAG	Os02g0753400	CI426801	Conserved hypothetical protein.
4049	48	54	Os01g0233300|COMBINER_EST|Os01g0233300|8	TGACCTTCATATTGAAATTCCTTATAGAACCAGTAGAAGCACATCATATGTTATGAGCAC	Os01g0233300		Cyclin.
4050	48	55	Os06g0708000|mRNA|AF177392|CDS+3'UTR	CCTCTTTGAAGAACTGTTCATTTTCAGTACATTAAGCCTAGTAAAGTTCAGATGTTTGAG	Os06g0708000	AF177392	MAP kinase homolog.
4051	48	56	Os01g0615200|COMBINER_EST|CI224792|6	ACGTTGGAATTCGTGACGTTTATTCGTGTCTTAACGAGACGTTATGTCGTAACTTTGGCG	Os01g0615200	CI224792	Transferase family protein.
4052	48	57	Os02g0168600|mRNA|AK067291|CDS+3'UTR	TAACTCGGGAGCAAACTTTGTAAGCTTATGTACAGTGAAATGCTGTTTGTTCATCTCCTT	Os02g0168600	AK067291	Ovarian tumour, otubain domain containing protein.
4053	48	58	Os03g0835800|mRNA|AK102903|CDS+3'UTR	ATCTTGTTGATGGAGTATGGAAAGCTGCTTTCCACCTGAGGCTGGGATAGCATCTTAGTT	Os03g0835800	AK102903	Galactose oxidase, central domain containing protein.
4054	48	59	Os07g0440700|mRNA|AK108717|UTR	GACATCGGCTAGTTGCTAGCTAGGGTTAGTTTTGTTACCCAGGTAGCTTTGTAACTGCTT	Os07g0440700	AK108717	Non-protein coding transcript, unclassifiable transcript.
4055	48	60	Os01g0966700|mRNA|AK067444|CDS+3'UTR	CACAGACTTGTTGATGACATCTACTTGCTTTGTAGCAATATGTTTTTACTTGTAGAAAGG	Os01g0966700	AK067444	Similar to Beta-fructofuranosidase (EC 3.2.1.26) (Fragment).
4056	48	61	Os05g0414600|mRNA|AK070176|CDS+3'UTR	ACCCATTTTTCTGCAAGCAATTAACAATGAAGATGAGGTGAATACAAAGGAGTACATTGC	Os05g0414600	AK070176	Conserved hypothetical protein.
4057	48	62	Os02g0556100|mRNA|AK103125|CDS+3'UTR	GCAGTCAATGATCTGCTCTCGTCCATGTTGCATCTGAAGTTTTTTAAGTGGCTACATTTT	Os02g0556100	AK103125	NAD-dependent epimerase/dehydratase family protein.
4058	48	63	Os09g0116100|COMBINER_EST|Os09g0116100|8	CATGCATCAAATGTCAATCAGAAACATCCAACCAATACGAAGCTGCGTAAAAAGCCTCGC	Os09g0116100		Protein of unknown function DUF597 family protein.
4059	48	64	Os04g0542000|mRNA|AK106878|CDS+3'UTR	CGCCACACATCAGCAACCTGCTTCGTGTTGTACTGGATTACTGATGATCCGTATGAAAAA	Os04g0542000	AK106878	HAT dimerisation domain containing protein.
4060	48	65	Os03g0799500|mRNA|AK071709|CDS+3'UTR	GAGAGATCTATGAACTGGAATATAATTTGTAGCTTGATGAACTGGTCATCGATCCAGACG	Os03g0799500	AK071709	Protein of unknown function DUF778 family protein.
4061	48	66	Os04g0601200|mRNA|AK063203|UTR	TGCTACTTGTGTAGTTGATTTATCAGTTTATAACCAACATGATAATAAACTTGTATGTGG	Os04g0601200	AK063203	Non-protein coding transcript, unclassifiable transcript.
4062	48	67	Os07g0301200|mRNA|AK102570|CDS+3'UTR	TTTGCTTCTCTTGTGTTGGAAAAAACAGTAAAATCAGATATGTGCTAAGGCACCATTGGC	Os07g0301200	AK102570	Similar to RNA helicase (Fragment).
4063	48	68	Os03g0638400|mRNA|AK103071|CDS+3'UTR	ATTGCTACTTTACCTTGTACTTACACGTGTCGGCTAGACCACCTAATTACTCATCTTTGA	Os03g0638400	AK103071	Conserved hypothetical protein.
4064	48	69	(-)3xSLv1		
4065	48	70	Os11g0703100|COMBINER_EST|CI557395|1	TTATTTGTGTGATTTCTGTGTACGTGACCATGTAACAAAAATTCCTTTCAAAATCTAAAA	Os11g0703100	CI557395	Thaumatin, pathogenesis-related family protein.
4066	48	71	Os04g0594500|mRNA|AK106269|CDS+3'UTR	AAGAAGAGACTGCATCTCCAGTCTAGTCTGTATTAGGTTACTGCCTCGTCGTTCCAGTAT	Os04g0594500	AK106269	Protein of unknown function DUF674 family protein.
4067	48	72	Os02g0514000|COMBINER_EST|Os02g0514000|8	AGTATTATCAAGCTTTGCAAACAGGAATGCTTCGTTGTGGTTTGGTGGAAAATGATGATG	Os02g0514000		Retrotransposon gag protein family protein.
4068	48	73	Os03g0133000|mRNA|AK107090|CDS+3'UTR	TGGATTCGATTGTACATATAGTAGTAGCACCGAGATATCAATCAATCTTTTGGTCTTCTC	Os03g0133000	AK107090	Similar to NAC-domain protein 14.
4069	48	74	Os03g0717000|mRNA|AK066295|CDS+3'UTR	TGCTGGGCTGTATCAACACTACTCCCTGCTCCTTAACATCATCTCAGTTGTAGTCATTGT	Os03g0717000	AK066295	Similar to TMK protein precursor.
4070	48	75	Os05g0583500|mRNA|AK100131|CDS+3'UTR	CGTCTGTTTTTTGTCCCCTGTGGGTGTTACCAAATTTTGTAACTCCGCATTACGTTGAAT	Os05g0583500	AK100131	PX-associated domain containing protein.
4071	48	76	Os03g0240400|mRNA|AK100490|CDS+3'UTR	TATTTGCATATTATCATTTTGGGTATTTGGATCAGGTAGGATGAACCCACTTGACTTTTG	Os03g0240400	AK100490	Conserved hypothetical protein.
4072	48	77	Os07g0470400|mRNA|AK108677|CDS+3'UTR	TTGGAAAACCATGTGTTGCCATTGCTTTTTATGCATTTGCAAACTACAGGCCTGAGAAAA	Os07g0470400	AK108677	Hypothetical protein.
4073	48	78	Os07g0209000|mRNA|AK059111|CDS+3'UTR	TCTTGCCTGATGAAGAGCTGTTGAAACTTTCATAGTCAATAGAATCATAACAACATAAGC	Os07g0209000	AK059111	Similar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like.
4074	48	79	Os02g0723300|COMBINER_EST|CI421287|0	AAACAACCAAGTGCCATGTGCACTTTACTTATCTAGGTCTGATAGGTTGAACCTGAGTTC	Os02g0723300	CI421287	HRDC-like domain containing protein.
4075	48	80	Os04g0483400|mRNA|AK063531|CDS+3'UTR	GAAAGAAAAATGCACTTGGCTGATTCTCATGTTACCACACGGCTTTTCTGCTCCTTGAAC	Os04g0483400	AK063531	Conserved hypothetical protein.
4076	48	81	Os01g0686400|mRNA|AK058740|CDS+3'UTR	CAGACTAGAGCACGGGACTGTTCCATTTCAGTTACCCAGAAAGAGAGTATTAGGACATCT	Os01g0686400	AK058740	Similar to AR401.
4077	48	82	Os04g0112300|mRNA|AK121833|CDS+3'UTR	GTGTTTGTTTATCAACCAAATTGAAACGCTTGTGGACTTTGAGATATTTGTTAAGGTGTG	Os04g0112300	AK121833	Eukaryotic initiation factor 3, gamma subunit family protein.
4078	48	83	Os07g0462700|mRNA|AK073834|CDS+3'UTR	TTAGTCAGGACATCCAGACAAGAAGTATATAAAAGATTAAACCATGCGAGCTAGTATATG	Os07g0462700	AK073834	Thioesterase superfamily domain containing protein.
4079	48	84	Os08g0545700|COMBINER_EST|CI409670|6	ATGCAGCTCTAACACAACATGGCATGATTTTATCTTGACAAGCTAATTGCTTGCAGTCAC	Os08g0545700	CI409670	TraB determinant family protein.
4080	48	85	(-)3xSLv1		
4081	49	1	osa-miR395k|Os08|Mature	GTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAA			miRNA
4082	49	2	Os09g0547300|mRNA|AK102669|CDS+3'UTR	TTGTTCCGTTATTTATTATACATATAATTCATTTGTATCCCTGTACAGCCGGTGGCTAAC	Os09g0547300	AK102669	Protein of unknown function DUF630 domain containing protein.
4083	49	3	Os12g0228400|mRNA|AK120234|CDS+3'UTR	CTTAATCTGTTATTCTCCCCCTAAGTCTTGTGTGGCGCCTTCTGGGGAATTTGAACCATT	Os12g0228400	AK120234	Similar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)].
4084	49	4	Os06g0620600|mRNA|AK071563|CDS+3'UTR	CATAGGACCAAGAGAGTGTTGTGTAATTCCTTACAAACTCCGTCTGAAATTTTCCTACTT	Os06g0620600	AK071563	Hrf1 family protein.
4085	49	5	Os06g0714200|COMBINER_EST|CI547847|0	GCTGCTGTCGGCTGTTGTCATCATAGTTTTTTGTAGAGAATACATGTAAAGATCTTTTGT	Os06g0714200	CI547847	Similar to CDPK-related protein kinase (Fragment).
4086	49	6	Os12g0577200|mRNA|AK106267|CDS+3'UTR	TGTTGGGAGTAAATTAATGGTATATTGGGGTTAATAAATAATGAATGGATGATTCTCTTG	Os12g0577200	AK106267	Conserved hypothetical protein.
4087	49	7	Os06g0582600|mRNA|AK067453|CDS+3'UTR	AATATGCGATTCATGTGATAAATTATTATCAGTGTTTGTTATATTTTACTATGCCGTTTT	Os06g0582600	AK067453	Similar to Cysteine proteinase.
4088	49	8	Os01g0208400|mRNA|AK105750|CDS+3'UTR	GCCCGTCAAGTGTACACTTTGGTGAAGATTTATCGTTTTATCTGTTGCAATAAGAGAGAT	Os01g0208400	AK105750	Conserved hypothetical protein.
4089	49	9	Os03g0244600|mRNA|AK103524|CDS+3'UTR	AAAGGGAATGTTGCTACGGCCGCAGATGCAAGAGCCAGCTAATCTAGCCTCTTTACTTTC	Os03g0244600	AK103524	Similar to AUX1-like protein.
4090	49	10	Os04g0683700|mRNA|AK119512|CDS+3'UTR	AGTAGCTTCGTTTAGGGTTGGGTTTCCCGTGCTAACGAGTAGTAAAATTTCGGTTTCCCG	Os04g0683700	AK119512	Similar to 4-coumarate-CoA ligase-like protein (Adenosine monophosphate binding protein 3 AMPBP3).
4091	49	11	Os03g0665800|mRNA|AK107693|CDS+3'UTR	TCTAGAGGAAAAACATTGGATTGGCTTTATCTGTATAATGATCGTGTAGGCACTGTATGC	Os03g0665800	AK107693	Armadillo-like helical domain containing protein.
4092	49	12	Os06g0256200|mRNA|AK072983|CDS+3'UTR	TACTCCATTATATTATTATAACTGGATTGTAACTGCTTGGCCAGCGATGTTTTTGGTTCT	Os06g0256200	AK072983	Similar to Keratinocytes proline-rich protein.
4093	49	13	Os03g0596900|mRNA|AK104029|CDS+3'UTR	AGAGCATCATGTAATGAATCATGTTCGTCATAGGTTTGAATAACAAGTGGACGTATTAGG	Os03g0596900	AK104029	GTP-binding signal recognition particle SRP54, G-domain containing protein.
4094	49	14	Os12g0618300|mRNA|AK103368|CDS+3'UTR	ATACAGCCAGTGTGAATTGTGTGTGATATGTGTACTGTTTGTTCCTCCATGAATGATCAA	Os12g0618300	AK103368	Similar to GTP-binding protein-like (Fragment).
4095	49	15	Os03g0381300|mRNA|AK068105|CDS+3'UTR	TGTTCGTGACTGTAAAAATAAACTGAAGTATCCAGCTTGCTCAATCCATATTGTTACTGC	Os03g0381300	AK068105	HSP20-like chaperone domain containing protein.
4096	49	16	Os12g0550600|mRNA|AK059672|CDS+3'UTR	TACCTCCACAATGTATATTGCCTGTCCTTAGAGCTGCATTTATTGCATAATGCCCACTTT	Os12g0550600	AK059672	Conserved hypothetical protein.
4097	49	17	Os04g0541700|mRNA|AY224440|5'UTR+CDS	TCCCGGAGTCCTTCTGCGCCACGCCGGAGCTGTGGGAGCCATGGCCGCTCGTCGAGTGGA	Os04g0541700	AY224440	Homeodomain-like containing protein.
4098	49	18	Os03g0210200|mRNA|AK111138|CDS+3'UTR	GCTCCCCGGAGGGCGATCGATAGCTCTCGATCGGCAAGATTTATGTGTTGAATAGCTCGA	Os03g0210200	AK111138	Proteinase inhibitor I25, cystatin domain containing protein.
4099	49	19	Os11g0701000|mRNA|AK103295|CDS+3'UTR	TGCACAACTCTAGTGTGTCATATATGCATGTGTGATCGATGTATCTGTACTTTTCTTTTT	Os11g0701000	AK103295	Class III chitinase homologue (OsChib3H-c).
4100	49	20	Os11g0660300|mRNA|AK109657|CDS+3'UTR	ACCTGTTGTACAATCCTAATTAAGCTCATGAGTTGCAAGTAGAGTGCGTTTATTTCCAGT	Os11g0660300	AK109657	WD40-like domain containing protein.
4101	49	21	Os01g0181100|COMBINER_EST|Os01g0181100|8	AATCGCCGGTGGCGGCCATGGCGGTCTCCATCACATGTGGCACTGATGTGGAGCTTACGT	Os01g0181100		Conserved hypothetical protein.
4102	49	22	Os07g0566000|COMBINER|CI364229|6	AAGTGTAATATAATTTTGGATTTTTATGGAACTGTAAGAAGTACTTGTAAAATAGAAAAG	Os07g0566000	CI364229	(No Hit)
4103	49	23	Os02g0193000|COMBINER_EST|CI426747|5	TATTTGTGTTGCAATTGATGGTGCGAATAAAAACTGTCCTCGAGCAGCAGCGACAACTTG	Os02g0193000	CI426747	Peptidoglycan-binding LysM domain containing protein.
4104	49	24	Os01g0935300|mRNA|AK062782|UTR	CTACAGTACTAGACTGTTGCTAGTTTTTAAATCCACAATGTCATATTTCTAGACATAGCC	Os01g0935300	AK062782	Cullin family protein.
4105	49	25	POsControl0043|art		
4106	49	26	Os10g0161100|mRNA|AK121174|UTR	ACCATTGCTTCTCTGCATGCAAATGCAGATCCATTCCTTTCCAAAAGGATTAGTTACCAT	Os10g0161100	AK121174	Non-protein coding transcript, uncharacterized transcript.
4107	49	27	Os09g0453500|mRNA|AK103120|CDS+3'UTR	TGTAGTGGAGCATGATTGGTTTTGTGACACTTAATAGATTCTAATGTATGTGCCCCATTT	Os09g0453500	AK103120	Spectrin repeat containing protein.
4108	49	28	Os08g0143400|mRNA|AK066792|CDS+3'UTR	AAACTTTAGACGTGGGGCAGGAAAACCAAGATCCTCCCTGCCATTTGTAACATGGCAGTC	Os08g0143400	AK066792	SWIRM domain containing protein.
4109	49	29	Os12g0631200|mRNA|AK101710|CDS+3'UTR	CTTGATGTTGAATTGGATAAGCTACATCAGCAATTGTTCAGTTGATGCGTGTATCTTTAC	Os12g0631200	AK101710	Zinc finger, RING-type domain containing protein.
4110	49	30	Os03g0696300|mRNA|AK069854|CDS+3'UTR	TTACCGTATTATTATGCAATGGCAGAAGCTTGCATAAGGCGTGGTGCCACTCGTTGCTTT	Os03g0696300	AK069854	CCAAT-binding transcription factor, subunit B family protein.
4111	49	31	Os07g0274100|mRNA|AK106993|CDS+3'UTR	ATGTGCAAGTCTGAAGTTGTAATGGAACATATCTGAACATGTAGAATCAGTGTTGTTTTA	Os07g0274100	AK106993	Metallophosphoesterase domain containing protein.
4112	49	32	Os04g0609200|mRNA|AK103652|CDS+3'UTR	GTTCCCCTGTTAATTGAACATTTCCAGCAATGTGCTAAGGGTGATATTGTTCAGTCTTCG	Os04g0609200	AK103652	Major facilitator superfamily protein.
4113	49	33	Os06g0243900|mRNA|AK103538|CDS+3'UTR	CCACTGCGCATCTTCATCTAGTACTCTTTGTTCTATATATAGAGTATAAAAGAGTGGTTT	Os06g0243900	AK103538	Hypothetical protein.
4114	49	34	Os03g0381500|mRNA|AK108125|CDS+3'UTR	TGTACATATTTCCACTGTACTATATACAGTAGTGTGATCCGTCCTGTTAGAATCGACGGA	Os03g0381500	AK108125	Conserved hypothetical protein.
4115	49	35	osa-miR399g|Os02|3'seq	TGATGCTTCCATTTGATCCCATCCCTATCTGCCAAAGGAGATTTGCCCAGCGATTCACTC			miRNA
4116	49	36	Os09g0248200|mRNA|AK107545|CDS+3'UTR	CAACGGCATGCATGTGTGGATTTTGGAATTTCTAGTTGTATATGCATCGCGCGCATGACA	Os09g0248200	AK107545	Frigida-like family protein.
4117	49	37	Os02g0113400|mRNA|AK069550|CDS+3'UTR	TTTAATCCCCTTTCTTATTGTTGGCTATTTCTTGTCATGCTACCCTCATGGAAATATCGA	Os02g0113400	AK069550	Protein of unknown function DUF544 family protein.
4118	49	38	Os06g0610100|COMBINER_EST|Os06g0610100|8	AGCTCCTCTGCGAGAAGTCGTCCACGATGGTGACACTGGAAGGCAAAGTAACACGAACTC	Os06g0610100		Similar to Storage protein precursor.
4119	49	39	Os12g0206700|mRNA|AK071313|CDS+3'UTR	TCCTCTAAGATCTTATGTCACATCTAATGACTTCTCCATTGTTCTTTCCCTTAAAGTTGG	Os12g0206700	AK071313	Conserved hypothetical protein.
4120	49	40	Os05g0170000|mRNA|AK103412|CDS+3'UTR	CCTGCAGTTGGATTGGCAAGAATCACCTCAGTTCTTTTCACGACAAATTCCTTTTTCAAA	Os05g0170000	AK103412	Protein of unknown function DUF266, plant family protein.
4121	49	41	Os02g0657500|COMBINER|CI014544|6	TTTCATAAACTTCTTCGGATAATTACTCAGTAGCATACCCTTCGATGAATTCATGACAAA	Os02g0657500	CI014544	(No Hit)
4122	49	42	Os03g0772800|mRNA|AK121608|CDS+3'UTR	GTGATCATATGCATGTGTTCTGTTTCAGAAAATGCTGTCATCATCACAACAAGCTTTGTT	Os03g0772800	AK121608	Cytochrome c oxidase, subunit VIa family protein.
4123	49	43	Os09g0476300|COMBINER|CI174280|6	GCACTATTACGACGCACTCGTTGTTCCATTGGTCAAGTGTACAAAACTACAAATTGTACG	Os09g0476300	CI174280	Conserved hypothetical protein.
4124	49	44	Os03g0787400|mRNA|AK120413|UTR	TTCAATGTTTCAACCAATGTAAGTATGATGTTTCTTGGGGAATCAAAATGTTTCGCTGAG	Os03g0787400	AK120413	Non-protein coding transcript, unclassifiable transcript.
4125	49	45	Os12g0481100|mRNA|AK073151|CDS+3'UTR	ATATCGTGCATTAATCACATTCGTCATGATTTTTAATGTAATGACCTGTGAGGTCCATCT	Os12g0481100	AK073151	Similar to RNA helicase.
4126	49	46	Os12g0616900|mRNA|AK101464|CDS+3'UTR	CATTGTGGCGTAGACACTGTATTCTATTTCCCCAACACTAAAGTTATACCCTTACCCATG	Os12g0616900	AK101464	Similar to Pyruvate dehydrogenase E1 beta subunit (Fragment).
4127	49	47	osa-miR159b|Os01|5'seq	GGTTATGAAGTGGAGCTCCTTTCGTTCCAATGAAAGGTTTATCTGAAGGGTGATACAGCT			miRNA
4128	49	48	Os11g0291900|mRNA|AK063221|UTR	CCGCGCTCCTCGCATGGCCGTGCTGCGCCGACGCCACGGGCCACGGGCCGCGACCGCTGC	Os11g0291900	AK063221	Non-protein coding transcript, unclassifiable transcript.
4129	49	49	Os11g0283200|COMBINER|AU174230|6	CTTCCCGGTATCGCTTTTGGAGAGCAATTGAGTTGAGAGTTGAGTTAGGGTTTCGAGTTT	Os11g0283200	AU174230	(No Hit)
4130	49	50	Os03g0114800|mRNA|AK065394|CDS+3'UTR	GCCGAGATATAGGCTATTCATGTTGTCATTTGTTATTTGTTATTGTTATTCACCAGCATG	Os03g0114800	AK065394	Protein of unknown function DUF791 family protein.
4131	49	51	Os05g0359500|COMBINER_EST|Os05g0359500|8	ACCACCGCGCCGCACGACGACGACGGCCAGCAGCAGGTCGTCGCGCCACCGCCGGATCAC	Os05g0359500		Similar to RING-H2 finger protein ATL5C precursor.
4132	49	52	Os10g0160100|mRNA|AK120028|CDS+3'UTR	ATGGCCTTGTAATTGAGGGGGTAATCTAATGGGTTGGTCAGTGTCATTAAACTAGACTTT	Os10g0160100	AK120028	Glycoside hydrolase, family 17 protein.
4133	49	53	Os06g0275900|mRNA|AK069382|CDS+3'UTR	CGAGAATGGGGTGGGATTTTGTAATGTACATCATCGTCCCATAGTATAACGGTTGTTTGG	Os06g0275900	AK069382	SMAD/FHA domain containing protein.
4134	49	54	Os07g0553600|mRNA|AK064506|CDS+3'UTR	CACATTTGTGAACAGAGACGCCAACATCTGCTATGATGCTATCCTCTTAGTAATTTATTC	Os07g0553600	AK064506	Conserved hypothetical protein.
4135	49	55	Os01g0638000|mRNA|AK103824|CDS+3'UTR	ATGTAAGTATAATGTAATTATAATGTAAGTGCAATGTAATTTCTATATTTTGCATTGAAA	Os01g0638000	AK103824	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
4136	49	56	Os03g0239400|mRNA|AK066563|CDS+3'UTR	GAGGCACAAATTTGTATAATGTACTAACGGGTCGTGATAAGGAAATTTTGTTGCATTTTG	Os03g0239400	AK066563	Similar to Transcription factor HBP-1a(C14).
4137	49	57	Os04g0555400|mRNA|AK066109|CDS+3'UTR	TTTGATCTGATGCCGTCTTTGCGTTCAACACAATTTACTGTTTTTGGTAGGTGATTATCT	Os04g0555400	AK066109	Similar to Serologically defined breast cancer antigen NY-BR-99.
4138	49	58	Os12g0607100|mRNA|AK122105|CDS+3'UTR	TCAGTTGTGCATGGCATTCACGTGTTGCAACCGAAAGTAACAAACATGACCAACACACTT	Os12g0607100	AK122105	Similar to Heterochromatin protein (Fragment).
4139	49	59	Os04g0660900|mRNA|AK108874|CDS+3'UTR	CTATGATCAATTAATTCGATTTATTATTGGTGTGATTAATAATAAAGTTGCCACTACTGG	Os04g0660900	AK108874	TGF-beta receptor, type I/II extracellular region family protein.
4140	49	60	Os10g0147900|mRNA|AK120943|CDS+3'UTR	CAATCTGTCAGTAAAATTGGTTGGGATTATTGAATTGTAATTCAAGAGGCATTTTAAACA	Os10g0147900	AK120943	Armadillo-like helical domain containing protein.
4141	49	61	Os04g0543200|mRNA|AK102135|CDS+3'UTR	TCTTGGCATGTTTACTTCCAGTGTTTCTAAACATTTTTGAGAGATATGGAGTGTTTCAGT	Os04g0543200	AK102135	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
4142	49	62	Os10g0439800|COMBINER_EST|Os10g0439800|8	GCTAGCCTTCTGTATCATTTTGATTGGAAGTTGCCTGATGGAATGATGCCTGAAGATGTT	Os10g0439800		Cytochrome P450 family protein.
4143	49	63	Os05g0546500|COMBINER_EST|AU166058|6	CTATTTGATGGATATTTGGCCGTATATGAATTAATTCGAGTTTGGTTTGGCTTGTTCCAT	Os05g0546500	AU166058	DNA-binding TFAR19-related protein family protein.
4144	49	64	Os03g0335300|mRNA|AK121413|CDS+3'UTR	TCTTCAGACTAGAGAATTCCTCCTCGCCTCAACTTAATAAAAGCTCGAGTCTTGAAGGGG	Os03g0335300	AK121413	Similar to Vacuolar sorting receptor homolog (Fragment).
4145	49	65	Os08g0439000|COMBINER_EST|CI438672|6	ACTCTGGAGTCTAGCCACGGTTCTTGTAGTAGCAGTGTTCTCTGAACTGTTTCTGAAGAA	Os08g0439000	CI438672	Phosphofructokinase family protein.
4146	49	66	Os07g0695100|mRNA|AY359964|CDS	AGAGTGGCTGCAGTGATCAAGTTTAGACAGAAAAGGAAAGAGCGCAACTTCGGAAAAAAG	Os07g0695100	AY359964	CheY-like domain containing protein.
4147	49	67	POsControl0006|genome		
4148	49	68	osa-miR394|Os02|Mature	TTGGCATTCTGTCCACCTCCTTGGCATTCTGTCCACCTCCTTGGCATTCTGTCCACCTCC			miRNA
4149	49	69	Os01g0852500|mRNA|AK100453|CDS+3'UTR	TGGAAGGGCCAATGTGTCGCCTTTAGCAAGCTTTTTTGGCAATGCATATCTATCGTTCTG	Os01g0852500	AK100453	ELM2 domain containing protein.
4150	49	70	Os09g0457400|mRNA|AK063988|CDS+3'UTR	ATGAAATCTTACCAATATATACTGCTCTGTTTTCTATAGTTCATCCCGGAAATTTGAACT	Os09g0457400	AK063988	Alpha-amylase isozyme 3A precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase).
4151	49	71	Os02g0529700|mRNA|AK120980|CDS+3'UTR	GAAGGTTTCATTACCAATGATTTGTTTCAGCAAAATCAGCACCGACCATGATATGTTGAG	Os02g0529700	AK120980	Similar to Acidic ribosomal protein P2a-4 (Fragment).
4152	49	72	Os02g0325600|mRNA|AK064355|CDS+3'UTR	TTAAGGGTTAATTACTGATTGCTTCGTGATCGCACACACCACATTTGCTGTTTTGTTTGT	Os02g0325600	AK064355	Similar to Phosphate starvation response regulator-like protein.
4153	49	73	Os02g0735100|mRNA|AK120606|CDS+3'UTR	TCGTTACCGAAGCAGGAAGTCAGCTGCGTCATCTGTGACTAGGAAAGAGTAAATACTAGT	Os02g0735100	AK120606	Peptidase M48, Ste24p family protein.
4154	49	74	Os07g0530400|mRNA|AK107269|CDS+3'UTR	TGAGGAATTCGCTCTGGAATTTCCTCCTGAAATAATAAAAATAGTGGTTGGTTCTTCCTG	Os07g0530400	AK107269	Conserved hypothetical protein.
4155	49	75	Os12g0484900|COMBINER|CI439534|0	TGTGGTATTGTACTATCTCAGTTTCTTGTGGAATTTGTTCTATGTTGCTGACTGAATTGC	Os12g0484900	CI439534	Similar to Growth-regulating factor 7.
4156	49	76	Os06g0717800|mRNA|AK064885|CDS+3'UTR	TTGTTCCGCCGCAGGAATTTTAACACCAGTGCATATGAAATAATAAGCCAAAAAAGGAGT	Os06g0717800	AK064885	Similar to Protein phosphatase 2C-like protein.
4157	49	77	Os05g0149900|mRNA|AK101105|CDS+3'UTR	TATTAGGGTGCTATATTTTGAGACGGGGTAGTAGTTAATTTGCTCTCCATGTATTATTGT	Os05g0149900	AK101105	Tetratricopeptide-like helical domain containing protein.
4158	49	78	Os12g0468600|mRNA|AK060961|CDS+3'UTR	TTATAATTGCAAATCCCCCCAGCGGTACAGCCAGACTGACAAAAGTATAATTGGTTTCCT	Os12g0468600	AK060961	Metallo-dependent hydrolase, composite domain containing protein.
4159	49	79	Os07g0662900|mRNA|AK067082|CDS+3'UTR	CAAGTCGGCATGTGGAATAATTTATCCCCTGTTCTTTGCTAATAAAATCTTTTTCTGATG	Os07g0662900	AK067082	Similar to 4-alpha-glucanotransferase (EC 2.4.1.25).
4160	49	80	Os05g0530400|mRNA|AB050096|CDS+3'UTR	TTTAGTAGACCATATCCATTTTTGTACTCCATTGCCCTTCTAAGATTCCTCGTTAAAATC	Os05g0530400	AB050096	Heat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10).
4161	49	81	Os02g0437800|mRNA|AK066001|CDS+3'UTR	TTTAACGCAGTTTAGTTCAATGTCCTGGGAGAATCAACATTCAAGTCGCGCATTTTGTTG	Os02g0437800	AK066001	Similar to Vacuolar protein-sorting protein 45 homolog (AtVPS45).
4162	49	82	Os11g0449800|mRNA|AK108433|CDS+3'UTR	AAATTGAGTTATTGGAGAAGATAGAGAGAAATCAGACTGGAAGACATGATTTATTTTTTT	Os11g0449800	AK108433	Hypothetical protein.
4163	49	83	Os05g0404600|mRNA|AK105210|CDS+3'UTR	TTTGCACTTAGTCTGTTCGGTCTCTGTGATCTGTGTGTTATGATGCGCTGAACCTTTTCT	Os05g0404600	AK105210	Zinc finger, CW-type domain containing protein.
4164	49	84	Os07g0158200|mRNA|AK103591|CDS+3'UTR	GACATGACAGAGCGTTTGTTACTTTGATATTCACTTAACGATGTTTGCTACCTTTTTTTT	Os07g0158200	AK103591	TatD-related deoxyribonuclease family protein.
4165	49	85	Os01g0779400|mRNA|AK072085|CDS+3'UTR	TCAGCCGTATGGTTGTACATCATAAACCATGTAAAAGATTAAGCTGAACTTGTCTTCGAC	Os01g0779400	AK072085	SWAP/Surp domain containing protein.
4166	50	1	Os07g0614400|mRNA|AK103733|CDS+3'UTR	AGTTGGTGTACGTTTCACCATATAGTACTACTCCCCCCAATGTATACTCCATTTCCATTA	Os07g0614400	AK103733	Conserved hypothetical protein.
4167	50	2	Os03g0429800|mRNA|AK067814|CDS+3'UTR	AATAAAAGCAATGTTCACATCGACTTGCTGTCTAGCTGTGTACTGGAATAGAAGTGCAGG	Os03g0429800	AK067814	Similar to Xanthine dehydrogenase 1 (EC 1.1.1.204).
4168	50	3	Os01g0195400|COMBINER_EST|CI209558|6	AGGCTCCATGCTAGTAGCTGAGTTTGACTGAATTTTGTACGCAAGGGAAAGGTGTGAGAT	Os01g0195400	CI209558	Hypothetical protein.
4169	50	4	Os01g0922800|mRNA|AF141964|CDS+3'UTR	ACTGACTTGTGTATGGAGTTTGTTTCAACCTATTGGTATGAATCTGTTTGATTCTGTAGG	Os01g0922800	AF141964	Similar to MADS-box protein PTM5.
4170	50	5	Os01g0876400|mRNA|AK121648|CDS+3'UTR	ATAATTGCGGCTGCGCTTTGTAATTGCCTGAGGTGTCTAATTCAAAATCTATTACAATGC	Os01g0876400	AK121648	Galactose-binding like domain containing protein.
4171	50	6	Os04g0465600|mRNA|AK059231|CDS+3'UTR	CTAGCTCTCCGGCTAGCCACTGTCTCCCACGAATTAGTGTACGTATCGGTGCATGAGTGA	Os04g0465600	AK059231	Bet v I allergen family protein.
4172	50	7	Os11g0579300|mRNA|AK064468|CDS+3'UTR	CAAGCATGACTTGTATTCTTTAGGTAGATCATTGTAAGAGTACATGAACATCTTCTTAGC	Os11g0579300	AK064468	Conserved hypothetical protein.
4173	50	8	Os10g0417600|mRNA|AK104822|CDS+3'UTR	GTCATATGAACAATGAAACAATGGGAATGCTCTGCATTACCTTTATGAATAGATGATGTG	Os10g0417600	AK104822	NAD-dependent epimerase/dehydratase family protein.
4174	50	9	Os07g0216600|mRNA|AK107674|CDS+3'UTR	GATAATGATAATAAAAAGAAATAAAATGAGGAACGGATGTTCCTCTTTGTTGTTATTCTT	Os07g0216600	AK107674	Cereal seed allergen, trypsin/alpha-amylase inhibitor family protein.
4175	50	10	Os11g0531800|mRNA|AK058678|CDS+3'UTR	AAAGCTCATTGCAATTTCTGTCTCTGACACTGTTGGAAAGCTCATATTTTCAACACATGG	Os11g0531800	AK058678	Hypothetical protein.
4176	50	11	Os11g0116200|mRNA|AK060108|CDS+3'UTR	ATATTTCCCCCAAGATTCGCTGTTCGTTTGTTCTGGGCATAATTTTGTCACCACTCAACA	Os11g0116200	AK060108	Similar to Nonspecific lipid-transfer protein 1 (LTP 1) (Major allergen Pru d 3).
4177	50	12	Os06g0148000|mRNA|AK059790|CDS+3'UTR	GCTAGCAGGAATCTTGAACAGCAGCAAAACAAGGAATGTACATTTGTGGGTTCGAAACAC	Os06g0148000	AK059790	Conserved hypothetical protein.
4178	50	13	Os04g0120200|COMBINER_EST|Os04g0120200|8	GTTGTTAATCCAAACATGGCAGCTGATCCAGGCCTCATATACGACATCGAACCATCAGAT	Os04g0120200		"Proteinase inhibitor I9, subtilisin propeptide domain containing protein."
4179	50	14	Os01g0559600|mRNA|AB025310|CDS+3'UTR	TATTACCTGCCATCATTGCTGTACATACTTATAGCTTGCTATATGTAGTTTGTAGCTACA	Os01g0559600	AB025310	Similar to C13 endopeptidase NP1 precursor.
4180	50	15	Os02g0600400|mRNA|AK073697|CDS+3'UTR	CCACAAGCAACTATATTATAGGGGCTACTATACCATGGATCTTGTTCAGACAGGATGATA	Os02g0600400	AK073697	Similar to Glucose-6-phosphate dehydrogenase.
4181	50	16	Os10g0132800|COMBINER_EST|Os10g0132800|8	AAGTTGGGGCGTGGAGATGAGGATTTGAAGAAGACCAACATACCACTCAACGGCTTTAAT	Os10g0132800		Conserved hypothetical protein.
4182	50	17	Os12g0227500|COMBINER_EST|Os12g0227500|8	ATCTGGTGTCATAAAGAAAACGGTGTATGAGCGAACACCCGAGGGGACAATCATTGAACT	Os12g0227500		Similar to Beta-glucosidase aggregating factor.
4183	50	18	Os12g0299300|mRNA|AK103895|CDS+3'UTR	TATAGGTTGAGAAGATGTTTGCATCCTACTTAGCCATGTAATTCTTATTCTTGGATTCTG	Os12g0299300	AK103895	Conserved hypothetical protein.
4184	50	19	Os05g0102800|mRNA|AK074004|CDS+3'UTR	GATGAGAACTGGAAGCTGTACAGTTGATGAGTTGAGTAGTCGAGTCTTTGGTTGAGATTG	Os05g0102800	AK074004	Similar to AML1.
4185	50	20	Os06g0708000|mRNA|AK067925|CDS+3'UTR	TTCAGTACATTAAGCCTAGTAAAGTTCAGATGTTTGAGTTCGGTGCTTAATAATCATGTC	Os06g0708000	AK067925	MAP kinase homolog.
4186	50	21	ETG09_35454		
4187	50	22	Os11g0184900|mRNA|AB028184|CDS+3'UTR	TGTCAGTCGTGTCTAGGTTCGTAGAGGAAATTAAAATGTAGAAGAACGGGTACTTCAGTT	Os11g0184900	AB028184	Similar to NAC-domain protein 5-7.
4188	50	23	Os11g0558200|mRNA|AK110844|CDS+3'UTR	AAGCAATCCACCTGGAAATAATCTGGTTGGTTTGGAGAAATATTGTCAGTTCTCAAGGAT	Os11g0558200	AK110844	Similar to P-type R2R3 Myb protein (Fragment).
4189	50	24	Os08g0556200|mRNA|AK121222|CDS+3'UTR	CGAAGAGGAATATATATGTAACGTAGATTGTTGTGGTACTATTAATTAATACTCCCTCCG	Os08g0556200	AK121222	Similar to Dihydroneopterin aldolase.
4190	50	25	Os11g0173500|mRNA|AK111017|UTR	AGCCTCTCTTATGGAGGTCGGACCAAGTCACTGGTTAATTGAGCCTATCTTTGACTGCTG	Os11g0173500	AK111017	Protein kinase-like domain containing protein.
4191	50	26	Os02g0744600|mRNA|AK058756|UTR	AGCTACAGATATTGTAGCACGACATTTAACACCTATGAACTTCAATGGAATACATTTACG	Os02g0744600	AK058756	Hypothetical protein.
4192	50	27	Os02g0722800|mRNA|AK122035|CDS+3'UTR	CCGTGAGTGACAATTTCCACTCAAAATTTTGTAGTTCAAAAAGATAAATGTTTCCTTGGC	Os02g0722800	AK122035	WD40-like domain containing protein.
4193	50	28	Os10g0394400|mRNA|AK100807|CDS+3'UTR	TTGGCCCAGGAAGTGCCAAATTTCTCAGTTTTTATACTCCTACTACATAGCGAAAGTACT	Os10g0394400	AK100807	Similar to NBS-LRR type resistance protein (Fragment).
4194	50	29	Os01g0111900|mRNA|AK103326|CDS+3'UTR	CGATCCCTTTTGGTGATAGGAAAGATGTACATCAGACTCTGTAATAATCCATATATATGT	Os01g0111900	AK103326	Glutelin family protein.
4195	50	30	Os09g0558200|mRNA|AK068834|CDS+3'UTR	TCAGTGGGGGATTATAGAAGCAGTTTTAGAATCAGTAACTAGCCTGAAGAAAGTTGTTGA	Os09g0558200	AK068834	Homeodomain-like containing protein.
4196	50	31	Os01g0897300|mRNA|AK061032|CDS+3'UTR	TAAAGCAACTGAAAATCCCATGCTGAGTTATGCAGAACTTTTACTGCATCTCAGTTTCTG	Os01g0897300	AK061032	Ribonuclease T2 family protein.
4197	50	32	Os08g0480300|COMBINER|CI167413|6	AGCTCGCCGACGACGTGCTCGTCAATTCATTCTACGAGTTCGAACCCGAGCTGAGCTAGT	Os08g0480300	CI167413	(No Hit)
4198	50	33	Os03g0102700|mRNA|AF261275|CDS+3'UTR	CGTATATGCATGTTGTACTCCTCCTTACTTGATTACATGTATGCATGCAAATTAATGAAT	Os03g0102700	AF261275	Beta-expansin precursor.
4199	50	34	Os01g0691700|mRNA|AK068018|CDS+3'UTR	ACACAGTTTGCCACACAGGAGGTTTGGGCCGTTATTGTGTTATATTTGCAGCTACAGCTT	Os01g0691700	AK068018	Similar to Serine/threonine protein phosphatase 2A.
4200	50	35	Os05g0110100|mRNA|AK099779|CDS+3'UTR	ATTCAATGTACTTGTGTTGCTGAGCTACTTTGTCTCTGATATACATATTCATTGTCTCTC	Os05g0110100	AK099779	Conserved hypothetical protein.
4201	50	36	Os05g0506000|mRNA|AK098900|CDS+3'UTR	TGTAAACATTCTACAGACTACAAGAAATCCAAGTGTACACTTCACTTGGCTTGTTGGAAT	Os05g0506000	AK098900	Similar to MS5-like protein (Fragment).
4202	50	37	Os09g0252800|mRNA|AK070046|5'UTR+CDS	ATTCACAAGGCTTATGGAGCTCCAGAGAGGCTTCCATCTGCCCATACTTGCTTTAATCAA	Os09g0252800	AK070046	Similar to E3 ubiquitin protein ligase URE-B1 (EC 6.3.2.-) (Upstream regulatory element binding protein 1) (Fragment).
4203	50	38	Os01g0744300|mRNA|AK102819|CDS+3'UTR	AGTGCAAGGCGTTGTCAGATGTGTACACCTGTCCGATATGATTGAACTCCTATCTAATCG	Os01g0744300	AK102819	Similar to Casein kinase-like protein.
4204	50	39	Os08g0481800|mRNA|AK060342|CDS+3'UTR	TACAACCCAGAAGGGTTCTCATAGGCGTTTTGTACAACTCCCATGCATTTCTCATGAACG	Os08g0481800	AK060342	Similar to Plastidic general dicarboxylate transporter.
4205	50	40	Os03g0737900|COMBINER_EST|CI393255|4	TAGTTGGTTGTGCCTTATTTGTATTGTTTGGGTACATTACAGATTGTTGCTCTCTATGTT	Os03g0737900	CI393255	Conserved hypothetical protein.
4206	50	41	Os06g0479200|mRNA|AK099423|CDS+3'UTR	TGGCTACCATCTATCTTTATGTATGACTACCATATATATCAATGAGAAACCATGTGATCC	Os06g0479200	AK099423	Conserved hypothetical protein.
4207	50	42	Os11g0244200|mRNA|AK107883|CDS+3'UTR	GAATAGTGATCGGCGACACCTATGTGTAATACTATGATCATAATGAAGATTATTTTATGC	Os11g0244200	AK107883	Similar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment).
4208	50	43	Os06g0664200|mRNA|AK058691|UTR	GGGACAACACAAATTTATATGTAATGCATCCTTTGGCTACATGGACACTTTTATCTGCAA	Os06g0664200	AK058691	Inositol phosphatase/fructose-1,6-bisphosphatase family protein.
4209	50	44	Os01g0566200|mRNA|AK106499|CDS+3'UTR	GCCGATCGGCTTCTTTTCTGAGTCGGGTTGGCATGAACCAGAATTTAGCCCGGCCCAAAA	Os01g0566200	AK106499	Conserved hypothetical protein.
4210	50	45	Os04g0116800|mRNA|AK119922|CDS+3'UTR	TTCCCAAAATTGTCAAAAGGACTGCATAGTGCGCGCTGTTACTACTGCATGCAACACGTT	Os04g0116800	AK119922	Similar to Very-long-chain fatty acid condensing enzyme CUT1 (Very-long-chain fatty acid condensing enzyme (CUT1); 56079-54227).
4211	50	46	Os12g0219700|mRNA|AK062524|CDS+3'UTR	CGGACATTGGGATCAAGTTCATGAGCTCTACTCGGATTAAAATTGCTCTTTTATATTGTT	Os12g0219700	AK062524	Conserved hypothetical protein.
4212	50	47	Os01g0257300|mRNA|AK070626|CDS+3'UTR	TTGTATGTGTATCATGTACATGAGTGAGTGTGGCTGATGCATATATATAGAGGTCTTTAA	Os01g0257300	AK070626	Conserved hypothetical protein.
4213	50	48	Os08g0500400|mRNA|AK111024|CDS+3'UTR	ACTTGTTGAGTGGAGTATCATATGATTTGTATGGTCTTGTTAACTTGGAGATTTGGGGTT	Os08g0500400	AK111024	Conserved hypothetical protein.
4214	50	49	Os04g0461000|COMBINER_EST|CI523687|6	TGTTCGGTGTTCTTATAGAATGTGTAAAACACTGAAACTACTATCAGAGAATGTAGCATC	Os04g0461000	CI523687	Similar to Myb-related transcription factor LBM1.
4215	50	50	Os01g0192900|COMBINER_EST|CI458827|1	TTTGTCTCTCTCACATGTTGGAGAGACGACAAATTAATACAGATAAGACTGGTCTAGCTC	Os01g0192900	CI458827	1-aminocyclopropane-1-carboxylate synthase family protein.
4216	50	51	Os04g0627000|mRNA|AB101645|CDS+3'UTR	CTGTGTCCCTGTCTTATACTTTTAGTTCTCTTCAGTGTTTGATCAGTGCTGTTTCAATCC	Os04g0627000	AB101645	Similar to Roc1.
4217	50	52	Os05g0499100|mRNA|X63990|CDS+3'UTR	GAAATGTTTTGAAAACAAAATAGCTGGTGATAAAGTACTATATATGATTTTGTGCGTTCT	Os05g0499100	X63990	26 kDa globulin (Alpha-globulin).
4218	50	53	Os01g0718300|mRNA|AK101085|CDS+3'UTR	TGTACATATATAAATGTTGAATTTTCTTTGGCGCAAAATCAAAATCCGCCTAGGTTGCTC	Os01g0718300	AK101085	Similar to Systemin receptor SR160 precursor (EC 2.7.1.37) (Brassinosteroid LRR receptor kinase).
4219	50	54	Os09g0325700|mRNA|AK063334|CDS+3'UTR	GTGATGGGGTTGTGCAACTGCTAGTTGGTGTAACCAGAATTTCATCTGGATACCAACTGA	Os09g0325700	AK063334	Similar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16).
4220	50	55	Os01g0770400|mRNA|AK061253|CDS+3'UTR	CAGAAAAGTTTGAGCCGTGCTGCCTCATGTGACCTTGTAACCTTTTGTGTATCAGACTAC	Os01g0770400	AK061253	Cyclin-like F-box domain containing protein.
4221	50	56	Os02g0717500|mRNA|AK067050|CDS+3'UTR	GGTGATCCGTTTTGGGATGTGTTCTTAGTAGGAGGGATTCTTTGATCAAAGGAATCCCTT	Os02g0717500	AK067050	Conserved hypothetical protein.
4222	50	57	Os03g0129000|mRNA|AK073895|CDS+3'UTR	ACTCGTTCATCTGGAACCTTTTGCAGCTAAATCCAGATTTATGTCATTTAGCTTTCATAT	Os03g0129000	AK073895	Phospho-ethanolamine N-methyltransferase family protein.
4223	50	58	Os11g0148200|COMBINER_EST|CI260209|6	GAGCTCCAGCAATGAATGATGTAAATATATAATTCTACTACAATCCGCGAGAAACGTGAC	Os11g0148200	CI260209	Conserved hypothetical protein.
4224	50	59	Os07g0139400|mRNA|AB096864|CDS+3'UTR	GCTCACTCACAGAAGTTATATGTAATATAGCGCTTATGGTCATTCGTTCAATTCTTGAGA	Os07g0139400	AB096864	UDP-glucose 4-epimerase family protein.
4225	50	60	Os04g0632300|mRNA|AK064596|CDS+3'UTR	AGGTATGCGCCGTCTCATGATGTTTTCTCTAGCAATTGCCCCACATTCTCCATGAACATG	Os04g0632300	AK064596	Non-protein coding transcript, unclassifiable transcript.
4226	50	61	Os10g0464000|mRNA|AK103475|CDS+3'UTR	TGCATGTGTGCTGTGAGAAAAATAATGTTGTCAGCCTGTATATCCTCAATATATAGCCTT	Os10g0464000	AK103475	Similar to Hypersensitive-induced response protein.
4227	50	62	Os12g0517000|COMBINER_EST|Os12g0517000|8	TGCACGGAATTTGGATTCTCTGATTGTTCAAGGCTGTCGCGTTTCTTGGAAAGCTGTGAA	Os12g0517000		Cyclin-like F-box domain containing protein.
4228	50	63	Os08g0209000|COMBINER_EST|AU160989|7	ATGATAGTGACTACCCTCAGCAGCAAGGTGAGGATACCGGTTATGAGTTATGCTTCTTGT	Os08g0209000	AU160989	Hypothetical protein.
4229	50	64	Os02g0518100|mRNA|AK103390|CDS+3'UTR	TAAACACGCCACACATGTTAGAACAAACTTCAATGATTCAATTCACTCTTCCCATTGGTG	Os02g0518100	AK103390	Protein of unknown function DUF803 family protein.
4230	50	65	Os07g0685300|mRNA|AK067645|CDS+3'UTR	AAGGAAGGTGCTTTAATTTCTCTGAATATATGTAATCTAGTTCATGTAGAGACTGATCGG	Os07g0685300	AK067645	Similar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1).
4231	50	66	Os07g0574400|mRNA|AK061367|UTR	GTATTCCATGATGCAAAGTTGATGTTGGCTATTGTCTCGGCGTTTCGAATAAAGATTGTT	Os07g0574400	AK061367	Non-protein coding transcript, uncharacterized transcript.
4232	50	67	Os07g0222100|COMBINER_EST|Os07g0222100|8	GCGATGTGCCAGTGTACTGAGAAGAAGTGAAGCTTGTGATATTATATTATTTTCAAAAAA	Os07g0222100		Similar to Alpha-amylase inhibitor 4 (SI alpha-4).
4233	50	68	Os10g0560400|mRNA|AK109732|CDS+3'UTR	AGGCCAAGCATGCATTGACTAGCTAGGCTATTGGTTGAAAAGTTTAAGGTTTAATTAAGG	Os10g0560400	AK109732	Similar to CONSTANS-like protein CO9 (Fragment).
4234	50	69	Os10g0335200|mRNA|AK064034|CDS+3'UTR	TGCTAGGTTAGATCAGTTCCGTGTTGATTTGTGCAATTGGACTGGCTAGTTCGGTTCCTT	Os10g0335200	AK064034	HNH nuclease domain containing protein.
4235	50	70	ETG05_36762		
4236	50	71	Os01g0592300|COMBINER|CI270094|6	GTCTTCAAGGGATATTGGTGTAAATGTCAGTCGAGGTATACAATTAGAGCTTCAAAGCAG	Os01g0592300	CI270094	(No Hit)
4237	50	72	Os01g0112800|COMBINER_EST|Os01g0112800|8	CAGCGCACTCGAAGAGGAAAGCAAAAGATTCACAGAAGAGAAAGAAAGATACTACTCAGA	Os01g0112800		NBS-LRR disease resistance protein homologue (Fragment).
4238	50	73	Os01g0957000|mRNA|AK099730|CDS+3'UTR	GTATACTGGTATATATATGTACCCCCATGATCTGAATGAAATAATTTGACCATGGAAAGG	Os01g0957000	AK099730	ATP-NAD/AcoX kinase family protein.
4239	50	74	Os01g0609900|mRNA|AK121722|CDS+3'UTR	ATGAATGTAAAGTATGGCCTTCAATGTTTTCATTTTTGTCGAATTAATGAAAGCAGAAAA	Os01g0609900	AK121722	Similar to PDR-like ABC transporter (PDR4 ABC transporter).
4240	50	75	Os07g0124900|mRNA|AK060057|CDS+3'UTR	TTATATATATATGTACGTTGTCGTTCGAATAAAAGAAGAAAATAAATGAGAAAATTAATT	Os07g0124900	AK060057	Allergen V5/Tpx-1 related family protein.
4241	50	76	Os07g0557100|mRNA|AK102045|CDS+3'UTR	TGCTGTAGTTCAACCCCGTCGTAAATTTTGGGGTTCAATATAATCTGCAGCGCTTGCGTT	Os07g0557100	AK102045	Delayed-early response protein/equilibrative nucleoside transporter family protein.
4242	50	77	Os05g0292700|mRNA|AK058501|UTR	AGACAGGAAAGAGTAAATATTCGCCCGCGAAATTTTTATTGAATTAGAATACTTTACCGC	Os05g0292700	AK058501	Chloroplast 50S ribosomal protein L14.
4243	50	78	Os12g0621500|mRNA|AK111785|CDS+3'UTR	AGAATGGCACCCACTGTTTTGGCAAAATAGGTATACCTTTCTCAAAACTTGTGAGTGGTG	Os12g0621500	AK111785	Similar to IRE.
4244	50	79	POsControl0015|genome		
4245	50	80	Os02g0609200|COMBINER_EST|CI380327|6	TCCCGGTGAGAAATCAGCTCGAACCGCACGGTTAAATGCTATAGCATCGCGACGATCCTC	Os02g0609200	CI380327	Similar to ATOZI1 protein (Stress-induced protein OZI1) (AT0ZI1 protein).
4246	50	81	Os12g0257000|mRNA|AK072798|CDS+3'UTR	CATCAAAATGTCAATCCTTTTTTCTGATATTTTGTATTCTCAATTTCTGATTGTCAATCC	Os12g0257000	AK072798	Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C).
4247	50	82	Os01g0631400|mRNA|AK100804|5'UTR+CDS	CGTCGTGAACAGGGAGAGCACCAAGACCGCGCGGCTGCCGCGGGACAGGTACCCGAAGCC	Os01g0631400	AK100804	Six-hairpin glycosidase domain containing protein.
4248	50	83	Os05g0108400|mRNA|AK119954|CDS+3'UTR	GATACCATGTTGATTAGATCGGGGATTCTTGATCGAAACGAAAATGCGAAGTTGTGAGCC	Os05g0108400	AK119954	Protein of unknown function DUF868, plant family protein.
4249	50	84	Os02g0625000|mRNA|AJ298876|CDS+3'UTR	TGACACATTCTGTAACTAGCTGAGAACTGAGCTGACACGGTTTCCTCGCCCAAAAGAAAA	Os02g0625000	AJ298876	Similar to Deoxyribodipyrimidine photo-lyase (EC 4.1.99.3) (DNA photolyase) (Photoreactivating enzyme).
4250	50	85	Os01g0296100|mRNA|AK063982|CDS+3'UTR	GTACTCTTCCCCCACTATTCAATTTCAAGCCTCGTGAGCTGAAAGGAGCATCAATGGAAT	Os01g0296100	AK063982	Similar to Shaggy-related protein kinase alpha (EC 2.7.1.-) (ASK-alpha).
4251	51	1	Os05g0365000|COMBINER|CI252859|6	GAATTCTCAGCGCGATTCGGCGCGATCGATTAAGAGTGTAACTTCTGATGATTTGCACAA	Os05g0365000	CI252859	Conserved hypothetical protein.
4252	51	2	Os05g0582200|COMBINER_EST|Os05g0582200|8	ATTGGACATACAAGGCGATAACGGGCCTTCATCCACTTCGGTTCCAATGGATGAAATCAA	Os05g0582200		Retrotransposon gag protein family protein.
4253	51	3	osa-miR159b|Os01|Mature	TTTGGATTGAAGGGAGCTCTGTTTGGATTGAAGGGAGCTCTGTTTGGATTGAAGGGAGCT			miRNA
4254	51	4	Os11g0171700|mRNA|AK064084|CDS+3'UTR	GCGGTGGCTACATTTCTGTTGGTATGATTTCCATGCCTAATGAAAGTCTGAAAGAAACTA	Os11g0171700	AK064084	SMAD/FHA domain containing protein.
4255	51	5	Os05g0298200|mRNA|AK066758|CDS+3'UTR	TCATATGAGGTTAGTGAGTATAATTTGTAGCAGAGTAAATTACATTGGTGGTACACGAAC	Os05g0298200	AK066758	Ankyrin repeat containing protein.
4256	51	6	Os01g0290600|COMBINER_EST|AU173241|7	ATAATCTGAACCCGGACTTCCAGAGAGCTTTGCAGCTGTTGTAGATCTGACTGCACGACT	Os01g0290600	AU173241	Aminotransferase, class V family protein.
4257	51	7	osa-miR395i|Os08|5'seq	GTTTTACCGGGAGTTCTCTTCAAGCACTTCACGTAGAGCTTTCTATTGACATGGAGCTTT			miRNA
4258	51	8	Os07g0673100|mRNA|AK060100|CDS+3'UTR	TTAACATATCTGGAATACATTTTACATTGTATGTCGTGGTGCAGAAAAGATCTTTACTAG	Os07g0673100	AK060100	Ribosomal protein S8E family protein.
4259	51	9	Os01g0880200|mRNA|AK105039|CDS+3'UTR	CTTGTGTTTGCTATCATGGCTTCGGCTCCACTCTGGCTGCTTTGATAGCTCACAATTTTT	Os01g0880200	AK105039	Glycosyl transferase, family 8 protein.
4260	51	10	Os03g0311300|mRNA|AK109395|CDS+3'UTR	GCAAAGTTTATTTCAATAAAATAATGCATCTCTTGTATTTGAAACTGGAAAGAAAAAAAA	Os03g0311300	AK109395	Soluble quinoprotein glucose dehydrogenase domain containing protein.
4261	51	11	Os06g0609400|mRNA|AK109185|CDS+3'UTR	GGACATAAATTTCAGTCATCGGTTTAATAAACAGCAAATATCAGGTTGAGAATTTTTCAT	Os06g0609400	AK109185	Conserved hypothetical protein.
4262	51	12	Os02g0256500|mRNA|AK109155|CDS+3'UTR	CAAAGATCCTGTGTGTTTGCTTCTGTGTTTGTGTTTCTTCCTCGCTGCCTCGTTCAGAAA	Os02g0256500	AK109155	Conserved hypothetical protein.
4263	51	13	Os04g0542800|mRNA|AY512582|CDS	GATTTGGACGTTCCCTTCGTCGCTGCTCGCGCTGGCCAAGGTCAAGCCACCCATCTGCAT	Os04g0542800	AY512582	Similar to Iron-phytosiderophore transporter protein yellow stripe 1.
4264	51	14	Os05g0116100|mRNA|AB037970|CDS+3'UTR	CTAGTACAATATGTTATATGAATAATGGAGATGCAGCCTGCAGCTGCTCTTGCTTGGAGC	Os05g0116100	AB037970	Dehydroascorbate reductase.
4265	51	15	Os05g0580000|mRNA|AK100910|CDS+3'UTR	CAGCAACTTTTTGGAGGGTCGTTGGTGCATCTCATGTGTAAATAAACTCAAAACTGGTAA	Os05g0580000	AK100910	Similar to ADP-glucose pyrophosphorylase (EC 2.7.7.27) (Fragment).
4266	51	16	Os06g0584000|COMBINER_EST|Os06g0584000|8	ATGCGACCCAGAAGCAGTTCAGCAACAAGGACCTGATCAAGCCCAAGCCTGGATCCTACG	Os06g0584000		Pectate lyase/Amb allergen family protein.
4267	51	17	Os01g0191900|mRNA|AK109125|CDS+3'UTR	CATCGCGTAATTACAAGAAGCGTGTAGTGTACTTGAACATGAGAAAATTCATCAGGTGCA	Os01g0191900	AK109125	Similar to Blind.
4268	51	18	Os12g0485500|mRNA|AK071132|CDS+3'UTR	TTGATCTCTCATGTAACGGGATTTTATGCCATTTATGCTTTTCCTGGTTGGAAGTTGATG	Os12g0485500	AK071132	Similar to HesB/YadR/YfhF family protein.
4269	51	19	Os08g0117800|mRNA|AK100696|CDS+3'UTR	ACAGATCTACTAGTAGAGTAGTAAGTCTCCAAAGAGAGTTAAGAGCAAGTACCATTGCTT	Os08g0117800	AK100696	Sodium/hydrogen exchanger family protein.
4270	51	20	(+)eQC-42		
4271	51	21	Os03g0802300|mRNA|AK105727|CDS+3'UTR	AGGCAAGCAGTGTATTGTAATTGTAGATGTATAAGTGGTTACTAACTGAGGTGATAAGAT	Os03g0802300	AK105727	Conserved hypothetical protein.
4272	51	22	Os10g0563500|mRNA|AK110827|UTR	CACAGAACGAAGTGGCTGTCAGATTATCTAAGAAAGAGCAAGATAGAAAGATTATGAAGC	Os10g0563500	AK110827	Protein kinase-like domain containing protein.
4273	51	23	Os08g0428800|COMBINER_EST|Os08g0428800|8	GGACCCCCTGTGCAATTTCGATTGTCAGGGTTGTTAGAATTCCTCAGATTCAATGACGAA	Os08g0428800		Similar to High mobility group I/Y-2.
4274	51	24	Os02g0617200|COMBINER_EST|CI448215|6	ATGAGATATTCACAGATGTTCACCTGATTTTAGAGAGGCTTGCCTTGTCCAGCTACAGGG	Os02g0617200	CI448215	Conserved hypothetical protein.
4275	51	25	Os12g0291100|mRNA|AK068555|CDS+3'UTR	AAACAAAGCTCCGGCTATATACACACAAGATATGTATCTAGAGCATATCTGATAAATTCG	Os12g0291100	AK068555	Similar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment).
4276	51	26	Os10g0516400|mRNA|AK059344|CDS+3'UTR	AGTATTGGTAGTAGTACGCTTTTGTGTAGCGGCAAATCAATCTATCTATGAGTCCTCAAT	Os10g0516400	AK059344	Conserved hypothetical protein.
4277	51	27	Os03g0822400|mRNA|AK102425|CDS+3'UTR	AAGTAGCTGTATCTATCTACCGCCCTGCGTGTGAAATCCTGTTAATTTAGCAGGGGGAAA	Os03g0822400	AK102425	Conserved hypothetical protein.
4278	51	28	Os09g0134400|mRNA|AK069256|CDS+3'UTR	AGAGTCTTGTCGTGCTTGGTTTTCATTTTTCATTGTGGCTTGTGTTTTGTTTTATGGTTG	Os09g0134400	AK069256	Conserved hypothetical protein.
4279	51	29	Os03g0754100|COMBINER_EST|CB643099|7	CACAAAATCAACATGCTCAAATACACAATTGACAACAACGTTGGCGGAGCAGACCCTGTG	Os03g0754100	CB643099	Hypothetical protein.
4280	51	30	Os01g0518400|mRNA|AK069603|CDS+3'UTR	GCGTAGAGCTTATGGAATTAAACGTGTTGATACTAACTGAGAGCTCCTGAGCTCCTGGTT	Os01g0518400	AK069603	Zinc finger, BED-type predicted domain containing protein.
4281	51	31	RC12		
4282	51	32	Os03g0718100|mRNA|AB047313|CDS+3'UTR	AGGGTACCAGAAAAAATACGTGTTCTGGTTGTTTTTGAGTTGCGATTATTCTATGAAATG	Os03g0718100	AB047313	Actin 1.
4283	51	33	Os12g0299500|COMBINER_EST|CB668558|7	ACAGTGACAACCCACCCAACCTTGCAAGCACAAGTAACATGCTATCATAAGTGCAAAACT	Os12g0299500	CB668558	Hypothetical protein.
4284	51	34	Os08g0233500|COMBINER_EST|CB684271|7	GGCTCCATCACCGAAGAGGAGAAAACTCAGGTAATAAGCTCGATCCACAAAAATCTGACT	Os08g0233500	CB684271	Hypothetical protein.
4285	51	35	Os10g0545400|COMBINER_EST|Os10g0545400|8	GTACTACTGGCAGAGATCATATCCTGTGGAAGTTTACCATGATACTAGTTCGGCAATTAA	Os10g0545400		Nucleic acid-binding, OB-fold domain containing protein.
4286	51	36	osa-miR396b|Os06|5'seq	CTTTGTGGTCTTCCACAGCTTTCTTGAACTGCATCTTTGAGAGAGATTAGCATCCCTATG			miRNA
4287	51	37	PGmControl0003|mRNA|AF035255|3'UTR		
4288	51	38	Os01g0327100|mRNA|AK070715|CDS+3'UTR	TACGGCGCTACTCATAATTCACCAAAAACATACGTGTACATAGAAAAAATAGATCAATGG	Os01g0327100	AK070715	Haem peroxidase family protein.
4289	51	39	Os09g0547800|mRNA|AK073122|CDS+3'UTR	CTTGCGGGCTTGTGATATCTATTTTGTTGCCATGGAGATGCCTGGCGCCATGATAATTAA	Os09g0547800	AK073122	Cyclin-like F-box domain containing protein.
4290	51	40	Os11g0514800|mRNA|AK064017|CDS+3'UTR	TGGCATTGAGCCAAAAAGAAATCAGAATATGTACCTTCTGTGTAGTTGAAAGTATCTATC	Os11g0514800	AK064017	Hypothetical protein.
4291	51	41	Os06g0138000|mRNA|AK063880|CDS+3'UTR	TGTAAATAACTAGTCTCTGCTTAGCTGTGTGAGGTTGCAACAATAGCGAAATGTTTCCCA	Os06g0138000	AK063880	Similar to IMB1.
4292	51	42	Os05g0537400|COMBINER_EST|C97686|6	TGCTGGGCTTCAAGAAATTGTACATGTATATGCTAGATGTATCTTCCATCTAGGGATAAA	Os05g0537400	C97686	Similar to Protein phosphatase 2C.
4293	51	43	Os04g0631900|mRNA|AK064630|CDS+3'UTR	TTTGCAGCTCAGTATGGATATGGGCAAGCCCAGATTGATTCGGAAGCAATGGTTTACGAT	Os04g0631900	AK064630	Hypothetical protein.
4294	51	44	Os01g0970600|COMBINER_EST|BI305247|7	GATGCAAGCTTGTGCCATATGATTGAGAAGCGTGCTCTCAGTCTTCAGTCTATGAGAGTA	Os01g0970600	BI305247	DEAD/DEAH box helicase domain containing protein.
4295	51	45	Os11g0516400|mRNA|AK062966|UTR	GATAACTTAGGTGTACGGTGCAAATGTTTTTCGGTAATAAATAGAGCTATATTGTTGCCT	Os11g0516400	AK062966	Non-protein coding transcript, putative npRNA.
4296	51	46	Os08g0483100|mRNA|AK099821|CDS+3'UTR	TGGTTGTGAAGTTTGTGTAGATAGGATTATCATCACGCAAAATTGGCATCATTTCTATTC	Os08g0483100	AK099821	Conserved hypothetical protein.
4297	51	47	Os11g0303300|COMBINER_EST|Os11g0303300|8	GCCGACGGTGTTGTTGAGTACGTGGCAGGTGACATGTTCGACTTCATCCCACCGAGTCAA	Os11g0303300		Winged helix repressor DNA-binding domain containing protein.
4298	51	48	Os01g0604700|mRNA|AK063423|CDS+3'UTR	AATGCATTAACGGAATTACTGAGGACAGACGTTATAATCAATAACAGAACGGTAAACAAC	Os01g0604700	AK063423	Conserved hypothetical protein.
4299	51	49	Os02g0717700|mRNA|AK063075|UTR	TCCGATTGAGAGTTCTACTTGTAGAACGACAACTTTGGTGATATGTTGCGTGATTAGCTG	Os02g0717700	AK063075	GCN5-related N-acetyltransferase domain containing protein.
4300	51	50	Os01g0842400|mRNA|AK059101|CDS+3'UTR	GTTCTTTTTTCTTTTATTTGTGTACAACTATACAATGACACTGTTTTGATGCTTCTTTGA	Os01g0842400	AK059101	Similar to Laccase (EC 1.10.3.2).
4301	51	51	Os07g0512200|mRNA|AJ417518|CDS+3'UTR	TCATTCTGGGTTGATGACGTTTCTTATTCTACCATTATGCATTTGCAACGTGTTTTAAGT	Os07g0512200	AJ417518	Similar to Symbiosis-related like protein.
4302	51	52	Os05g0410200|mRNA|AK072435|CDS+3'UTR	TGATAAAGGGTGGCATTGCATATTTGCATGTGCATTTAAATCTTTAATTACTCTATCCGC	Os05g0410200	AK072435	Esterase/lipase/thioesterase domain containing protein.
4303	51	53	Os01g0921300|mRNA|AK106015|CDS+3'UTR	AGGTTTACTGACGCACTAACATTTTTGTCCCCTTTTTTGTTCCTTCTATGACATCCTAAC	Os01g0921300	AK106015	Exostosin-like family protein.
4304	51	54	Os03g0200500|mRNA|D26060|CDS+3'UTR	TTTGTTGGGATTACTTGCCAGCTGCATATTTGCTTTCTGATGAGAAATGAATGTTTTTGA	Os03g0200500	D26060	40S ribosomal protein S3a (CYC07 protein).
4305	51	55	Os01g0680700|mRNA|AK120014|CDS+3'UTR	GCATTCAAGCATGCTGTAGTTTAATGAGCTCCTGTAACATACTAACATGCATATATTTTC	Os01g0680700	AK120014	Protein of unknown function DUF1639 family protein.
4306	51	56	Os04g0605200|mRNA|AK108075|CDS+3'UTR	ATGTTTTTGCCATGGGACCATGGTGGCGGGTTGATGAAGCAATCAGTGAGAAATTGACAT	Os04g0605200	AK108075	Low molecular weight phosphotyrosine protein phosphatase family protein.
4307	51	57	Os04g0689700|mRNA|AK066225|CDS+3'UTR	ATGGAACTGGAAGTCTTAAAATTTTGGCCTTGTTTACTTCCTTGCCATTCTCAACTATTC	Os04g0689700	AK066225	Nucleotide-binding, alpha-beta plait domain containing protein.
4308	51	58	(+)E1A_r60_a20		
4309	51	59	Os08g0560000|mRNA|AK107230|CDS+3'UTR	TTTCAAAGTCAACGTGATTGTACCTTGACGTACATAGTACTGAATCATGTACGTCATCAC	Os08g0560000	AK107230	2OG-Fe(II) oxygenase domain containing protein.
4310	51	60	Os01g0510800|mRNA|AK120931|CDS+3'UTR	GATGCTAGATTTAATCGCTTGGTGACTTGCTGCTGCAATATTTTATGTGCTGATTTCTTG	Os01g0510800	AK120931	TATA box binding protein associated factor (TAF) domain containing protein.
4311	51	61	Os10g0519800|mRNA|AK108172|CDS+3'UTR	TATGTGGCCAAACATTTGGCTGGGTTTAATTTAGTTTCAACTTTCAAGTACTGTGAATGA	Os10g0519800	AK108172	Protein of unknown function DUF295 family protein.
4312	51	62	Os06g0496800|mRNA|AK069969|CDS+3'UTR	GGAGAGTTAGTGAAGAGATCCACGAGGAAAATGTAATTAAGTATTATCCTTCCACAAGAG	Os06g0496800	AK069969	Similar to S-locus receptor kinase precursor.
4313	51	63	Os09g0352400|mRNA|AK061996|CDS+3'UTR	AGCGTGTAGCTGTAATATACGTCACCAGAATTGTAGTGTTTTGTACACAAATTGTCTTTA	Os09g0352400	AK061996	Similar to Bystin.
4314	51	64	Os05g0344200|mRNA|AK098850|CDS+3'UTR	AAATGCTGATGTAATAAAGATTGCAGCGAGAGATTTCGCAGCTGCTGCCTTGTAATTTCC	Os05g0344200	AK098850	Conserved hypothetical protein.
4315	51	65	Os04g0634800|mRNA|AK107772|CDS+3'UTR	TCTCAGATGTGAATGAAGATGTAATTAAGTATGTGAATCATCGTCTATGGATGCCGAAAA	Os04g0634800	AK107772	Conserved hypothetical protein.
4316	51	66	Os05g0213900|COMBINER_EST|CI550210|0	CGCGTTCTTATCTTTATTTAACTTGTATAATTATGAGTGTGCTTAGGGCATCCACAATAG	Os05g0213900	CI550210	Virulence factor, pectin lyase fold family protein.
4317	51	67	Os07g0220600|mRNA|AK102969|UTR	TTTTTTATTGAGAGAATCCCTTATATGCCACTCCAAATTAACCGGTTTCCTTTATGCCAC	Os07g0220600	AK102969	Non-protein coding transcript, uncharacterized transcript.
4318	51	68	Os05g0406600|COMBINER|CI426437|x	AGTTGATAGACCTATTATATCTGGTTTTCCAGTTAAAGTATGAAAATCGGATTCGTCGAC	Os05g0406600	CI426437	Conserved hypothetical protein.
4319	51	69	Os01g0600900|mRNA|AK121563|CDS+3'UTR	ATATGGTGTTGTGAATTAATTATAAAATTAGCTTGTTTAATCCTGCGTGCTACTTAATGA	Os01g0600900	AK121563	Chlorophyll a-b binding protein 2, chloroplast precursor (LHCII type I CAB-2) (LHCP).
4320	51	70	Os06g0644800|mRNA|AK109442|CDS+3'UTR	GCTTCTGTACTAGTGCAAACGAAGTACTAAATTTCAGTGTCAAACTGTAGACAGTAACAT	Os06g0644800	AK109442	Mannose-6-phosphate receptor, binding domain containing protein.
4321	51	71	Os05g0430300|mRNA|AK064776|CDS+3'UTR	TACAAAACATTTCTTTAGTTGATTCTGCCTGTACAAGAAATGCAAGTTTGTTCTTTGTTT	Os05g0430300	AK064776	Protein of unknown function DUF668 family protein.
4322	51	72	Os03g0809700|mRNA|AK071374|CDS+3'UTR	AGCCCCTTGTGCGGTTATGCCTGTAAATTGTGAGTGAATTGGTTAAAAGAAATGTTTATG	Os03g0809700	AK071374	Similar to Kinase associated protein phosphatase.
4323	51	73	Os01g0315800|mRNA|AK061857|CDS+3'UTR	GTAAGCTACTGTCTTTTTTGGTCTTGCTCATAGAAGCCATATGGTGTTATACATGTAATC	Os01g0315800	AK061857	UDP-glucuronic acid decarboxylase (EC 4.1.1.35).
4324	51	74	Os01g0134500|mRNA|AK112014|CDS+3'UTR	ACAGTTGTGGCCAGCTTTTGTACAGCAATAACTGTTTTATTGTAACTGCTGCCATCCTTT	Os01g0134500	AK112014	Similar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase).
4325	51	75	Os01g0209200|mRNA|AK103145|CDS+3'UTR	TGATTCTTCGACTTCTTGAGCAACATCGTGTACTAAGCACTCGCTGATCGCTCTTTTGCA	Os01g0209200	AK103145	Similar to 14-3-3 protein 7.
4326	51	76	Os02g0723400|mRNA|AK108275|CDS+3'UTR	ATCGTGTAATTGAAATCTTGCCTTTTCTAATATATTGACATGTAACTCTTTTGCGCATTC	Os02g0723400	AK108275	AUX/IAA protein family protein.
4327	51	77	Os03g0122300|mRNA|AK071416|CDS+3'UTR	GTGTTTAATGCAGGCTTCAAGGAAAGGCTGTTGTTTTTGCAATTGATTTTATTTGAACTC	Os03g0122300	AK071416	Similar to Flavanone 3-hydroxylase-like protein.
4328	51	78	Os03g0640600|COMBINER|CI532809|6	GCCCCTAGTCTGTAATCTGGAATGATTTTAAGTACGACTGGTATGTCTTATTTTGGCACC	Os03g0640600	CI532809	(No Hit)
4329	51	79	Os02g0709400|mRNA|AK072218|CDS+3'UTR	GCCATAGCGTTTTCATTGATTGCCTGTATGTAATCGAAATCTGATCTCATTCAATGGAAG	Os02g0709400	AK072218	Dek1-calpain-like protein.
4330	51	80	Os05g0176500|mRNA|AK099352|CDS+3'UTR	TCTCGTTTCAGCATATTGAGGGATGATTTTTTTTCCTCGCGGTTAATAAGCGTAAATTGG	Os05g0176500	AK099352	ATP10 family protein.
4331	51	81	Os01g0384300|COMBINER_EST|Os01g0384300|8	TAGCAGTGGCTCAGGTCAGCTGTTTAGTCCCTCTGGTTTCCGGTCTTTTACTCATATAAA	Os01g0384300		Protein kinase-like domain containing protein.
4332	51	82	Os10g0550200|mRNA|AK066785|CDS+3'UTR	TGTCAGCAATTCGCTCTTGGGAGGAGCTATATTTGTTTAACCAGATCTTATCCTGTTTTT	Os10g0550200	AK066785	Conserved hypothetical protein.
4333	51	83	Os09g0505600|mRNA|AB014058|CDS+3'UTR	CTGCCTTGATGCAAATGAGACCGAACATATTTATTGTCAGAAATATCACAATGGTCGATA	Os09g0505600	AB014058	Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit beta-6).
4334	51	84	Os06g0193000|mRNA|AK065085|CDS+3'UTR	GGTGATGGTAAAATCTGTAGAACCATATCCTCTCTTTACAGAATCTACAGAACAGCTTTG	Os06g0193000	AK065085	Similar to Ubiquitin conjugating enzyme 2.
4335	51	85	Os01g0834400|mRNA|AK108142|CDS+3'UTR	ATGGCATGTGTTCTAGAGGGGGCATTCAATATTTAGGTATCTCAAGAATGTACCAAATAC	Os01g0834400	AK108142	Similar to HAP3.
4336	52	1	osa-miR395t|Os09|Mature	GTGAAGTGTTTGGGGAAACTCGTGAAGTGTTTGGGGAAACTCGTGAAGTGTTTGGGGAAA			miRNA
4337	52	2	Os06g0218600|mRNA|AK072802|CDS+3'UTR	GCTGTGTTTGAATTGACTTCCTGTTAATTTGTTGTCCTATCTATGTCATGGATTTTTAGC	Os06g0218600	AK072802	Cupredoxin domain containing protein.
4338	52	3	Os02g0179300|mRNA|AK104908|CDS+3'UTR	AGGGACGGATCCTTTTGTCCATCCGTTTTTAGCCAGAAATTTCAATGGATGTGAATTGTG	Os02g0179300	AK104908	Similar to RAD23 protein, isoform II.
4339	52	4	Os01g0644200|mRNA|AY549310|CDS+3'UTR	GGCCAACGTCGTCTACCCGCGGATCACCAGCGCGATCCCCATCTAATCGACCCGGCGTCC	Os01g0644200	AY549310	Conserved hypothetical protein.
4340	52	5	Os03g0339900|mRNA|AK068987|CDS+3'UTR	TGAAACGATAATTGTATTGACCATTTAATTGAAAACATGTTTTATTCACTTTGCCATGTG	Os03g0339900	AK068987	Similar to Serine/threonine protein kinase.
4341	52	6	Os05g0424800|mRNA|AK121054|CDS+3'UTR	TTCTTTCAAATACAATAGGCAAATAGCTCACTCATAATACAAGAAGAGGTTGAAAGAGCG	Os05g0424800	AK121054	Similar to AER274Wp.
4342	52	7	Os04g0670200|mRNA|AK073373|CDS+3'UTR	ATCTTCTCCAATTTGTACTCTATATAATTTATCATCTCAAGAATACATTAACGAAGATCC	Os04g0670200	AK073373	Similar to Oryzain beta chain precursor (EC 3.4.22.-).
4343	52	8	Os01g0957800|COMBINER_EST|CI397901|1	TTGGGTTGGTCCACCAATATGCAGATATACAGTGTCAAGTGTTTGGTCTATGAATAAAAT	Os01g0957800	CI397901	Cytochrome P450 family protein.
4344	52	9	Os09g0125900|mRNA|AK065634|CDS+3'UTR	TTTTCTAACCGGGACTACGAATCCGGGACTAAAAGATGTCCAGTTTTAGTCCCGGTTGAA	Os09g0125900	AK065634	Similar to PDR15 ABC transporter.
4345	52	10	Os02g0822100|mRNA|AK065330|CDS+3'UTR	CGAATAATTTGTATAGGCAGGAGAAGAGAAAATCAATGAAATGCATGCCCCTATCGATGC	Os02g0822100	AK065330	Citrate transporter family protein.
4346	52	11	Os11g0440200|COMBINER_EST|Os11g0440200|8	ACAGTTACTTGCATTATGGGCTCCAAGCTTCTCGCGTCGAGATTCTTAAGACGAAGAATG	Os11g0440200		Similar to Apyrase-like protein.
4347	52	12	Os04g0515300|mRNA|AK062092|CDS+3'UTR	TTGAACTCCTGTGTTTAGACCTTGTGCCACAAATTCTATTCAGAATCTAAGATAGTATGC	Os04g0515300	AK062092	Ribosomal protein L14 domain containing protein.
4348	52	13	Os03g0198600|mRNA|AY554034|CDS+3'UTR	TGTGTTTAGAATATCATGCAAGTGGTTGCCATGGACTGATTAATTATGCCATGATGTAAT	Os03g0198600	AY554034	Similar to HAHB-7 (Fragment).
4349	52	14	Os05g0475500|COMBINER|CI276250|6	ACACTTCCCTGACATGCCAACGGGGGACAACGTGTTGAACACACCAGCATGGGGACTTCA	Os05g0475500	CI276250	(No Hit)
4350	52	15	Os02g0704000|mRNA|AK099580|CDS+3'UTR	ATAAGTGCACACATACTTCGAGAAAATTATGTAGAGTACATATGAAATGAAAGAATGATT	Os02g0704000	AK099580	Carotenoid oxygenase family protein.
4351	52	16	Os02g0586500|mRNA|AK101525|CDS+3'UTR	GATTTTTTCCCGGTTGGTATTTGACCAGATGTTCTTGTTCAAGAATATGCTACGTTACAT	Os02g0586500	AK101525	Similar to Small nuclear ribonucleoprotein Sm D1 (snRNP core protein D1) (Sm-D1) (Sm-D autoantigen).
4352	52	17	Os05g0132300|mRNA|AK064667|CDS+3'UTR	GTTTTCACCACCCATGTTTAAGGTTAGACAAACAAAAATAATGACATGGCTCAATCAATC	Os05g0132300	AK064667	Conserved hypothetical protein.
4353	52	18	Os08g0526300|mRNA|AK121104|CDS+3'UTR	ATATATACTGTATAAACACTTTGGAAAGTTTATATTGTACATGAACTAAACTGTCGTCAT	Os08g0526300	AK121104	tRNA-binding arm domain containing protein.
4354	52	19	Os01g0607400|mRNA|AK105049|CDS+3'UTR	GGCGTGCTGTAACTCTCAACATGTCTCTGATTTGTACTGATCATAAGTTACAAAGTCTGT	Os01g0607400	AK105049	Similar to STYLOSA protein.
4355	52	20	Os11g0145000|COMBINER|CI354393|x	TTTGCCCATTTCCAGGACTATTTTGTAGGTAAGATCATTCATTCATTATGTTGTAGATGG	Os11g0145000	CI354393	Conserved hypothetical protein.
4356	52	21	Os06g0630300|mRNA|AK071675|CDS+3'UTR	TGTAATCAGTAAGCTTGCACAGTTTGGTTTTGGTAAATCCTAACAAAGCCTTATGGATTC	Os06g0630300	AK071675	Conserved hypothetical protein.
4357	52	22	Os03g0627500|mRNA|AK067707|CDS+3'UTR	TGCCCTTTGTCGTCGGAAACAAGTGGTTGACTGTCTTTAAACTCGATTTTGGGGTGGAAA	Os03g0627500	AK067707	KH domain containing protein.
4358	52	23	Os03g0106900|COMBINER_EST|CI363568|1	TTTTGCCCACAATATTTTCTGCTAAATTCATTCTCTGATTTTGCGTGAGATTATCATGAG	Os03g0106900	CI363568	Beta-expansin precursor (Beta-expansin 1).
4359	52	24	Os11g0130500|COMBINER|CI437360|x	TTCCAAGTGTATTACCTCATGTTGAAACGTTATATGTTGAAGTTCATGTCAAAACTCAGG	Os11g0130500	CI437360	Cyclin-like F-box domain containing protein.
4360	52	25	(+)E1A_r60_a104		
4361	52	26	Os07g0495900|mRNA|AK067729|CDS+3'UTR	GTTTTTGATATTTAGGTTCACAGAAATGATGTTTGGTGATCTTGCCTGAAAGAACGAATG	Os07g0495900	AK067729	Similar to Regulator of nonsense transcripts 1 homolog.
4362	52	27	Os04g0470700|mRNA|AK071044|CDS+3'UTR	AAACTGCTCCTATATATGTACAGAATGTCGTCATATTATTGCCATGATACTTGGAACGGT	Os04g0470700	AK071044	Amino acid transporter, transmembrane family protein.
4363	52	28	Os06g0490700|mRNA|AK105159|CDS+3'UTR	ATCGCCGCGGTCACGCTGTGCTTGCAGATACCTTCAGGATAGTTGAATTTCACCTCGTCG	Os06g0490700	AK105159	Conserved hypothetical protein.
4364	52	29	Os10g0473400|mRNA|AK068550|5'UTR+CDS	CGTTCCGCATGACCTAGGAACACATGATCCATGGCATGAAATGAATGCGTACAACATACA	Os10g0473400	AK068550	Protein of unknown function DUF608 domain containing protein.
4365	52	30	Os03g0322800|mRNA|AK101817|CDS+3'UTR	CTGAGTGCATATTTATCTTTTCCTTGTTCAAGAGAAAAATTCAGGCCTGTGTACATAGTG	Os03g0322800	AK101817	Engulfment and cell motility, ELM domain containing protein.
4366	52	31	Os01g0904200|mRNA|AK068432|CDS+3'UTR	ATTTCCTTTGTGCCATATGGTTTTGACACGATAATACTTTTATATTTTGGAAGGTAGACT	Os01g0904200	AK068432	Protein kinase-like domain containing protein.
4367	52	32	Os09g0525300|mRNA|AK066620|CDS+3'UTR	ATAGCTTTTGTGGCTCATGATCCTTGACACCCTGTGCACCAATGTTGTTCTTCTGGTAGT	Os09g0525300	AK066620	Cyclin-like F-box domain containing protein.
4368	52	33	Os11g0197500|mRNA|AK120960|CDS+3'UTR	AAATTTCCTCTCTTTTGCTGAAGTGTGTGTTCTTCTTATTATCTATATATATATATAGTT	Os11g0197500	AK120960	Hypothetical protein.
4369	52	34	Os03g0399600|mRNA|AK063084|UTR	TGTACTGTCCGGCTGTTCAAATTTGAGCTATTTTCCAGTTAATTATTTAATTAACTCTTA	Os03g0399600	AK063084	Conserved hypothetical protein.
4370	52	35	Os03g0644400|mRNA|AB022783|CDS+3'UTR	TGCTACCTCTGTTTGCGGAGATTTTTGTCTGCAGGCATGCAGGATGAATATTATTCAAGT	Os03g0644400	AB022783	Amino acid permease.
4371	52	36	Os05g0348400|COMBINER|CI101604|6	AAAGAAAAACTTTGTACTTTGTTTCCTTCCACTCTTAATGAAATTTGTCGGCCTCTTTCG	Os05g0348400	CI101604	(No Hit)
4372	52	37	Os06g0345200|mRNA|AK108576|CDS+3'UTR	TACATTTTTGACGTATAAAAATATATATACACATATACAAAAGTACAAACTTTGTATACG	Os06g0345200	AK108576	Similar to Tyrosine aminotransferase.
4373	52	38	Os03g0107800|mRNA|AK062666|CDS+3'UTR	AGGCTGTTAGACTGTAATAAGGGCTGTTAATTAACATAACAGGTTACAAAGTTGTGTAAC	Os03g0107800	AK062666	Hypothetical protein.
4374	52	39	Os03g0339300|mRNA|AK104573|CDS+3'UTR	CAACGTGATATTGAATTTATGTAAGGGCTTGTCCGGTTTATTGCCATTTTCAACACTATC	Os03g0339300	AK104573	Similar to Peroxidase (EC 1.11.1.7).
4375	52	40	Os02g0579000|mRNA|AB028180|CDS+3'UTR	GCCACCGATTATTGATTGTGTTGTAATATTGGTATTGTTGATTATAATTAATTAGTACGC	Os02g0579000	AB028180	No apical meristem (NAM) protein domain containing protein.
4376	52	41	Os02g0700600|mRNA|AK059173|UTR	GCGGTCAAGTCTTTGTCGGGTCCTTGGCAAATGATACAATGCATAGTCTGGTTTTGACTT	Os02g0700600	AK059173	Similar to GAMYB-binding protein.
4377	52	42	Os08g0498600|mRNA|AK106735|CDS+3'UTR	TTGCTCTACTGTTGCTGTTGATCTTGTCGTACAATAATTGAAGTTCAAATTCAACGTCAA	Os08g0498600	AK106735	Similar to Caffeoyl-CoA 3-O-methyltransferase (Fragment).
4378	52	43	Os05g0207300|mRNA|AK070605|CDS+3'UTR	GTCAGGCAAAAGCTAAGTAGCAACAGTCAAATTGTTCATTTTAGTGATGTTTTATTTGGG	Os05g0207300	AK070605	Similar to 60S ribosomal protein L11-2 (L16). Splice isoform 2.
4379	52	44	Os05g0381700|mRNA|AK068838|CDS+3'UTR	AGACTAGCAAAATGTTTAGGGTGGTTGATGCCTTAGACAGAGATGAATAGAATTCTTCTG	Os05g0381700	AK068838	Calmodulin-binding, plant family protein.
4380	52	45	Os04g0568700|mRNA|AY344483|CDS+3'UTR	TAAACTATACTTTCGGGAGTAGTAGGAACATTGTAGCCTTGGTTGTCATGATGATGTAAA	Os04g0568700	AY344483	Similar to Heat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10).
4381	52	46	Os02g0125200|COMBINER_EST|CI261093|6	ATGCAGGTGCTGGGCAGCGGCTCTACTCCTACCTGTGATGCTTAATTGTTTATTTATGAT	Os02g0125200	CI261093	HMG-I and HMG-Y, DNA-binding domain containing protein.
4382	52	47	Os06g0542000|COMBINER_EST|Os06g0542000|8	AAATTTATTGTACTTTAACTACGGATTTACTCCTAATTGAATACAGGCGTACGCGTTGCC	Os06g0542000		Conserved hypothetical protein.
4383	52	48	Os01g0337500|mRNA|AY333187|CDS+3'UTR	TTCAGGCTAGCACCTGAGAGTTCCATGCCAAACACAAAAATACAAAACAACAAACAAGGA	Os01g0337500	AY333187	Similar to H+-pyrophosphatase (Fragment).
4384	52	49	Os11g0152700|mRNA|AK102690|CDS+3'UTR	ATGAATGGGATTGCATGATTTTCAGTTACTGATCATAAAGCAAGTAGTTCACGTCCTTTC	Os11g0152700	AK102690	Similar to Transcription factor HBP-1b(C38) (Fragment).
4385	52	50	Os12g0408800|mRNA|AK073688|CDS+3'UTR	ACTTGTGTTGAAAGTTTCACCGCATTCAGTAAGCAAAGAGGATCATTTTGAGCCTCACAC	Os12g0408800	AK073688	Conserved hypothetical protein.
4386	52	51	Os01g0101200|mRNA|AK119457|CDS+3'UTR	GTTGAGGCCGATCCTTTGTTGAAACTTGTAGTAGTAGTAGTATACTACATACAGTTTAAT	Os01g0101200	AK119457	2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein.
4387	52	52	Os03g0747800|mRNA|AF073697|CDS+3'UTR	CTGGGGATTCGATCAGCTTTCCTGGTGTTATATGAGCAGTTCATATGTGTACTTTCTTCC	Os03g0747800	AF073697	Cysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL).
4388	52	53	Os03g0660700|mRNA|AK109543|CDS+3'UTR	TCCACTATGTAATTGATCAAAAAGCATTTTCGCCCTTAAATCAACTTTTCCATTTTTGTC	Os03g0660700	AK109543	Conserved hypothetical protein.
4389	52	54	Os10g0374600|COMBINER_EST|Os10g0374600|8	GCTTCCATGCGACCAGGCCGTTCCCAACGCTACCCACCATCGTTGTCGCTACGGGAATCT	Os10g0374600		Protein kinase domain containing protein.
4390	52	55	Os05g0149600|mRNA|AK061409|CDS+3'UTR	CACTCCTGAGTTAACCTGGATGCTAAATGGGTATTTATTTGCTCTATGAAATAGTAGTAT	Os05g0149600	AK061409	Similar to Cullin-1.
4391	52	56	Os02g0813500|mRNA|D78136|CDS+3'UTR	TTTCACGTTAGGGATTCTACCTGGAACGGTAAAAAGGAGACAATGTATACTTGATTGAAA	Os02g0813500	D78136	Glutathione reductase, cytosolic (EC 1.8.1.7) (GR) (GRase).
4392	52	57	Os03g0793000|mRNA|AK108205|CDS+3'UTR	TACTTGCATGTAATTTAGTATTTGTTTTCACTGAAGAAACATGTTCCCATTGACAATAAT	Os03g0793000	AK108205	Zinc finger, A20-type domain containing protein.
4393	52	58	Os12g0641200|mRNA|AK064961|CDS+3'UTR	TCGACAAATTTCTTTCATAGCTTTCGATTTTTCTGCTAGGCTGAGTTCTTTTCTGTTGAA	Os12g0641200	AK064961	Conserved hypothetical protein.
4394	52	59	Os04g0669300|mRNA|AK071148|CDS+3'UTR	CAGTCTTCTGCAGTGATCTCTGAAGAAGGCAGTGTGACAGGAATGTGCAAAGTGAAGCCG	Os04g0669300	AK071148	Dynamin family protein.
4395	52	60	Os01g0507700|mRNA|AK060145|CDS+3'UTR	TGAAGGGGCGGGGTTAATCAATCAATTGTTTGGTTGAACCGCTAGGTAAGCTCTCTATGA	Os01g0507700	AK060145	Heavy metal transport/detoxification protein domain containing protein.
4396	52	61	Os08g0107900|COMBINER_EST|CI554888|0	AGAGGTGAAATTGTTACCATATGCCTCATCAATTGCATCTCGTCTTCATCCATTCCATAC	Os08g0107900	CI554888	Mago nashi protein family protein.
4397	52	62	Os07g0459400|mRNA|AK101767|CDS+3'UTR	TGACAAACTATTTCTTTCCCTTGGCTCAGTTAGTTCAATCAAGTGTTGAACTGTTGGCTC	Os07g0459400	AK101767	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
4398	52	63	Os05g0198200|COMBINER_EST|CI422976|6	TCTGTAGTAGCAAATTCTCTTGGGTTGCTCCCTTGGTACTGCACGTTAAGTACCCTGTAA	Os05g0198200	CI422976	Glutaredoxin-like, plant II family protein.
4399	52	64	Os01g0962700|mRNA|AK104065|CDS+3'UTR	CATGACGTCATGACAACCTCCTTTATGATCAATATATATGGATGTGGATTTTCATCTTGC	Os01g0962700	AK104065	Similar to Peroxidase 12 precursor (EC 1.11.1.7) (Atperox P12) (PRXR6) (ATP4a).
4400	52	65	Os09g0281900|mRNA|AK102936|CDS+3'UTR	TTATCAGAAGGGAGCTGGTGTTTTTGTTGCTGTTAATTTAGACATTTTATCAGGTTTGAG	Os09g0281900	AK102936	Thyroid hormone receptor-associated protein complex component TRAP170- like protein.
4401	52	66	Os04g0116900|COMBINER_EST|CI130704|6	ACCTGATCAGCGAGGGGTAATTAGACATGTATGTATGAAGACTGGAGTAGTTATTCAGGT	Os04g0116900	CI130704	Protein of unknown function DUF827, plant family protein.
4402	52	67	Os11g0602700|COMBINER|CI522869|x	AAATGGCAAGCATAGTGGCGTCTTAGCCCTCCTCCTCTGGCTGTAATTATTCCCTAATTT	Os11g0602700	CI522869	(No Hit)
4403	52	68	Os01g0326100|mRNA|AK067102|CDS+3'UTR	CACAGTTCAAGGGAGAGTTAGCTAAGATATATTTATGATCATATGTTATGAAAGATCGGC	Os01g0326100	AK067102	Similar to Peroxidase component PR-2 and/or 4 (Fragment).
4404	52	69	Os03g0237500|mRNA|AK068960|CDS+3'UTR	GTACTTGCGTCAAAAGATGAAATCGTGTTGCCAAACTGTACAGTAATACAATTGAACTTT	Os03g0237500	AK068960	Protein of unknown function DUF775 family protein.
4405	52	70	Os02g0497700|mRNA|AK070143|CDS+3'UTR	AGCTGGTAAAGTAGTAATTAGGAGAGATTTTGTCTTGTTCTTGTGATGTCTTGAGGCGAA	Os02g0497700	AK070143	Similar to Ras-GTPase-activating protein SH3-domain binding protein-like.
4406	52	71	Os01g0161000|COMBINER_EST|Os01g0161000|8	TCACATACAAAGGGTCTGCCATCGCAATTAGTAAGATACTAAGGACCTTTGTATTCATTG	Os01g0161000		Leucine rich repeat, N-terminal domain containing protein.
4407	52	72	Os01g0859400|mRNA|AK072832|CDS+3'UTR	ATCGGTTTTTACCGGTTTTTGGTCGGATTTCGGTAAACCGGTGAGGAGCGGTTTTTACTT	Os01g0859400	AK072832	Dual specificity protein phosphatase domain containing protein.
4408	52	73	Os07g0124600|mRNA|AK073437|CDS+3'UTR	CTGCTTCTTGTACCGATGTTTAAATTCTTTGTTGATTTAATGTACCAGGATCAGAACATC	Os07g0124600	AK073437	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
4409	52	74	Os08g0435700|COMBINER_EST|Os08g0435700|8	CGGCGGCGCCGCACGGGTGGCTCGGAGGCCACGAGATGATGGTGATGGTGAACGACGGCG	Os08g0435700		Similar to Myb-like protein.
4410	52	75	osa-miR171c|Os04|Mature	TGATTGAGCCGTGCCAATATCTGATTGAGCCGTGCCAATATCTGATTGAGCCGTGCCAAT			miRNA
4411	52	76	Os07g0258400|mRNA|S81897|CDS+3'UTR	ATTGTATGGTTAGATATTTAGTCATAAATCCAAGAAGTGAGTTTTCTTGGATGCGAGGAC	Os07g0258400	S81897	OsNramp1 (Integral membrane protein).
4412	52	77	Os07g0589400|mRNA|AK072501|CDS+3'UTR	TGTTTGCAAAATGACAATGTTAGGTAAAAATCTGAGCTGCAGTGGGTCAAGCCTCGGGTC	Os07g0589400	AK072501	Quinonprotein alcohol dehydrogenase-like domain containing protein.
4413	52	78	Os01g0657100|mRNA|AF280998|CDS+3'UTR	TGCAATCGATGCGAACATACACGAAATGAATGAATTCATGGTCACATATGCAGGTACATG	Os01g0657100	AF280998	Similar to Mycorrhiza-inducible inorganic phosphate transporter (Fragment).
4414	52	79	Os02g0797500|mRNA|AY157306|CDS+3'UTR	GTACCTAGCTGACGCCATCATCGACTCCTTCCATAACGTTAGCTAGACGAGGATTCAGGT	Os02g0797500	AY157306	Similar to Plastidic aspartate aminotransferase.
4415	52	80	Os09g0347900|mRNA|AK071224|CDS+3'UTR	AAAGGCCATTATTTGGCCATTATTTGATCTCATCAAAAGCAGCCATCAAGTGGATTTGAA	Os09g0347900	AK071224	Conserved hypothetical protein.
4416	52	81	Os07g0459200|mRNA|AK102099|CDS+3'UTR	TGGACAGGCAGGGTAGGTAACACAGATAATGGAAATGCAGTCTAATTATCTTTTGATCTG	Os07g0459200	AK102099	Similar to Possible kinase.
4417	52	82	Os05g0138300|mRNA|AK119249|CDS+3'UTR	AGCTCCCCTCTTATGTATATCTATCTATGACTTGTTTTACTAGTAAACTTGATTATTGAG	Os05g0138300	AK119249	Hydrophobic protein LTI6B (Low temperature-induced protein 6B).
4418	52	83	osa-miR395h|Os08|Mature	GTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAA			miRNA
4419	52	84	Os01g0639600|mRNA|AK067056|CDS+3'UTR	ATTCGCTGAGGAATACAGCTCTGCAAGTCGGTTTATTGCGAACGACATGTGAAGTTGTGA	Os01g0639600	AK067056	Protein of unknown function DUF1645 family protein.
4420	52	85	Os08g0198300|mRNA|AK105288|CDS+3'UTR	TGATGTTGCGTTATCTCGTATGTAATGAACAGCTAAGCTCATAAACAGTTTCAGCCCACT	Os08g0198300	AK105288	TRAF-like domain containing protein.
4421	53	1	Os05g0524300|mRNA|AK065794|CDS+3'UTR	TTTATTAGCGTGTTTGCCCATTTGTACCAACAAGCTGTAAACATATACGAGTAAAAAGAG	Os05g0524300	AK065794	Similar to Mitochondrial processing peptidase.
4422	53	2	Os11g0433300|COMBINER|CI142820|6	TAATGTGCATTGTTAGATTCAACGATCGGAAATGATTTGGTATAATGAGATACCGGTATC	Os11g0433300	CI142820	TRAF-like domain containing protein.
4423	53	3	Os09g0568200|COMBINER_EST|CI521986|6	GACACCGTTGAAGCGGTGTTTTCAGGACAATATAAGCCTGAAAATGCACCACTTTGGCTT	Os09g0568200	CI521986	Transcription factor CBF/NF-Y/archaeal histone domain containing protein.
4424	53	4	Os01g0730300|mRNA|AK101207|CDS+3'UTR	CTTGCTTGTTAGGTACAGTATGGAAGATTGGAGTATTTGCGGGAGTACAAGTCGGAAATT	Os01g0730300	AK101207	HAD-superfamily hydrolase subfamily IIB protein.
4425	53	5	Os09g0361700|mRNA|AK063109|CDS+3'UTR	TTCCTGAATCTGGGAGAACAGCTTCAGCTATATGTAAACTTAAAAAATATTCTCCAACCC	Os09g0361700	AK063109	Protein of unknown function UPF0203 family protein.
4426	53	6	Os06g0352900|mRNA|AK060651|CDS+3'UTR	ATAGCATGTTAAGTTACATCAGATAGATTAGGGAGGAGTATATGTAAATCTCTTGGGGTT	Os06g0352900	AK060651	Conserved hypothetical protein.
4427	53	7	Os05g0217800|mRNA|AK104534|CDS+3'UTR	GGCACTTCTCCCCTCTGTCCCGAAATAAACCAACTTATAAAGATTGAAGTTTGTCGCAAA	Os05g0217800	AK104534	Virulence factor, pectin lyase fold family protein.
4428	53	8	Os08g0127900|mRNA|AK119657|CDS+3'UTR	GTATGTTGGCCCGTACATGTACGGTGTACCCGATCTAGAATAAATGAAGTCGCTGCTGCT	Os08g0127900	AK119657	Similar to Globulin 1 (Fragment).
4429	53	9	Os07g0111600|mRNA|AK100372|CDS+3'UTR	GATACATAAAGGTTTCAATAAGTGACATTACGTTCACATCAATTGGTTGGTATGAGTGGT	Os07g0111600	AK100372	Similar to Purple acid phosphatase.
4430	53	10	Os02g0218800|mRNA|AK105964|CDS+3'UTR	TGTCATTGTGTGAAGTTCAATACGATGTTTGAAGTTGAATAAAATTATGTGCGTTCCTCG	Os02g0218800	AK105964	Similar to Allene oxide synthase (EC 4.2.1.92).
4431	53	11	Os09g0315800|mRNA|AK121947|CDS+3'UTR	GGTGTTTATGATTTGGCCTTTCAAGGAGATAAATAAATAAAGCTAGTTTTGTGTGATTTT	Os09g0315800	AK121947	Conserved hypothetical protein.
4432	53	12	Os12g0153600|COMBINER_EST|Os12g0153600|8	TTTGGTTCAGTGGCATTCTGTGTGATATTACTTATTTTCCTTTGGTACCTGTGGTGGTCT	Os12g0153600		Heat shock protein Hsp70 family protein.
4433	53	13	Os12g0637100|mRNA|AK058368|CDS+3'UTR	TGGATGCCCACCAACGACGATGTATAATTATTAATCGACTCCAACCATCTCAAACTTCTT	Os12g0637100	AK058368	Similar to Purple acid phosphatase (EC 3.1.3.2).
4434	53	14	POsControl0024|genome		
4435	53	15	Os06g0273800|mRNA|AK058911|CDS+3'UTR	TGGTTCGGCAACTGGTTATTGGATGCTGACTTTGATACAATATAAGATGAATTCATAAAG	Os06g0273800	AK058911	Similar to Signal peptidase 18 subunit (Fragment).
4436	53	16	Os10g0391200|COMBINER_EST|CI225833|6	TCCATTCTTCCAGATGTAACATAATAATGGTGTCGGCCTACAGAATGATATAACTTTGAA	Os10g0391200	CI225833	Cyclin-like F-box domain containing protein.
4437	53	17	Os02g0555600|mRNA|AK072247|CDS+3'UTR	AAATGCTGGATCCATGGTGTTGGTTCTGTTCTGTGCAATGCAGATTGCAGAATGCAGACT	Os02g0555600	AK072247	Amino acid-binding ACT domain containing protein.
4438	53	18	Os06g0564100|COMBINER|CI126855|6	GATCTCCTCCATATGCAGCTCGGCTCCAGTAATCTGTTGTAAGGTAGGATGGCAATGTGA	Os06g0564100	CI126855	(No Hit)
4439	53	19	Os06g0141200|mRNA|AK099058|CDS+3'UTR	GTGATTGCAGGATTGTACGGGGTAATGTACTTGCATTATCCATTATAATCTTAAGCATCC	Os06g0141200	AK099058	Similar to RNA-binding protein EWS.
4440	53	20	Os09g0397700|mRNA|AK111009|CDS+3'UTR	CAATTCGACTGTCTTAAAATGAAATTGAGACTAGAAGAAGGATATGAGGATATGCTTTCG	Os09g0397700	AK111009	Glutathione-dependent formaldehyde-activating, GFA family protein.
4441	53	21	Os11g0579600|mRNA|AK106009|CDS+3'UTR	CATCTATGTATGTACTCTGGTGTTCAAACATATATGGATAATGTGCTCAAGATTTATTAT	Os11g0579600	AK106009	Protein of unknown function DUF295 family protein.
4442	53	22	Os05g0516600|mRNA|AK111896|CDS+3'UTR	CGAGTGTAAACTGAAGTTTCTCCATTATGGTTCTCTCTGAAACGAACAAGATGAATTTGT	Os05g0516600	AK111896	Small GTP binding protein.
4443	53	23	Os11g0232100|mRNA|AK111558|CDS+3'UTR	TAATGCATTTGCAGGTATTATGTAAAATGGTTGACAATTAAGGTAGTAGTCCACTTTAAT	Os11g0232100	AK111558	Protein kinase-like domain containing protein.
4444	53	24	Os03g0104100|mRNA|AK099959|CDS+3'UTR	GAGCATCTTAGCGATGACGCTGCGGTGCAGATTGTCTTCAAGAATCCAAGAACGGATGTA	Os03g0104100	AK099959	Protein phosphatase 2C-like domain containing protein.
4445	53	25	Os02g0489400|mRNA|AK102757|CDS+3'UTR	TTAGCATGATGACATGAGAATGGGTTATGTACTCTGGATGTTATTAAGTTAAAATATTTA	Os02g0489400	AK102757	Similar to 40S ribosomal protein S8.
4446	53	26	Os07g0200900|mRNA|AK061082|CDS+3'UTR	CGTTCTTGATGCATGTTATGTATATATCTGTGTCCTCTATGCAATTATGAGCTTGTTTGC	Os07g0200900	AK061082	Conserved hypothetical protein.
4447	53	27	Os05g0389500|mRNA|AK060960|CDS+3'UTR	TTGTTTGGATTTATTGTAGAAACAGTAGCAAATTTATTAATATCAACCAGAATTTTTGTT	Os05g0389500	AK060960	Endonuclease/exonuclease/phosphatase domain containing protein.
4448	53	28	Os12g0637700|mRNA|AK070555|CDS+3'UTR	TTCCTCCAAAACAAAAACACTTTTTATGGCTGGCTATAAGGGGAAAGATTCAATCGGCTG	Os12g0637700	AK070555	Nodulin-like domain containing protein.
4449	53	29	Os06g0185800|mRNA|AK120685|CDS+3'UTR	AGTAGCTTGGTTGATCAAAAGATTAAGAGTAATGTATGAGAAATGTCGATGACTGTTAGG	Os06g0185800	AK120685	Protein prenyltransferase domain containing protein.
4450	53	30	Os01g0341600|COMBINER_EST|CB655037|7	TTAAAGGTGGAAGCTAATCATTTAATTGCTGCTTCTTGGCAAACTCCTGAATCCAATAAC	Os01g0341600	CB655037	Conserved hypothetical protein.
4451	53	31	Os01g0658400|mRNA|AK063826|CDS+3'UTR	TTGCTCCATTGTGTCACTCACTCATTGCAGTGATTTCGAATAGTATCAAACTGGTGGTTT	Os01g0658400	AK063826	Ubiquitin-conjugating enzyme OsUBC5a.
4452	53	32	Os01g0496900|mRNA|AK069894|CDS+3'UTR	TTAATCTAGACAAACCATCCTTACCCACATATGTATTGAAGAACATGTATGAATCACAGC	Os01g0496900	AK069894	Conserved hypothetical protein.
4453	53	33	Os03g0754300|COMBINER_EST|CI448498|6	AATTTTGAGTCATGACTGACCAGGGTAATGTATATGCTGTAGTAAGAATGGCATTTATTC	Os03g0754300	CI448498	Hypothetical protein.
4454	53	34	Os08g0157500|mRNA|AK064768|CDS+3'UTR	TTTTGATGTTCAATTCCGGTGATTCTGAGTTCTAATGGATGTAACCTGTCTGCTATTATA	Os08g0157500	AK064768	Similar to Caffeic acid 3-O-methyltransferase (EC 2.1.1.68) (S-adenosysl-L- methionine:caffeic acid 3-O-methyltransferase) (COMT) (CAOMT).
4455	53	35	Os05g0571600|COMBINER|CI411380|x	TTTGGTTCAAATCGTGGTGTTCCTCTCCAAAGCTGTACGTACCTGATGGAGGTTTTGAAC	Os05g0571600	CI411380	Conserved hypothetical protein.
4456	53	36	Os03g0180900|mRNA|AK073589|CDS+3'UTR	TTGATGCCTGTCGGACCTATGGCTTGTAAATCCAAATAAAATGGTCAACAAATGGTATTA	Os03g0180900	AK073589	ZIM domain containing protein.
4457	53	37	Os10g0122500|COMBINER_EST|Os10g0122500|8	ATGGCAAGGGGAGGAAGATGAAGGAGCCAGGGTGCTGTCCGGCTGTGTAACGCCTCACCA	Os10g0122500		Transferase family protein.
4458	53	38	Os04g0293100|mRNA|AK062525|CDS+3'UTR	TATGTAATTTGTGATGGATAATATATGCTGCCAAAATTTAGTTAAACTTCAGTTGTAGTT	Os04g0293100	AK062525	Conserved hypothetical protein.
4459	53	39	Os06g0660700|mRNA|AK058614|CDS+3'UTR	CGGCGTTTGGGTTAAACAGAGAAGAATGTGTGTTGTGACTGTTGGTGTACCATACTGTCT	Os06g0660700	AK058614	Similar to Ubiquitin-conjugating enzyme E2S (EC 6.3.2.19) (Ubiquitin-conjugating enzyme E2-24 kDa) (Ubiquitin-protein ligase) (Ubiquitin carrier protein) (E2-EPF5).
4460	53	40	Os05g0557200|mRNA|AK102111|CDS+3'UTR	GAGATGATGGATGTACCACCTGTGTTCCTGGTGCGCTAAACATGTCTTTGACGACCGAAG	Os05g0557200	AK102111	Armadillo-like helical domain containing protein.
4461	53	41	Os01g0206300|COMBINER_EST|Os01g0206300|8	GGGCGCGGCTCAAGCCAAGCCTCCGCGAGCTCGTCTGCGACGACCGGCCATGCCCGGAGG	Os01g0206300		Similar to Serine/threonine protein kinase (CBL-interacting protein kinase 19).
4462	53	42	Os01g0306800|mRNA|AK099426|CDS+3'UTR	TTCCCTGTTTTTCCAAATTGTTCTCTCCTCTTGATTTTATGATTGTGAGTCACAAAGATG	Os01g0306800	AK099426	Conserved hypothetical protein.
4463	53	43	Os11g0432600|mRNA|AK059916|CDS+3'UTR	TGTGCGAGTTGGAATTATTAGTACTTTTCCATTCAGTGTAATCGAGAAATAAACAATGTA	Os11g0432600	AK059916	Similar to Beta-keto acyl reductase (Fragment).
4464	53	44	Os07g0523300|mRNA|AK058830|CDS+3'UTR	ATGTGATGCATGTCTTTAGATGGCACTGCAATTGTGACTTTTGTCTTATGGCAGTTTTAT	Os07g0523300	AK058830	Similar to 60S ribosomal protein L44.
4465	53	45	Os11g0191400|mRNA|AK101259|CDS+3'UTR	TAGTATATAGTTCCAATCCGTCTCATGTCCAACCCGACCACCAACCAACTACGTGTTCCA	Os11g0191400	AK101259	ATP-NAD/AcoX kinase family protein.
4466	53	46	Os07g0484600|mRNA|AK105559|CDS+3'UTR	TTCAGTTCCTGAAGTACTGGTACTTACTGTTGATTTATTTGTGCGTGCACTTACTGATAT	Os07g0484600	AK105559	Hypothetical protein.
4467	53	47	Os01g0566100|mRNA|AK065173|CDS+3'UTR	TAGTTTGACTGTAAAAGATGAGTGTGAGTCGAGGTCATATCTTTCTAGCCTTGTTTCTGC	Os01g0566100	AK065173	Conserved hypothetical protein.
4468	53	48	Os02g0770000|mRNA|AK103425|CDS+3'UTR	ATTTAGACTTTGATTTGCCTCCTTTTGTGGTTTTGATGCATATGGCTTGCCCCCTCGTAT	Os02g0770000	AK103425	Beta 1 subunit of 20S proteasome.
4469	53	49	Os10g0363500|COMBINER_EST|Os10g0363500|8	TGGAGCTTGATATCGTGACATACAATGCGCTCATTCTTGGGCTTTGCAATGAAGGGAAGA	Os10g0363500		Pentatricopeptide repeat containing protein.
4470	53	50	Os11g0537300|COMBINER_EST|Os11g0537300|8	CTACATGACAGGGATGAATTCTTCATCATTGACATCTTGGGGTGCAAATTTTGGAGGATT	Os11g0537300		Germin family protein.
4471	53	51	Os05g0461000|mRNA|AK066739|CDS+3'UTR	GGTTCAGTTTTGCGAGTATTTAAAAAACTGCACAAACAAGATTGTGAACGGTGATTGTTT	Os05g0461000	AK066739	Clathrin adaptor complex, small chain family protein.
4472	53	52	Os08g0344600|mRNA|AK059591|CDS+3'UTR	GGTTTTGAAGTACATGAGCAGATTTCCGTGCGTGTTGTTGCAATAAAGTTTCGGCTTCAA	Os08g0344600	AK059591	Similar to Triose phosphate/phosphate translocator, non-green plastid, chloroplast precursor (CTPT).
4473	53	53	Os04g0674700|mRNA|AK106615|CDS+3'UTR	AGTCACAGAGCAGAAATGTCTGGTGCAGGCAGAGGCTGATGCATTCCGCATTGTCATGGC	Os04g0674700	AK106615	Similar to AMP-binding protein (Adenosine monophosphate binding protein 5 AMPBP5).
4474	53	54	osa-miR395a|Os04|Mature	GTGAAGTGCTTGGGGGAACTCGTGAAGTGCTTGGGGGAACTCGTGAAGTGCTTGGGGGAA			miRNA
4475	53	55	Os05g0471800|COMBINER_EST|AU076164|7	GGTGAGTAGTAGCAAGCACCATCATATGGCGAAGGCAGAAGATGGAACCATTACAGTTAT	Os05g0471800	AU076164	FAR1 domain containing protein.
4476	53	56	Os07g0496600|COMBINER_EST|CI271161|6	CGTGGTCACGTCTTAAATAATTAGACTGAATGTTACTCCTGTAAACCCCATAGTCATGGA	Os07g0496600	CI271161	FAR1 domain containing protein.
4477	53	57	Os02g0799300|mRNA|AK061912|CDS+3'UTR	GTGCTGTTTGTGAACTTGAGATAGATTTCTGACTTTGTGCCATTAGAGTTTCAGTTTGTG	Os02g0799300	AK061912	Conserved hypothetical protein.
4478	53	58	Os02g0331200|mRNA|AK063938|CDS+3'UTR	AAAGTTGGTACTTTACGTGAGTAGGAAAGTTTTCGATGCAATGTGATATGATGGCAAGTT	Os02g0331200	AK063938	Protein of unknown function DUF563 family protein.
4479	53	59	Os01g0198500|mRNA|AK108464|CDS+3'UTR	TTTTTCTACCTGCATGGCTGCGTGTAATTTTTCCTCGGTTAATTAATTTCCTCGCTTGTG	Os01g0198500	AK108464	Conserved hypothetical protein.
4480	53	60	Os09g0320400|COMBINER_EST|CI043348|3	ACACCGAGGATGTTTGATTTTGCTGTAAGCAATTAATTAATATCTTGTGAACAACTGGTC	Os09g0320400	CI043348	Conserved hypothetical protein.
4481	53	61	(-)3xSLv1		
4482	53	62	Os05g0126100|mRNA|AK059541|CDS+3'UTR	CCTTCAGTGCGAATAATTAAGCTGTTGTACATATTTGGGAAATGCAAAGTAGCACTCAGC	Os05g0126100	AK059541	CD9/CD37/CD63 antigen family protein.
4483	53	63	Os03g0181500|mRNA|AK060840|CDS+3'UTR	GTACTGAACCAGTGTACGCGAGTTCGGTGATATGTGAACTTATCTACGTTTGATTCTATT	Os03g0181500	AK060840	Similar to Fiddlehead protein.
4484	53	64	Os02g0616100|mRNA|AK104284|CDS+3'UTR	TGTCACGTCTAGATCTCACCTCCTGTACTCTTGTGTACTGTACTATGTGAAAATCATTGG	Os02g0616100	AK104284	Conserved hypothetical protein.
4485	53	65	Os03g0205000|mRNA|AK069442|CDS+3'UTR	TGATGATCATATTTCTTGTAGCTTCGGACAGAATACAAAGTTTGAATCTCATAAATGAAA	Os03g0205000	AK069442	UBA-like domain containing protein.
4486	53	66	Os02g0324900|COMBINER|CI411818|6	GGTTCGTGAGTGCGTCAGAAGAGATTCAGAAGACTAATTGAAGACCGATTATTGCAAGGC	Os02g0324900	CI411818	(No Hit)
4487	53	67	Os04g0683100|mRNA|AK064962|CDS+3'UTR	TTTTTTCTAGCCAGGAACTCCCCCTCTTAACTGTAAAAATGCTTTGGATTTAAGACAACA	Os04g0683100	AK064962	Similar to Pre-mRNA cleavage factor I 25 kDa subunit (Cleavage and polyadenylation specific factor 5, 25 kD subunit).
4488	53	68	Os05g0290300|COMBINER_EST|CI094256|6	GCTTGTTTTACTTGCGACATGTCATGGTGCACCACTACTTAGTTGTGGTTATTGTAATGT	Os05g0290300	CI094256	N-acetylglucosaminyl transferase component family protein.
4489	53	69	Os01g0130100|COMBINER_EST|Os01g0130100|8	TTCGTCAAGAGGGTCATCAAGCGATGCCACGTGATGTCACCAATCAAAACTGCCCAGTAG	Os01g0130100		Non-protein coding transcript, unclassifiable transcript.
4490	53	70	Os02g0742200|mRNA|AB029510|CDS+3'UTR	TGATAGATGCCAAAGGAACAAGGAGACACCGTTCTGTCAGGACAAAATCACAGATTTTGT	Os02g0742200	AB029510	Small GTP-binding protein OsRac3.
4491	53	71	Os02g0824900|mRNA|AK103528|CDS+3'UTR	ATTCGCTTCCGGTCTTAAATCTGAATTTACTATGCGCAAAAATGTAAATCTTGGTTTTGC	Os02g0824900	AK103528	Conserved hypothetical protein.
4492	53	72	Os09g0501200|COMBINER_EST|Os09g0501200|8	GAGCCTCGAACAAAAATAGCACAGCAGCAATCATCTACTCAACCACAGGAATGCGTACAT	Os09g0501200		60S ribosomal protein L32 (Ribosomal protein 49).
4493	53	73	Os03g0125400|mRNA|AK101342|CDS+3'UTR	CGTAATTGAATAGTTACATTCATTTTCTGGCAATACATGGGATAAAATCTGTTGTCACCC	Os03g0125400	AK101342	Conserved hypothetical protein 147 family protein.
4494	53	74	Os01g0303600|mRNA|AK099496|CDS+3'UTR	GCTTTCCACTATATGTACATGTCCACATTTGTTGCAAAGATGATTACACCAGAGCTTTGA	Os01g0303600	AK099496	RINGv domain containing protein.
4495	53	75	Os04g0524300|mRNA|AK106426|CDS+3'UTR	TGCAGTTTGTCCCATCGGTTTGTCCATCCCAGTTGAAAAACCTGTTGCAACAAATGTCTC	Os04g0524300	AK106426	Similar to ZmRR2 protein (Response regulator 2).
4496	53	76	Os09g0120800|mRNA|AK066284|CDS+3'UTR	TTCAACGGTTGTAAGTTCTATTATGATTTGTTGGATATTTTGGAGTTTACTTCCGATCGC	Os09g0120800	AK066284	Similar to Cation-transporting ATPase.
4497	53	77	Os05g0453700|mRNA|AK063881|CDS+3'UTR	TGCTTGTGTGCTCAACCATGTGAATCACTTTATATATATAGACCGAATTTGAGGTTTTAC	Os05g0453700	AK063881	Similar to ENOD18 protein (Fragment).
4498	53	78	Os02g0757700|mRNA|AK103417|CDS+3'UTR	TGACCTCACTGTCCTTGCTCTTCCTCTCGAGCCGTGTACCTAAGCTTGCAGTTGCAGTCT	Os02g0757700	AK103417	Cyclin-like F-box domain containing protein.
4499	53	79	Os08g0300300|mRNA|AK066375|CDS+3'UTR	TCTTCTTTTTGCTTGTATATTACTCCCTCTATTTTATATTATAAGTTGTTTTGATTTTTT	Os08g0300300	AK066375	Similar to C1C-Nt1 protein.
4500	53	80	Os03g0804600|COMBINER_EST|Os03g0804600|8	GCACGGCGGGGAAGTTCTCTCCAGGGTGCTCGGCGAGGGGGAAACCTTCGTCATCCCGCG	Os03g0804600		Cupin 1 domain containing protein.
4501	53	81	Os12g0468100|COMBINER|CI105466|6	GCGAAGAAGCTGCTCTTGATCTTATCAGCAATGCTCAAAATGCGGCTGACAAAATTGCAA	Os12g0468100	CI105466	(No Hit)
4502	53	82	Os03g0409100|mRNA|AK105845|CDS+3'UTR	TTGATGTACCATCTGCAGGTTACTCATCAGGTGATAAATAAGAGTACACCATGTAACATT	Os03g0409100	AK105845	Conserved hypothetical protein.
4503	53	83	Os01g0978400|mRNA|AK062411|CDS+3'UTR	TAATTGAACCGTGCTAACGCTACGGTAATATTTAGTAATGCAAATTAAACTATTAAAGTT	Os01g0978400	AK062411	NAD-dependent epimerase/dehydratase family protein.
4504	53	84	Os03g0234100|COMBINER_EST|CI407244|0	AAGCACGGCCTGATGTTTTGTTCTTGTGATTCAACATAAATAAAGATGGTTTTCTTCTGT	Os03g0234100	CI407244	Similar to Non-symbiotic hemoglobin 4 (rHb4) (ORYsa GLB1d).
4505	53	85	Os11g0454000|mRNA|AK071366|CDS+3'UTR	ATGTAATATGGTGTGTGTACACACTAAGGTTTTATTGAAGTGTGACTTTGTGCTTGTGTT	Os11g0454000	AK071366	Dehydrin RAB 16C.
4506	54	1	Os01g0711100|mRNA|AK068087|CDS+3'UTR	CGGATTGTAAACTCCTTCCGTTCACCTTTTACTTTCTTAGCATACAATTGCGTCAAAATT	Os01g0711100	AK068087	Peptidase M16, C-terminal domain containing protein.
4507	54	2	Os04g0546800|COMBINER_EST|CI061691|0	TGCAAATCCTAAGGGTCATAATTCGCGTCATTGTCACTAGTGGATCACCCGAGTGAGTTT	Os04g0546800	CI061691	Pathogenesis-related transcriptional factor and ERF domain containing protein.
4508	54	3	Os02g0303500|mRNA|AK106082|CDS+3'UTR	TGCACATTTGATGTGCCTAGTAATTTGTCGGTTGTGAAGTACTAACCGACATCTTATATT	Os02g0303500	AK106082	Eggshell protein family protein.
4509	54	4	Os05g0559600|mRNA|AK068237|CDS+3'UTR	GTTACCTTACAGATGTAAAATCATGCAGCCATTGTAACTGTTAAGAGCAAAGACAACACT	Os05g0559600	AK068237	Glycosyl transferase, family 43 protein.
4510	54	5	Os05g0226100|COMBINER|AU058284|6	TTTTTTGTTAAATGTGTGGATATTTTTGATGCTTGAATGCTTGGGAGAATGGAAATTTTT	Os05g0226100	AU058284	(No Hit)
4511	54	6	Os03g0563300|mRNA|AK104435|CDS+3'UTR	GTACATTTGAATCTTCCTTGTAGTCATTGATGCAGCCAATGATTAGGAAAGGAGCATCTA	Os03g0563300	AK104435	Similar to Mg-chelatase subunit (Fragment).
4512	54	7	Os07g0658000|mRNA|AK107954|CDS+3'UTR	ATGTAGCCTCCCTTGATATCAAAATTCAGAATCAATGGATGCAAGTTTCTATTTCTGAAC	Os07g0658000	AK107954	Conserved hypothetical protein.
4513	54	8	Os08g0512500|mRNA|AK068227|CDS+3'UTR	AGGCCAACATGAGCTAATTATGTTGTGGCAAGTCATAAGCATTGTTTTCTATGCATTTTT	Os08g0512500	AK068227	Similar to Thylakoid lumen protein, chloroplast.
4514	54	9	Os01g0614300|mRNA|AK105551|CDS+3'UTR	CTCCAGTTAATGTACACTAGCTTAGGATAAAAGAGATAATACACAGTTTTGCAGCTTTGC	Os01g0614300	AK105551	Protein of unknown function DUF231, plant domain containing protein.
4515	54	10	Os03g0179000|mRNA|AK069518|CDS+3'UTR	AAAGGGGGTGTGATGCTGCCTCCTGCCTGTACCATGCTTCGGATCAGATTGAAATGAGCT	Os03g0179000	AK069518	Tubulin-tyrosine ligase family protein.
4516	54	11	Os04g0469800|mRNA|AB158759|CDS+3'UTR	CTTCACCCTGTAACATCCTCCACTGTTTCAACTTTCATCTGCTATTCTATAGAAGAAAAA	Os04g0469800	AB158759	Cytochrome P450 724B1 (EC 1.14.-.-) (OsDWARF11) (Dwarf protein 11).
4517	54	12	Os01g0844900|mRNA|AK066659|CDS+3'UTR	CTCATCATGTATGTGTAAGATGCTACTCTTTCTAACCTGGTGACATCGGCAAAGCTGCTC	Os01g0844900	AK066659	Homeodomain-like containing protein.
4518	54	13	Os08g0450800|mRNA|AK102479|CDS+3'UTR	CGTCGCTTCTCTCTAGTTCCCATTCCATTTTGGTTGGATGTAAACAATAGAAGTGGGGCA	Os08g0450800	AK102479	Phosphatidylinositol-4-phosphate 5-kinase family protein.
4519	54	14	Os11g0645300|mRNA|AK062126|CDS+3'UTR	GAACGCCGAGGAGAGCTTGCTGCTGCTTGCCATGGCGAACACTGATGACTGACACGGAAT	Os11g0645300	AK062126	Plant disease resistance response protein family protein.
4520	54	15	Os08g0535200|mRNA|AK070510|CDS+3'UTR	TGCAATCTCATCTCTTTGTACTTACAACTCAGAAATCAATGGAAGATTGTGACAGGTATT	Os08g0535200	AK070510	Similar to MtN3-like protein.
4521	54	16	Os10g0116400|COMBINER_EST|CI279150|6	CGATGAGCTCTTCGGCAAGCTGCTAAGCAGCATCCTTCCCCTGCCCAAACACTACGATTT	Os10g0116400	CI279150	Conserved hypothetical protein.
4522	54	17	Os10g0545700|mRNA|AK073024|CDS+3'UTR	ACACCACGGGGTACTGAATTATTACTGATTACTAAAAACTCTTTACATCTTGGCTGAAGA	Os10g0545700	AK073024	Similar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25).
4523	54	18	Os07g0171300|mRNA|AK100663|CDS+3'UTR	CATTCTTGCATGTTGAAATCGATATCTCTGCATTTTTATCATACGTTCTCCCGATGTTTC	Os07g0171300	AK100663	Protein kinase-like domain containing protein.
4524	54	19	(+)E1A_r60_a22		
4525	54	20	Os12g0639700|mRNA|AK069880|CDS+3'UTR	TTGTGTCATCCCTTAGTACAAACACGAGATGAATGTATCATCCACGGTCTGAAGTGAAAA	Os12g0639700	AK069880	Glycosyl transferase, family 14 protein.
4526	54	21	Os05g0106900|mRNA|AK105734|CDS+3'UTR	CTTTATTTGGGTCATATGGTACATTTCTTTGTTAAATCCGGACATGTACTATGGCGTTGT	Os05g0106900	AK105734	Conserved hypothetical protein.
4527	54	22	Os07g0180700|mRNA|AK065334|CDS+3'UTR	ATCTCATTGCGTAGCTCAATTCTTCTTTCGATTGTCAACTCCTTATTTGATTTAATCAGG	Os07g0180700	AK065334	Similar to Major facilitator superfamily antiporter.
4528	54	23	Os01g0182600|mRNA|AK100147|5'UTR+CDS	TGCTTGTTGATGGTGAAGCTTGTACTTTACCACAATTAGAGCTATTGGAAGTAACCGCCA	Os01g0182600	AK100147	GIGANTEA protein.
4529	54	24	Os08g0141800|COMBINER|AU077425|6	AATTTCTAAGATTATTGGATTTTTGGTCTAAAGGAAAAAGGATTTATTTAAATCCTTTTT	Os08g0141800	AU077425	(No Hit)
4530	54	25	Os01g0733500|mRNA|AK059056|CDS+3'UTR	GGGCTTGCTGTTTGATGTATAGTTTTAGTATGCGGGTGCAATAAACAGACAAGTATTTAC	Os01g0733500	AK059056	Similar to Dehydration-induced protein RD22-like protein 1.
4531	54	26	Os05g0573900|COMBINER_EST|CI512622|6	TATATACCACTCCTTTACTGTAGGAGTATAGGATATATACCCAATGTATCAATCACCATG	Os05g0573900	CI512622	Conserved hypothetical protein.
4532	54	27	Os02g0732700|mRNA|AK072905|5'UTR+CDS	TGGAGAGCATCGTCTTTTTAGATTAGCAGAAAATTTGTGCATGAATTTGATTCTCTCACT	Os02g0732700	AK072905	Conserved hypothetical protein.
4533	54	28	Os09g0397900|mRNA|AK101306|CDS+3'UTR	TAGTTAGACTGTTGGAAAAAAAGAACACTTTTCATCCGTCAATTGTTATTTTGGTGGATT	Os09g0397900	AK101306	Similar to FEG protein.
4534	54	29	Os05g0402700|mRNA|AY522925|CDS	CAGGGCGGCCTTCCTTACCAGGTGCAAGGCCAACTCCGAGGCTACCCTCGGTACATACAA	Os05g0402700	AY522925	Similar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13).
4535	54	30	Os04g0429800|mRNA|AK067438|CDS+3'UTR	ATTTGAGTCCATGAGATGATGAGAACAAATAATCGCTGTAAAAGGTTGAGATCATGCCCC	Os04g0429800	AK067438	Nicotinate phosphoribosyltransferase and related family protein.
4536	54	31	Os04g0403300|COMBINER_EST|AU100676|7	ACAGCAGATAGTGTAAACTGTAATGCGAAGTGTAAACTGTAATGTGAATACGTATACTGT	Os04g0403300	AU100676	Similar to Alpha-amylase (EC 3.2.1.1).
4537	54	32	Os01g0897700|mRNA|AK061290|CDS+3'UTR	ACAGCCTGTACAATGTACTAACAATTTCAAGTATGGCCAGTCTGCAGAATTCAAAGGTAA	Os01g0897700	AK061290	Similar to FH protein NFH1.
4538	54	33	Os05g0397900|mRNA|AK102894|CDS+3'UTR	GTCTGTGATAAGGGTTGTACCCATTCATCAGTTCTTTTCTTAAAATGATTGATGTTAGTG	Os05g0397900	AK102894	Kinesin, motor region domain containing protein.
4539	54	34	Os05g0552300|mRNA|AK065272|CDS+3'UTR	TAACATTTGCCTGGTACTTTCTACTTCATTTTCATTAATTAATGATTAGATTTGCCAATG	Os05g0552300	AK065272	Similar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD).
4540	54	35	Os06g0131700|mRNA|AK062952|CDS+3'UTR	GTCGGTGTCATCGTCGCTACACGCAGACTTGACGACCATGAATAACGTATAATAATTGGA	Os06g0131700	AK062952	Similar to NAM-like protein.
4541	54	36	(+)eQC-41		
4542	54	37	Os07g0106100|mRNA|AK067091|CDS+3'UTR	ATGGGCACCCTGTACACACTCTGCTAATGTTATTCTTGCTGTACATACAGAGTGAAATTA	Os07g0106100	AK067091	Leucine-rich repeat, SDS22 containing protein.
4543	54	38	osa-miR442|Os04|Mature	TGACGTGTAAATTGCGAGACGAATTGACGTGTAAATTGCGAGACGAATTGACGTGTAAAT			miRNA
4544	54	39	Os08g0302000|mRNA|AK106760|CDS+3'UTR	GACTATCCTGCATGTAATCGAATAACTATACTAATAAAATCGGGCAAGTCATTTTCAGTC	Os08g0302000	AK106760	Similar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40).
4545	54	40	Os10g0533100|mRNA|AK099073|CDS+3'UTR	TCCGCAATTGCATGTAGATATGCTATAAATTTTCACAGCAAGTAACACTAGTTGTCTTTG	Os10g0533100	AK099073	Conserved hypothetical protein.
4546	54	41	Os12g0165300|mRNA|AK120817|CDS+3'UTR	TTTTTTGTTCTATGTGGGCGTTCAAGTTGTATACTGATTAAGCCCTCACCTTTCCCCTCC	Os12g0165300	AK120817	Conserved hypothetical protein.
4547	54	42	Os09g0441400|mRNA|AK111616|CDS+3'UTR	CCTTTGTAGAGCTGAATGTAATAGGGCAAGTGTGAGTCAATAATATGCTTGATAATAAGG	Os09g0441400	AK111616	Similar to Elicitor-inducible cytochrome P450.
4548	54	43	Os10g0130500|mRNA|AK066967|UTR	TCCTCTCCCTCATTCACACACACTTGAAGCATGAGCTGAATTACAAGAGGCTCTAGTGTA	Os10g0130500	AK066967	Peptidase C48, SUMO/Sentrin/Ubl1 family protein.
4549	54	44	Os08g0120500|mRNA|AK102447|CDS+3'UTR	TTACCTCATTTACTGTACGTTCTCGCCTGCAGCGATAAGTAGCTTGATGTGTTCTTTTTT	Os08g0120500	AK102447	Similar to Topoisomerase-like protein.
4550	54	45	Os12g0104700|mRNA|AK067342|CDS+3'UTR	AATCGTTCAATTGAATTGTAAATTAGTTTTGAGCTAACCAATTGAGCAAACAGCACTGTT	Os12g0104700	AK067342	Protein of unknown function DUF231, plant domain containing protein.
4551	54	46	Os06g0699600|mRNA|AK121295|CDS+3'UTR	TTATGTCTTACTCCAATCGAAATGGCTTGTCCAAGTTGCAGGCTTTCAGCTTGGAAGGGA	Os06g0699600	AK121295	CCT domain containing protein.
4552	54	47	Os04g0640700|mRNA|AK071973|CDS+3'UTR	TGGAAAAAGAAATTTCCGCAAGTGTAATTGATTGGAAGGGAAATTAGCTCATTTTCGTCC	Os04g0640700	AK071973	Similar to Alpha-L-arabinofuranosidase/beta-D-xylosidase isoenzyme ARA-I.
4553	54	48	Os02g0105500|mRNA|AK102953|CDS+3'UTR	TTGTCATGAAATGATGTGCGGCATGTGCCCCCTAATAAATAAGACCATTACCATATGGTA	Os02g0105500	AK102953	IQ calmodulin-binding region domain containing protein.
4554	54	49	Os07g0565500|mRNA|AK107834|CDS+3'UTR	ATACACATCTTGTAGAAACTCTGTCGGGGAATGTGAAGCTAGCTGTTAAAGCCATTCTTG	Os07g0565500	AK107834	Conserved hypothetical protein.
4555	54	50	Os04g0242300|COMBINER|CI165432|6	GCACCGTTACCCACAAAACAAGAACCTTTATTTCGAAATTTCGAATAAGTAGGCAGGCTC	Os04g0242300	CI165432	(No Hit)
4556	54	51	(+)E1A_r60_n9		
4557	54	52	Os06g0542700|COMBINER_EST|Os06g0542700|8	TTAGCCCTGAACCTTGGAAAAGTTGGTTGCCTCCTATATGGATGATGCCCAATCTCATGA	Os06g0542700		Protein of unknown function DUF295 family protein.
4558	54	53	Os04g0556300|mRNA|AK062772|CDS+3'UTR	GGTTGCATTTGCACTATACTCCTTGCATCCTGAATCTTTATTGTACTCTGTACCTGTATA	Os04g0556300	AK062772	Glutathione peroxidase.
4559	54	54	Os02g0106100|mRNA|AK072245|CDS+3'UTR	CCTTCGATCCAACTGTACCTAGGGGAAGAAGATGCCATGGTCAAGCAATACTTCTGTAAA	Os02g0106100	AK072245	Similar to Fructosyltransferase.
4560	54	55	Os04g0563700|mRNA|AB024987|CDS+3'UTR	TTCAGCCTATGTAAGCTGAATCTCTTGTAAATCTACATGTGTTCAAGTAGCATGAAGAAA	Os04g0563700	AB024987	Cyclin.
4561	54	56	Os06g0669100|COMBINER_EST|CI531989|6	AGCGCACGCATCAGGCTGTCGCGGCCATCACCATCCTGAGGTTAGTACTGGTTTCCTTTT	Os06g0669100	CI531989	"DNA polymerase, beta-like region domain containing protein."
4562	54	57	Os08g0200400|mRNA|AK067859|CDS+3'UTR	ACTACTCTGCTGCAGAGCCAAAGCTTCCTTTCTTTTCAAATGCAGTATGTCCCTATGGTG	Os08g0200400	AK067859	KH domain containing protein.
4563	54	58	Os02g0108600|COMBINER|CI038401|6	TCTGCTGCAAATATGATTTTTGAGATACATGAACACACATCAGGCAGGCGTGCATGAGAT	Os02g0108600	CI038401	(No Hit)
4564	54	59	Os02g0182500|mRNA|AF358768|CDS+3'UTR	GCCCGTAGACCTAGATCGCGTAGGGGATGGTTCGTTCGTTCGATCGATCGATTATCCTGT	Os02g0182500	AF358768	Similar to Proteasome subunit beta type 3 (EC 3.4.25.1) (20S proteasome alpha subunit C) (20S proteasome subunit beta-3).
4565	54	60	Os03g0136400|mRNA|AK107027|CDS+3'UTR	ACGCAGTTCTGGTTCCTTGGCTCCCATCTGGAGCTTCATTTCCAACCACTTTAACAATTT	Os03g0136400	AK107027	Similar to Inorganic phosphate transporter 1.
4566	54	61	Os05g0340700|COMBINER|CI042335|6	GCAACGATCGAAATGAGTGCGACCATGATGACGACATCTCTCTAGATTCCGACGTTTCTG	Os05g0340700	CI042335	(No Hit)
4567	54	62	Os06g0238300|mRNA|AK107758|CDS+3'UTR	TTACATACTGTGAACACATCTTGTTCATCTTGAATAAAAACGTTATTATGTTTGTTTATG	Os06g0238300	AK107758	FMN-binding split barrel domain containing protein.
4568	54	63	Os01g0254100|mRNA|AK111583|5'UTR+CDS	ATTTCACATGCATCATACTCACGCAACAGCCAGTTGGTTTTTGCTGCCTTTACCGATGGT	Os01g0254100	AK111583	Similar to CTV.2.
4569	54	64	Os05g0540600|mRNA|AK072324|CDS+3'UTR	GCATCTGTTATGTTACTTGTATACAAGGCTTTAAGTTATAAAGCATGCATCTGTTATGTC	Os05g0540600	AK072324	Cyclin-like F-box domain containing protein.
4570	54	65	Os02g0122800|mRNA|AK121372|CDS+3'UTR	CTGACAGCCTGACACTATGGTAGATTGCTGCACCAAAACGAATTTGCTCTTTGTCATTTG	Os02g0122800	AK121372	Nucleotide-binding, alpha-beta plait domain containing protein.
4571	54	66	Os01g0689600|COMBINER_EST|Os01g0689600|8	GTTACTGCTTCTGGTGCCGCAAATTATCAATTGGTTCAAATCCTAACCCTCCTTTAGGAT	Os01g0689600		Conserved hypothetical protein.
4572	54	67	Os01g0348700|mRNA|AK120842|CDS+3'UTR	CAAAAGAACATCTTGAGTTTTGTTGAGCGAATATCATCTGTGTGAGCGCACATTTACTGA	Os01g0348700	AK120842	Similar to 60S ribosomal protein L23a (L25).
4573	54	68	Os01g0594300|mRNA|AK105266|CDS+3'UTR	TCCTCCCATTGATTTGCTTGATTTACAGATAATCCATTGTGAACAAATGGCCATATTCTG	Os01g0594300	AK105266	Pistil-specific extensin-like protein family protein.
4574	54	69	Os02g0611800|mRNA|AK104319|CDS+3'UTR	GACACATTTTGTGCCAACTGTATTTGTATTGTGAACAGTTAATTAATCCGTAAACATTAC	Os02g0611800	AK104319	Similar to Hydroxyanthranilate hydroxycinnamoyltransferase 3.
4575	54	70	Os11g0508600|mRNA|AK101913|CDS+3'UTR	ATGGGCTTTCTGTAATTCAACCTGTAAGGGTTCCTTCCATGATTAATTAATTAGCGTGTT	Os11g0508600	AK101913	Similar to MtN3 protein precursor.
4576	54	71	Os01g0836900|mRNA|AK064231|CDS+3'UTR	TTAACACCAAATAGTGTAAGCACTTGGAATGACTGTCTAATACCAGAGTGCAGATTTCCC	Os01g0836900	AK064231	Conserved hypothetical protein.
4577	54	72	Os02g0590400|mRNA|AK104403|CDS+3'UTR	TAATCATATATATCACGTGTGGAATTCTGTGTAATAAATGAATCCCATGCAGCTTTGTGT	Os02g0590400	AK104403	Lecithin:cholesterol acyltransferase family protein.
4578	54	73	Os08g0535600|mRNA|AK121683|CDS+3'UTR	CAGTGAATTGTTTTATGTAATTCTGGGACAAAAGCGCGCTGTTGTCTCCAGTTTTTTGTC	Os08g0535600	AK121683	Zinc finger, Tim10/DDP-type family protein.
4579	54	74	Os01g0224200|COMBINER_EST|CI246612|6	TCGCTTAGGAGTAGATTTGTAGCCTGTTATCATCTCTTGTCGTTGTAAGGGAACACTGTA	Os01g0224200	CI246612	Conserved hypothetical protein.
4580	54	75	Os03g0336600|mRNA|AK103014|CDS+3'UTR	AGTATGCTGTAGATGCCACTGCAATGTGCTACTATTCTAACTCTTGAGCAATAAGGTTCG	Os03g0336600	AK103014	Reticulon family protein.
4581	54	76	Os01g0513800|mRNA|AK100776|CDS+3'UTR	TGCCAGTGAGCATGGAATTTTGAGTAGCTATATGTTCTGAGAATTTTGTTCTACAATTCT	Os01g0513800	AK100776	Similar to Brix domain containing protein 1 homolog.
4582	54	77	Os07g0608100|mRNA|AK068225|CDS+3'UTR	AACCTGAGTTCTGCTCAATCTTTCTAGAATTCTAATATTTGTGCTCAGTCTTTCTAGAAC	Os07g0608100	AK068225	Conserved hypothetical protein.
4583	54	78	(+)E1A_r60_n11		
4584	54	79	Os02g0610500|mRNA|AK058536|CDS+3'UTR	AGTAGCTGTTTTTGCAACCGTGACCATGGTTCAGTGCTTCAAGTTCAAGGGCGTTAATGT	Os02g0610500	AK058536	Similar to CONSTANS-like protein CO9 (Fragment).
4585	54	80	Os09g0279600|mRNA|AY371050|CDS+3'UTR	GAGTTCACTTCTACCCATTCAATTTTAGGAATAGGAAACATTAGAGAGTGTGTTTGCTGG	Os09g0279600	AY371050	Similar to Topoisomerase 6 subunit B.
4586	54	81	Os11g0244300|mRNA|AK062707|UTR	CATTTCACCAAGCCTCTTGCATAGCAATAACCACTTGGCAAACTGTGACAATGAGAGTGT	Os11g0244300	AK062707	Hypothetical protein.
4587	54	82	Os05g0573200|mRNA|AF155334|CDS+3'UTR	ATCACTTGGTAGGTGGAGATTACAAATAAAGTTTCAGAGCTATTCATGAGAAAGCTCCAG	Os05g0573200	AF155334	Similar to Isocitrate dehydrogenase (Fragment).
4588	54	83	Os02g0668200|COMBINER_EST|Os02g0668200|8	CCAACTGATATTCATTCGAGGGGGAGAAGCAAAAGAATTAGAAGAAGCAAGGATGACAAT	Os02g0668200		Similar to Transposase.
4589	54	84	osa-miR171i|Os03|3'seq	GATCTAGCGCATGCAGCCATGTTTCTTGGATTGAGCCGCGTCAATATCTCTCCTTGCTTC			miRNA
4590	54	85	Os03g0704100|mRNA|AK070474|CDS+3'UTR	TGGTCAGTTCATTCATCCAAATTCTATAATGAATATCTGCATAACTAGGCATAGCAGAAC	Os03g0704100	AK070474	PAP fibrillin family protein.
4591	55	1	Os02g0822300|COMBINER_EST|CI044139|6	CCCAGTTAGGAGGAGGGGTTGGAGATTGTCTTTTCTAGTTTTAGCACTATCCGCCAAAAA	Os02g0822300	CI044139	KH domain containing protein.
4592	55	2	Os04g0577700|mRNA|AK108703|CDS+3'UTR	ATTACTGTACTAGGTTGCGTCCAAGAAATTCTCGGCCTCATCTGATCACGTATCTACCGG	Os04g0577700	AK108703	Protein of unknown function DUF623, plant domain containing protein.
4593	55	3	Os12g0555400|mRNA|AK061098|CDS+3'UTR	TGTCCAGCAGCTAATTAACAGTTTTTTGTGATGCCCTACAGCAAATACACGTTCTTACGA	Os12g0555400	AK061098	Similar to Raffinose synthase protein.
4594	55	4	Os02g0807100|mRNA|AK105477|CDS+3'UTR	AATGTTGCTTGATAACCGGCCGATTGAATACCTGTAACGACTTTCAGAGCTAACGTGAAC	Os02g0807100	AK105477	Similar to Wall-associated kinase-like protein.
4595	55	5	Os07g0586200|mRNA|AK099293|CDS+3'UTR	TATGGTTGATATAAAGTACATATACTGCTTCCTTTGTGCAATAAAGGGAGAATGAGATTC	Os07g0586200	AK099293	Similar to Esterase precursor (EC 3.1.1.-) (Early nodule-specific protein homolog) (Latex allergen Hev b 13).
4596	55	6	Os01g0601700|mRNA|AK072103|CDS+3'UTR	ACAGAGTAGTAGTTCTAAAGAGAGAGATATTGTAACCAAGAAGCTCTTTAATAATACCTG	Os01g0601700	AK072103	Leucine rich repeat, N-terminal domain containing protein.
4597	55	7	Os02g0823500|mRNA|U16257|UTR	CCAAACATATGTGGGGAGTATATTCATTCATATAACAATTATTTCTTAATAGCTACGGTC	Os02g0823500	U16257	"Non-protein coding transcript, unclassifiable transcript."
4598	55	8	Os10g0569300|mRNA|AK072459|CDS+3'UTR	TTGTGCTGCTTGTACAACATGGAACATTAGCAGTACATGTACAAGTAACAAGGAGACAAG	Os10g0569300	AK072459	Protein of unknown function DUF248, methyltransferase putative family protein.
4599	55	9	Os04g0545400|COMBINER_EST|Os04g0545400|8	TCCCGACGCTCGACCTCGGCGGGTCCCACCGGGTGACGGTGGGGCCCGCGGTGGCCACGT	Os04g0545400		Plastocyanin-like domain containing protein.
4600	55	10	Os10g0559700|mRNA|AK068632|5'UTR+CDS	ATACCTGAGGAAAAACAGAAGGCATCGGTTTCTACTTCTAAGCGTGGAGCTACACCACAA	Os10g0559700	AK068632	Conserved hypothetical protein.
4601	55	11	Os02g0626600|COMBINER_EST|CI198223|6	TGGCAAGCGCCTAAAGTAATTGTTTTGTAAGTTTTGAAGTATAATTTACGATTCTTTTTG	Os02g0626600	CI198223	Phenylalanine ammonia-lyase family protein.
4602	55	12	Os09g0567300|mRNA|AK121487|CDS+3'UTR	TGTAAACCAACCTCCCAAAAGAAAGTGGCATTTTATAAGAACTGTACATACACAAGACAG	Os09g0567300	AK121487	Similar to Monodehydroascorbate reductase (EC 1.6.5.4) (MDAR) (Ascorbate free radical reductase) (AFR reductase).
4603	55	13	Os02g0140300|COMBINER_EST|CI552950|0	TCATGTGATTGTGTAACCGGAAATTAAATTCCGTGAGAAAATAATGAAACACGCAATGTC	Os02g0140300	CI552950	Molybdopterin biosynthesis MoaE family protein.
4604	55	14	Os02g0575200|mRNA|AK069567|CDS+3'UTR	TTTTTTCTCTCTTTCAGAATTACAAAAAAGAGAGTGAAGTTAACAGCGACAGCCCCAAAT	Os02g0575200	AK069567	DNA/pantothenate metabolism flavoprotein, C-terminal domain containing protein.
4605	55	15	Os03g0718100|mRNA|AB047313|3'UTR	GATTTTGGACACATATGTTCGGTTTATTCAAATTTAATCAGATGCCTGATGAGGGTACCA	Os03g0718100	AB047313	Actin 1.
4606	55	16	Os06g0693700|mRNA|AK059140|CDS+3'UTR	AGCAACAGAACTCTCCATTGATCGTTCGCAACAGGTTTCATGATTCTAGTTTCATTTTGT	Os06g0693700	AK059140	Protein of unknown function DUF1644 family protein.
4607	55	17	Os04g0506800|mRNA|AK070719|CDS+3'UTR	GTTTTAGTCATTGCAACAAAGCGAAGCAAACGTAAACAACAATCCGTGAACATTTGGGTC	Os04g0506800	AK070719	Glycosyl transferase, family 29 protein.
4608	55	18	Os07g0103000|mRNA|AK063123|CDS+3'UTR	ACTAAGAATGTCAGCTGAGATGTATGAGTGAATGTTGATGTAAGGTAGCAAGAATGGCTT	Os07g0103000	AK063123	Hypothetical protein.
4609	55	19	Os06g0263400|COMBINER_EST|Os06g0263400|8	TGTCGTGTGTGCGGCCGATGGAGCGCTCGCCCTTGGTGCGTGCGTGGGCGCGTGGCGGAG	Os06g0263400		Very-long-chain 3-ketoacyl-CoA synthase family protein.
4610	55	20	Os07g0530700|mRNA|AK099533|CDS+3'UTR	CGTTTTGTTCTCAAACCTCAATGCAATCTGTAAAGGAGGCATGATGTTGCTACAAAGACC	Os07g0530700	AK099533	Conserved hypothetical protein.
4611	55	21	Os04g0431300|mRNA|AK063893|CDS+3'UTR	ACAAATGTATTGTTTCATCAGTTGCACCATGATCTATTTACAAGGCAACACCATGTACTA	Os04g0431300	AK063893	Conserved hypothetical protein.
4612	55	22	Os03g0416200|mRNA|AK105862|CDS+3'UTR	AGATCTCCATAATGTACAACACAATCAGGCTGGAAGAGTTTTGGTCAGTCCCCAGTTAGG	Os03g0416200	AK105862	BRITTLE CULM1.
4613	55	23	Os01g0628000|mRNA|AK109274|CDS+3'UTR	CGTCATTCCGGGTTACATGTGAGCAACAAATTCCATGGTCCCCTCGGGCATACTCTGTTT	Os01g0628000	AK109274	Cytochrome P450 family protein.
4614	55	24	Os04g0258100|COMBINER|CI433991|6	GCCATGTACTCCATTTATGTAAGAACTTGTTGGATGGATGTAATAGTAACTAAGAACTCG	Os04g0258100	CI433991	(No Hit)
4615	55	25	Os04g0421800|mRNA|AK068951|CDS+3'UTR	CATTCTTTTTTGTACACACACACCTTGTGGTTCTATTTTAAATCTGATAGAGAGTTGGTG	Os04g0421800	AK068951	EF-Hand type domain containing protein.
4616	55	26	Os03g0220700|mRNA|AK069004|CDS+3'UTR	GATTCCTGGTCCTGTTTGAAAATGATCGGATACGGTTATATCTTAAAGATGAGAATTTTG	Os03g0220700	AK069004	Peptidase, trypsin-like serine and cysteine domain containing protein.
4617	55	27	Os12g0577100|mRNA|AK059444|CDS+3'UTR	TCTCAGCCCAATTTATTGAAGGATGCAATCCACCAAGCAGAAAATCTGTTCTGGAACCAA	Os12g0577100	AK059444	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
4618	55	28	Os06g0726200|mRNA|D10423|5'UTR+CDS	GCCGCCAACGCCTTCCCGAGCTTCGCCACAACCGGCGACGCCGCCACCCGCAAGCGCGAG	Os06g0726200	D10423	Endochitinase precursor (EC 3.2.1.14).
4619	55	29	Os12g0582700|mRNA|AK121238|CDS+3'UTR	GCCATGTGCCTACCACGTGTGGAGATGGAGTCTGTGCTCAAAAGTCTCTAGAAATTTTTT	Os12g0582700	AK121238	Cytochrome P450 family protein.
4620	55	30	Os09g0410700|COMBINER_EST|CI048687|0	GAGTGGGTGTGTAAATCTACTGGTGGTATCTCTCTTGGGGTATATCAACGAAAGGTGGAA	Os09g0410700	CI048687	Conserved hypothetical protein.
4621	55	31	Os04g0178300|mRNA|AY530101|CDS+3'UTR	ACGGGGTTTAATTTCGTGGCGTTTCTGAAAGGTAATTTCTGTGTATGATACTGAACGCCA	Os04g0178300	AY530101	Similar to Copalyl diphosphate synthetase (Fragment).
4622	55	32	Os09g0279200|mRNA|AK062883|CDS+3'UTR	CCCTGAAGAGTCCTTGTTTTTGTTCACTTTCTTGGTTTTTAAGTTCAGGATTAAGGGTTC	Os09g0279200	AK062883	Conserved hypothetical protein.
4623	55	33	Os03g0672300|mRNA|AK109881|CDS+3'UTR	AGCAGCTGCAGATCTGGATGGATATTTACAAATTATACGATGATTCTTGAAATTGTTCTG	Os03g0672300	AK109881	Similar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40).
4624	55	34	osa-miR398a|Os10|3'seq	GCTACTGTATAATGGAGTAATTCTGTAACTGTGTTCTCAGGTCACCCCTTTGGGTTTCTT			miRNA
4625	55	35	Os04g0418900|mRNA|AK073909|UTR	TGTATCCTCCACATGGGTTTGTCGATGGATGTCAGATATCCCTGGAATAAACTTCAGAGA	Os04g0418900	AK073909	Non-protein coding transcript, unclassifiable transcript.
4626	55	36	Os08g0398700|mRNA|AK120068|CDS+3'UTR	GGTTCAGCTTTTGTCAGGACTGGCAATGAAAATCACAAATCTTGTACAGAACTGTTTCAT	Os08g0398700	AK120068	Peptidase M1, membrane alanine aminopeptidase family protein.
4627	55	37	Os01g0347600|COMBINER_EST|CI552130|0	TGAATGGTCCTGTTTGTTCGATGTTTAATGCGCTGGATTTCCCTTGAAAAGTACACATGA	Os01g0347600	CI552130	Peptidase C1A, papain family protein.
4628	55	38	Os01g0927900|mRNA|AB042521|CDS+3'UTR	ACAAGTTCCTCGCTTGAATGTGCTTTCACTTTGGATCTAAAGTGCCTTAAAAGTATTAAA	Os01g0927900	AB042521	Similar to Aspartate kinase precursor (EC 2.7.2.4).
4629	55	39	(+)E1A_r60_a97		
4630	55	40	Os04g0401300|mRNA|AK121122|CDS+3'UTR	CCATTCCATACATGAAAAAGGTAGTTGTATTTGATTGGAACAAAATAAAAGGAAAAAAAA	Os04g0401300	AK121122	CBS domain containing protein.
4631	55	41	Os05g0150800|mRNA|AK104502|CDS+3'UTR	TCGTTCTCATTTTTGTTGTGTGACGGTTATTTCGAGAATAATAAGAATAAGTTTGTCTGT	Os05g0150800	AK104502	Similar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment).
4632	55	42	Os04g0419100|mRNA|AK107777|CDS+3'UTR	TTTCTGAGGGCGTTCGTGCTTTTTGTAACATTTTCTATCTTCCAAAATTTAACGAGAAAG	Os04g0419100	AK107777	Conserved hypothetical protein.
4633	55	43	Os05g0430200|mRNA|AK071740|CDS+3'UTR	ACATTCTGTTAGATGATCCGGAACTCTTTGACATTTCTGGGAAAGATGCTTCAGTACTTG	Os05g0430200	AK071740	Deoxynucleoside kinase family protein.
4634	55	44	Os01g0923600|mRNA|AK068932|CDS+3'UTR	TAATGAATGTGTGGTGAATCTTTAAAGTGAAGCTTATTGCGAATGAGAGTACCCGATCTT	Os01g0923600	AK068932	CG-1 domain containing protein.
4635	55	45	Os01g0279400|mRNA|AF543418|CDS+3'UTR	TCTGAACTCCGAACCATTGGATGGTCGAGGCATATGATAAACAGCTAACGGGATCTTGTT	Os01g0279400	AF543418	Major facilitator superfamily antiporter.
4636	55	46	Os05g0391000|mRNA|AK109555|5'UTR+CDS	TTTCCTTGTCCGTTTAATACAAAATAGAGTGATTTTCGTCATAGCAGAAAAAATCGGACG	Os05g0391000	AK109555	Conserved hypothetical protein.
4637	55	47	Os11g0648700|mRNA|AK106845|CDS+3'UTR	CACTATTTCGCTCACAACACTTGTTGTAGTACTGAAGTCTAAAATATTGTGCAACTCGTT	Os11g0648700	AK106845	Hypothetical protein.
4638	55	48	Os02g0522300|mRNA|AK068634|CDS+3'UTR	AGATCCCCGGATTTCTTGTTGCTGAACTCCACTTGTGCTACTTCTGTTGATCTGATCCAT	Os02g0522300	AK068634	Hypothetical protein.
4639	55	49	Os07g0172200|mRNA|AK103352|CDS+3'UTR	TAAACAAGAGCTGATAAATCATTGTTAGGGTCTGCAATGCAAATTAGTACGGCAATTGCA	Os07g0172200	AK103352	Conserved hypothetical protein.
4640	55	50	Os01g0172100|mRNA|AK060343|CDS+3'UTR	AACATTGCTGAATATTCTCAGATCTCGAGAGAAATTCATTAGTGTCCAGGCGCAAAATCA	Os01g0172100	AK060343	Similar to Triose phosphate/phosphate translocator, non-green plastid, chloroplast precursor (CTPT).
4641	55	51	(-)3xSLv1		
4642	55	52	Os09g0569200|mRNA|AK070300|CDS+3'UTR	GGAGTTAGCAAAGGTTCTCGCGGTGTATGTGTTTGTATTTGTTGGTGGAATGTCACTCGA	Os09g0569200	AK070300	Similar to Beta-amylase (EC 3.2.1.2) (1,4-alpha-D-glucan maltohydrolase).
4643	55	53	Os07g0523500|COMBINER|AU095530|6	CCTGTTTTCCACAAGAAGGCAAAAACCACCAAGAAGATTGTGCTGAAGCTGCAATGCCAA	Os07g0523500	AU095530	Similar to 60S ribosomal protein L44 (60S ribosomal protein L41).
4644	55	54	Os10g0517800|mRNA|AK063213|CDS+3'UTR	ATTACCAGCTTACTCTTGAATTGCAAGTTTCGTATTGATGAATAAAAAAACAAGGTTCAG	Os10g0517800	AK063213	Hypothetical protein.
4645	55	55	Os03g0350100|mRNA|AK099754|CDS+3'UTR	CGGGAGGGTCTTGTTCGTGCAATATTGCAATGGCTGTTAAGGTCTTTCAGGTTCTTACTT	Os03g0350100	AK099754	Similar to SAR DNA-binding protein-like protein.
4646	55	56	Os08g0109000|mRNA|AK107316|CDS+3'UTR	TTGTGTTGAACTGTTTGTAGAATTTGTGTAGCAAGGGAAATGACCAATTGGACAATAGGA	Os08g0109000	AK107316	ENTH/VHS domain containing protein.
4647	55	57	Os12g0616500|COMBINER_EST|CI402310|0	GCTGCTAGCTGCTTTTTGCGTTATCCCTGTTCCTTTTTGACTTGTTTTTCAAAGTATTGC	Os12g0616500	CI402310	Sodium/hydrogen exchanger family protein.
4648	55	58	Os05g0455500|mRNA|AK101985|5'UTR+CDS	CCTTACTAGTTCATAAGGATCTTATGAAGAGTCCAGGCCTTGACGACATATTAGTAGCAC	Os05g0455500	AK101985	Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
4649	55	59	Os03g0723700|mRNA|AK101260|CDS+3'UTR	GCCACTTGTATTTTGGGTTGGGCTAAGTATCAACCTTCCCAACGTAATGTACTGTAATAA	Os03g0723700	AK101260	Conserved hypothetical protein.
4650	55	60	Os05g0115900|mRNA|AK060214|CDS+3'UTR	AAATTTTATAGTCCCTCGTCATGTATTTTCGCCCTAAGTTTCAAATAAAACTGCAGAGCC	Os05g0115900	AK060214	Glycoside hydrolase, family 20 protein.
4651	55	61	Os02g0693700|mRNA|AK106518|CDS+3'UTR	AAACGAGGGGTTCACGATTATGTACAAGAGAAAGTATTGGATTTGTTTCTCTTTTTCTGT	Os02g0693700	AK106518	Similar to P-glycoprotein ABCB5.
4652	55	62	Os05g0478900|COMBINER|CI341886|6	TTTTTACCTAGAAAGGTTTTTAACGAGGCAGCCATTGCACTACACAGCTACTTTATTCAT	Os05g0478900	CI341886	(No Hit)
4653	55	63	Os04g0157300|COMBINER|CI104699|6	ATTGTGTTATGCAAGGGGTATTGTCACAGCTCCTTTCCGAGAGGAAGAGTTCTACAGTGA	Os04g0157300	CI104699	(No Hit)
4654	55	64	Os01g0223400|mRNA|AK066253|CDS+3'UTR	GCATTTGCTCCATCCATTGGATTCAGTGATCCGCCTGCCACTCCATCGGCTGGATTAAAC	Os01g0223400	AK066253	Nucleic acid-binding, OB-fold domain containing protein.
4655	55	65	Os07g0227700|mRNA|AK120258|CDS+3'UTR	AACATTTATCAGAATTAGGGTGGTCCAATTGTTTAATTAGAGCTGATGATGCATCTGTGT	Os07g0227700	AK120258	Conserved hypothetical protein.
4656	55	66	Os08g0528000|COMBINER_EST|AU092911|6	TTGTTGAGCTACACTGTATGCATGGTGATTCAGATACTCGTTGAAGTAGCAATAACAAGA	Os08g0528000	AU092911	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
4657	55	67	Os06g0192100|COMBINER_EST|Os06g0192100|8	CGTTCGTCGAGCCCGACGGAAGCTGCAGGAAGAACTTCGCCAAGTTCGTCGAGATAATCT	Os06g0192100		Similar to Flavonol 3-O-glucosyltransferase (EC 2.4.1.91) (UDP-glucose flavonoid 3-O-glucosyltransferase) (Bronze-1) (Bz-McC allele).
4658	55	68	Os12g0538800|mRNA|AK100645|CDS+3'UTR	ACCATTCTGTTACATGAACTGATACAGATTTGTAATTTGGCTGAGATTTTGTGTGCAGTT	Os12g0538800	AK100645	Galactose oxidase, central domain containing protein.
4659	55	69	Os05g0526600|COMBINER_EST|CI205690|6	GCACTGAAGCAGACATGCAGTGTATATACATTGTTTTTTCCATTCGGATATAGTAGCTTT	Os05g0526600	CI205690	Zinc finger, RING-type domain containing protein.
4660	55	70	Os03g0295400|mRNA|AK102201|CDS+3'UTR	TAAAGCTCGGCATTGGTTTTTTGTTGTTCCAGTTTACCATGCACCCTAGTTGCAGTTTAC	Os03g0295400	AK102201	Similar to Ferredoxin.
4661	55	71	Os02g0224500|COMBINER|CI067958|6	CCACGTAGGCTAAAAACCGCTTCAAATCGAGTTATGGGGGGTAATTTGTCCGGTTTCAAT	Os02g0224500	CI067958	(No Hit)
4662	55	72	Os03g0850700|mRNA|AK062083|CDS+3'UTR	CATGAATGATCACTGTTGATGAGAAATGCAAGTTCGTCTGCATCAAAGCATGCATCTTGT	Os03g0850700	AK062083	Similar to Phosphatidylinositol phosphatidylcholine transfer protein sec14 cytosolic-like protein.
4663	55	73	Os12g0175500|mRNA|AK060940|CDS+3'UTR	TTGCTTTTTGAGAGAGGATTTGCAAGGGCAGAGGGCTGTCAGTATTTTGTGGTCGTTTCA	Os12g0175500	AK060940	Similar to Glutaredoxin-like protein.
4664	55	74	Os08g0385100|COMBINER_EST|Os08g0385100|8	CGTCCTCGCCGGCGGCGGCGGGTGCCGGCTCTCCTCCTCGCCGCCGGTGGCCGCGGCCGC	Os08g0385100		Conserved hypothetical protein.
4665	55	75	Os09g0425300|COMBINER_EST|Os09g0425300|8	GACCTCATGGGAATTTATACATAGACAGAGATCAGTGCAAGATTGAGCTAGCGATGTGGC	Os09g0425300		Similar to Procyclic form specific polypeptide B1-alpha precursor (Procyclin B1- alpha) (PARP).
4666	55	76	Os08g0189500|COMBINER_EST|CI545332|0	TTTCTAGACAACTTAATTATGTGTGCTTGCAAACAACCCAACAACACAGTTTTTTGTTGG	Os08g0189500	CI545332	Similar to Oxalate oxidase-like protein or germin-like protein (Germin-like 8) (Germin-like 12).
4667	55	77	Os03g0823500|mRNA|AK058972|CDS+3'UTR	CTTAATCTGCTTGTGATTGCCATCTGATCGTGTGATCTACTGCTACTGCTGATGTTGCCA	Os03g0823500	AK058972	TGF-beta receptor, type I/II extracellular region family protein.
4668	55	78	Os10g0186900|mRNA|AK069635|CDS+3'UTR	ATCTCTCCGATGTGTTATTGCATTATTTGTGTGTAATTAGTTTCTAATACATGTGATTCC	Os10g0186900	AK069635	Conserved hypothetical protein.
4669	55	79	Os03g0401300|mRNA|D29733|5'UTR+CDS	CGACCGCGTCCTGAGCCGCCTCCACAGCGTCAGGGAGCGCATCGGCGACTCCCTCTCCGC	Os03g0401300	D29733	Sucrose synthase 2 (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase 2).
4670	55	80	Os05g0344400|COMBINER_EST|CI476802|6	GAATCGGCCGGTGGGGTTAATTTGCGTGTTTAGGGGAGGATATTGATCGATTCATTTCAT	Os05g0344400	CI476802	Protein of unknown function DUF588 family protein.
4671	55	81	Os05g0274900|COMBINER_EST|AU160938|7	GTCCCTTGCAGACATTAATTATCTGTCTATTTTCTTGTGATGAGAGAAAGAATTATTCAG	Os05g0274900	AU160938	60S ribosomal protein L15.
4672	55	82	Os03g0744600|mRNA|AK065730|CDS+3'UTR	CCACGTTGTGGTTGAGGTCTATCTCTCGTGTTCTGATAAATAAAGCTCAATGAAAGCTTC	Os03g0744600	AK065730	Similar to Ripening-associated protein (Fragment).
4673	55	83	Os03g0653900|COMBINER|CI516611|3	ATTAGCAGTTAGGTAATGCCAGGTTGAGATGAATTGCTGTTGTGGTATGAGTAAAGGACG	Os03g0653900	CI516611	Ribosome-inactivating protein family protein.
4674	55	84	Os01g0936800|mRNA|AK103322|CDS+3'UTR	ACATTTGTAAGGCATCAACGAGGTACCAAAGCAGAACCATCATTATATCGTCGAGTTGCT	Os01g0936800	AK103322	PapD-like domain containing protein.
4675	55	85	RC8		
4676	56	1	osa-miR399a|Os01|3'seq	ATTGCATGGTTCAGGGATCACAGATCTCGTGCCAAAGGAGAATTGCCCTGCGATTTTGTC			miRNA
4677	56	2	Os03g0441400|mRNA|AK119281|CDS+3'UTR	CTATTGGTGATCTTCTGTTGTTCCTTGATGTGTTAAAGGAATCCATACAAGTTATATGTG	Os03g0441400	AK119281	Protein prenyltransferase domain containing protein.
4678	56	3	Os06g0667000|mRNA|AK110075|CDS+3'UTR	GTGTACTGTACTGACAGAAAATGGATGTACTCTGCATATTCAGATTTCAGAATAGATTGT	Os06g0667000	AK110075	Protein kinase-like domain containing protein.
4679	56	4	Os02g0616100|mRNA|AK104455|CDS+3'UTR	TGTCACGTCTAGATCTCACCTCCTGTACTCTTGTGTACTGTACTATGTGAAAATCATTGG	Os02g0616100	AK104455	Conserved hypothetical protein.
4680	56	5	Os04g0562000|mRNA|AK072630|CDS+3'UTR	AGAAAATCTGGATTGATCGATATCCATACCTTGATCTGAGTATGCTCAAATCTGGATTTT	Os04g0562000	AK072630	Zinc finger, DHHC-type domain containing protein.
4681	56	6	Os02g0258300|mRNA|AK104067|CDS+3'UTR	GAAACCGGGCCATGCTGGAAGTATATATAAAAAATGTCAATTGGTTTTTGACCAGTTAAA	Os02g0258300	AK104067	Zinc finger, FYVE/PHD-type domain containing protein.
4682	56	7	Os06g0355300|COMBINER|CI218766|6	TCAGTGAAGAGGCTCTACATTGCTCAGGATCCTAGAGTTCATGCGAAGCTACGATAATAG	Os06g0355300	CI218766	(No Hit)
4683	56	8	Os03g0597600|mRNA|AK069458|CDS+3'UTR	ACAATGGCTTTTGGCTTGGTGTGTCAGACAATCAGCTCAATTTATATCCAAATTCAATTA	Os03g0597600	AK069458	Similar to L-asparaginase (EC 3.5.1.1) (L-asparagine amidohydrolase).
4684	56	9	Os01g0911100|mRNA|AK062123|CDS+3'UTR	AAGATTAAAACTTTTACTGTATACCGATAGGTGGAACATGTCACACGAATGGCCAAATAT	Os01g0911100	AK062123	Similar to DEAD box RNA helicase.
4685	56	10	Os02g0814000|mRNA|AK060071|CDS+3'UTR	TGTTTGTGGTGTCTGGTGATCAGACTGTTAACTGTGATACTACTATTGTCGATTTCATTC	Os02g0814000	AK060071	Protein of unknown function DUF862, eukaryotic domain containing protein.
4686	56	11	(-)3xSLv1		
4687	56	12	Os06g0542600|COMBINER|CI473095|x	ATTCACTGCCTCCCATTTGGTTTACTCCTAGTCTCATAGGATAAGTGTGCATTCAGTTAT	Os06g0542600	CI473095	Protein of unknown function DUF295 family protein.
4688	56	13	Os03g0157800|mRNA|AK067375|CDS+3'UTR	TTGCTCTGATGTATGCCTTCAAATTCATCCTTCTGTGCAGAAAATAGCTGTAGAGAAATG	Os03g0157800	AK067375	3'-5' exonuclease domain containing protein.
4689	56	14	Os03g0301200|mRNA|AK119578|CDS+3'UTR	ATCAAGATGAGTGATATTGTACATCTCTGATTTAAGTTGGTGTAGTTGCCAGGAATGTCT	Os03g0301200	AK119578	Similar to COBRA-like protein 7 precursor.
4690	56	15	Os04g0530000|mRNA|AK066169|CDS+3'UTR	CTTGGAAAGTTGCAATATATGCGAAACTCTTTTGCCTCACTGTAAACATCTGAGAGGCTT	Os04g0530000	AK066169	Conserved hypothetical protein.
4691	56	16	Os01g0683600|mRNA|AK069481|CDS+3'UTR	TTTCCACTCCACATGTATCAGTTATAGCTCTGTACTTTAGAAAGATGCAAGCTTATTAAG	Os01g0683600	AK069481	Protein of unknown function DUF786 family protein.
4692	56	17	Os01g0290800|mRNA|AK119474|5'UTR+CDS	ACAATTCATTCTGGGAAGGTACGAAACCATCCATACAAGAACCTCTTTACATTCAAAATG	Os01g0290800	AK119474	Conserved hypothetical protein.
4693	56	18	Os11g0175000|mRNA|AK109815|CDS+3'UTR	TGTTATAGTGGTACTTGTATACACTTGTGGGATTAACTGTGCTAATTCTGCTGAATTAAG	Os11g0175000	AK109815	Protein of unknown function DUF1618 domain containing protein.
4694	56	19	Os05g0597200|mRNA|X88798|CDS+3'UTR	TTCTCAAGATCAACATTGGAGTATGCTTTTAATGATATCCACTTCTCGGATAAATTTTTA	Os05g0597200	X88798	Non-protein coding transcript, uncharacterized transcript.
4695	56	20	Os10g0114500|mRNA|AY569037|CDS+3'UTR	GTATCTTTGTCATTATCTTTACAAGTAGCAGTGTAATGCGACAATCTCTAATTTAGGTGG	Os10g0114500	AY569037	Barley B recombinant like-protein B (Barley B recombinant like-protein A).
4696	56	21	Os03g0184300|mRNA|AK119613|CDS+3'UTR	ATTTACTAAGCCCTCGGTGAATAATTCAATCACAAGTAAATAATTGAGTAAAATGAAGTC	Os03g0184300	AK119613	Glycosyl transferase, family 8 protein.
4697	56	22	Os08g0542100|mRNA|AK101416|CDS+3'UTR	TATTTCTGAAAGCTTAATAGAGTGTTCATGCTCAGATTATGAAATAGCAGAATCTGTTTT	Os08g0542100	AK101416	Ribosomal protein L7, eukaryotic form family protein.
4698	56	23	Os08g0140700|COMBINER_EST|Os08g0140700|8	AATGGTGAGCTAGACATTGGCTTCTGTCTGCTTGAAGTTAGTGTAGCTTGGTCGCTCATT	Os08g0140700		Conserved hypothetical protein.
4699	56	24	Os09g0566100|mRNA|AK065725|CDS+3'UTR	TCCTTGCCATTGTGATGCGTAAAATTGTTTTGTCGTCGGAAGTTGTTAATTCGGCAGATG	Os09g0566100	AK065725	ENTH/VHS domain containing protein.
4700	56	25	Os02g0736900|COMBINER_EST|CI549323|6	ATGTTGCCTTCTTGGCAACCCGTGATTTCATTTGTGTTCCTCAGGGCCTTATCGCATTCT	Os02g0736900	CI549323	Conserved hypothetical protein.
4701	56	26	Os03g0752800|mRNA|AK121171|CDS+3'UTR	TTGAAAACTTTCGACCCAGATTTGAAAACTTTCAACTCGAGATTTGAAAACTTTCAAGCC	Os03g0752800	AK121171	MADS14 protein.
4702	56	27	Os07g0122200|mRNA|AK120172|CDS+3'UTR	CCCCTGTAATGCTCCTGTTGTTCTCTTATTTGGCTTTACCAGATCTCATCTGGTTTGACC	Os07g0122200	AK120172	Protein of unknown function DUF1719, Oryza sativa family protein.
4703	56	28	Os02g0690600|mRNA|AK110831|CDS+3'UTR	TCTTTCTGATTACCGTGGCTAAGCTGTAACAACAAAGCAGATGGAAATTGTGTTTTTTTT	Os02g0690600	AK110831	U box domain containing protein.
4704	56	29	ETG04_27747		
4705	56	30	Os10g0548700|mRNA|AK065488|CDS+3'UTR	TACAATAAATCGTGCATGCTCATATGAGCAGGTGATGATCAGCTAGCAAATGTTTGATGT	Os10g0548700	AK065488	Protein kinase domain containing protein.
4706	56	31	ETG07_105829		
4707	56	32	Os10g0444400|mRNA|AK121209|CDS+3'UTR	AGTTCAAGTTTCACCAAGCAGGTTAATTGTGAATGTCATCCTGTATTATCATCAGAATTG	Os10g0444400	AK121209	Appr-1-p processing domain containing protein.
4708	56	33	Os12g0619000|mRNA|AK102525|CDS+3'UTR	CAGAGAACTGTATGTGCAAAACTGTGAAAATATGCACAGTACAATAAACCATATGCCCTA	Os12g0619000	AK102525	IQ calmodulin-binding region domain containing protein.
4709	56	34	Os04g0529500|mRNA|AK059419|CDS+3'UTR	CCTTCTATTTCCGTGAGGAGATAGAGGCCGGAGGGTGTATTTCTTATCACCTCAATCAAA	Os04g0529500	AK059419	Similar to C-terminal domain phosphatase-like 1.
4710	56	35	Os01g0176500|mRNA|AK102552|CDS+3'UTR	ACTAGTGAGACAGACATTTACTGTTCATGGTCACTATTATGTGATCATACTGGCGTTGTA	Os01g0176500	AK102552	Conserved hypothetical protein.
4711	56	36	Os06g0167500|mRNA|AK100574|CDS+3'UTR	TTTTAGCCTATAGTTTTGTTGCTCTACCATCATTTATAGCCAGGGTGTAATCTCAAGTTA	Os06g0167500	AK100574	Leucine-rich repeat, plant specific containing protein.
4712	56	37	Os04g0281900|mRNA|AK060229|CDS+3'UTR	ATCTCTGACCTGATCATGATCATCGTCGTCATATACTCATATATCTCTACTCGAACTCGT	Os04g0281900	AK060229	Protein of unknown function DUF588 family protein.
4713	56	38	Os12g0618000|COMBINER|CI473684|0	GTATTTCTCGTCGGCGGTGAAGAAGAATAGCAGGGTACATCTGTTCTACTACAACGTCAA	Os12g0618000	CI473684	Conserved hypothetical protein.
4714	56	39	Os01g0200700|mRNA|AK120350|CDS+3'UTR	ATTAATCAATCGTGTATTCGTGTGGTTTGCCTAGTAAAAAGGTCTATCATACTCAATCGA	Os01g0200700	AK120350	Similar to Metallothionein-like protein type 3 (MT-3) (MWMT3).
4715	56	40	Os08g0436600|COMBINER_EST|CI400283|1	AGGTTCCATGCTATTTTTTGCTCTCAATTTAAAAGCTGGGTTGTATGACCTTTGATCTAA	Os08g0436600	CI400283	Abortive infection protein family protein.
4716	56	41	Os05g0120700|mRNA|AK062874|CDS+3'UTR	TCACAGCAAACCAGCAGGCAGCAGCATTGTTCTGTTGGCAACATTTTGCTTCTGTGAATT	Os05g0120700	AK062874	ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter family protein.
4717	56	42	Os02g0823300|mRNA|AK069544|CDS+3'UTR	CTGAACTGAACAGAAGAGACACTGGCAGTTACTCATATAGATTATTAATCTAATCCCACC	Os02g0823300	AK069544	Similar to Neuralized protein.
4718	56	43	Os09g0541700|mRNA|AK104841|CDS+3'UTR	GTCTTCTGGGTCATTTTATGGATGTACCTTCTGAATGATTTTCTGTTGGATTCCATAATT	Os09g0541700	AK104841	Conserved hypothetical protein.
4719	56	44	Os10g0439200|COMBINER_EST|Os10g0439200|8	CCGGCGGCCAGACGCTGCAGATCAACAGCGTCGTGCCGGAGTGGTGGGAGTTCGGGACGA	Os10g0439200		Similar to Alpha-expansin OsEXPA25.
4720	56	45	Os08g0471900|mRNA|AK069434|CDS+3'UTR	GACCAAATTTGCTTTATCAGAACGTTTCTTGTTTCTTTGCTTAATTACATTGAACGCCAC	Os08g0471900	AK069434	Zinc finger, ZPR1-type domain containing protein.
4721	56	46	Os02g0153700|mRNA|AK100376|CDS+3'UTR	GGACAGACTAATATCATTTCAGCAAATTGATGTTACTTGTTTTTGCTTAGTGAATGTTTA	Os02g0153700	AK100376	Protein kinase-like domain containing protein.
4722	56	47	Os06g0686400|mRNA|AK063215|CDS+3'UTR	CACCCAAATAGCATGATTTGACTGTTCCTACACTGAATAAATATGAGGCCTTGTTCTTGC	Os06g0686400	AK063215	Plant lipid transfer protein/Par allergen family protein.
4723	56	48	Os02g0290300|mRNA|AK068360|CDS+3'UTR	ACGGGGTACCAAATGCCAATGATTAAAGTAACTAATCATCAATTCATCTTTGGTTCAAAG	Os02g0290300	AK068360	Nitrous oxide reductase, N-terminal domain containing protein.
4724	56	49	Os03g0219300|mRNA|AK071837|CDS+3'UTR	GTGTGAGAGTGGGTTTTGTTGTACTTGCATCACAAAAAATAAAAGAATTCGTCAGAAATC	Os03g0219300	AK071837	Similar to Tubulin alpha-2 chain (Alpha-2 tubulin).
4725	56	50	Os07g0675100|mRNA|AK101251|CDS+3'UTR	ATCACCACCAAGTGTTTTGTTACGAGGGTTGAAGCCTACAATGGCCGAAGGCTAATCATT	Os07g0675100	AK101251	Similar to Pectin methylesterase isoform alpha (EC 3.1.1.11) (Fragment).
4726	56	51	Os03g0421300|COMBINER|CI439633|4	AGTATAGTTCTGTTAGTAGGGGTTGACCCCTCCTAGGATTAATCTCAATGGAGGCATCCA	Os03g0421300	CI439633	Conserved hypothetical protein.
4727	56	52	Os08g0244400|mRNA|AK103017|5'UTR+CDS	ATACATCTGTGGATGAAGAAGACAGTTCATCTCCGTCCGTAACTACAAGCCAAACCAGTC	Os08g0244400	AK103017	Conserved hypothetical protein.
4728	56	53	Os08g0141700|mRNA|AK072310|CDS+3'UTR	TTACGTTAGAAACGTTGAGACCATATGTATAGACCAAATTTTTAATATATTTGTTGATGT	Os08g0141700	AK072310	Pectinesterase inhibitor domain containing protein.
4729	56	54	Os04g0520200|COMBINER|CI098833|6	AGGATTAGACTGACGGACTCCTTGCAGCTTCGATCTCGTATCAGATGGTTTTTGGATAGT	Os04g0520200	CI098833	(No Hit)
4730	56	55	Os02g0534400|mRNA|AB073749|CDS+3'UTR	GTTTGCAAACATTTGTTTGTACCACGATCGAGTTGTGTGACAAATAAATTAAGATGCTGA	Os02g0534400	AB073749	Cell wall invertase (EC 3.2.1.26).
4731	56	56	Os02g0814900|COMBINER_EST|CI433923|6	ATGAAACATTTCGAAATAAAAAGAGCACCTGCTAATTGCATGTTGACTGGAAGTTGTATC	Os02g0814900	CI433923	Probable nicotinate-nucleotide adenylyltransferase family protein.
4732	56	57	Os08g0534300|COMBINER_EST|Os08g0534300|8	GGAACTGTTGGAGCAGCTAGGATCAGAAACTACTCTAGAAGGGATATCAAGTGTATCAAA	Os08g0534300		Conserved hypothetical protein.
4733	56	58	Os06g0163300|mRNA|AK058295|CDS+3'UTR	GTTTACAGTTTCGCATGGACAATCACTGCATTTTGTTTTGAACAGAGCATATTAAACAGC	Os06g0163300	AK058295	Harpin-induced 1 domain containing protein.
4734	56	59	Os04g0453300|COMBINER_EST|Os04g0453300|8	GATCGAGGCCATGCGGTCCGTGTGGGAGCGGCACTGGTACTGGAAAAGGTTCGTCAACGA	Os04g0453300		Monosaccharide transporter 1.
4735	56	60	Os12g0558400|mRNA|AK073071|CDS+3'UTR	TCCTCACTTATTGTACACAAAACTAGACTATGTTGGTCTTGATACTGTGTTATTCATTCC	Os12g0558400	AK073071	FBD domain containing protein.
4736	56	61	Os04g0524400|mRNA|AK103349|CDS+3'UTR	ATCAGATCGCAGAGAATAACGTAAACAAGATAATTTATTCCCATTCTTGTCTCTGTACAC	Os04g0524400	AK103349	Conserved hypothetical protein.
4737	56	62	Os05g0130100|COMBINER_EST|Os05g0130100|8	CAAAATAATCCTGCTGATGATAGCATCATGTGAGGAAACAGCAAGCAAAATTAATGGATT	Os05g0130100		Protein kinase domain containing protein.
4738	56	63	Os08g0499700|mRNA|AK109726|CDS+3'UTR	ATGGGCAGGCGCAAAAAGAAAACACCAGCTCTCACACCGAGGGTATGATCGTCGATCACT	Os08g0499700	AK109726	Similar to Pherophorin-S precursor.
4739	56	64	Os03g0753100|mRNA|AB003324|CDS+3'UTR	TCCTCTTCAATTTGTTGCTAATTAAGTGCTTGCCAAACTTTTCTCAGTGTAATGTACTAC	Os03g0753100	AB003324	Transcription factor, MADS-box domain containing protein.
4740	56	65	Os06g0334400|mRNA|AK059487|CDS+3'UTR	TTGTAAACTGCGATATGTTCATTATGTTGTGTACAACAGCACCAGCTTTCCTGGTAATGA	Os06g0334400	AK059487	Similar to Cdk-activating kinase 1At (Cdk-activating kinase CAK1At).
4741	56	66	Os06g0166200|mRNA|AK106360|CDS+3'UTR	GGATAGTTCCTGGATGGCATTGCTGAACATGGATGCACTGACATGCATATCTCGACTATT	Os06g0166200	AK106360	Zinc finger, C2H2-type domain containing protein.
4742	56	67	Os05g0423400|mRNA|AK100233|CDS+3'UTR	ACTCAATGTCAGTTGCTTTTGTGCTTCTCCCTGCTTGTTTAATTAGCCACTGTTCTTGTT	Os05g0423400	AK100233	Similar to PISTILLATA-like MADS box protein.
4743	56	68	Os07g0617000|mRNA|AK067060|CDS+3'UTR	GTTGTAACTTGTAAAATCTCTGATGATGATCTCTGCATCATATGATCAATTTGAGTGCAG	Os07g0617000	AK067060	Similar to Ethylene response factor 2.
4744	56	69	Os11g0684100|mRNA|AK121102|CDS+3'UTR	TGCACTACTATGTTCCATGTTAGGTTAATAGGTTTGTGACTTACTGACTTTGTGTCTGTC	Os11g0684100	AK121102	Disease resistance protein family protein.
4745	56	70	Os05g0533600|mRNA|AY373258|CDS+3'UTR	GAAGAACTAAAATCTTGGCACCCATTGTCGTGTCCCAGTGACAGTGTGGACTATACAGTT	Os05g0533600	AY373258	Similar to Starch synthase IVa (Glycogen (Starch) synthase-like).
4746	56	71	Os03g0295500|COMBINER_EST|AU092681|7	TGAGTCAGCTGTAGCCCTAAGATAAGTTGATCGATGATGTTACTCTTATGATTTGCAACG	Os03g0295500	AU092681	CHCH domain containing protein.
4747	56	72	Os07g0107800|mRNA|AK121984|CDS+3'UTR	ATCCAGGAATAGACCTGTATCTTTGTTTTGTTGTCTGAAACTTGGCCTTCCAGCAAAATA	Os07g0107800	AK121984	Similar to Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kinase).
4748	56	73	Os02g0579600|mRNA|AY177696|CDS+3'UTR	TACACCCTTGTATGCTGAAGGGATACTATTTGCTGTCAAGAGTTGATACTCAGATCAAGA	Os02g0579600	AY177696	Transcription factor MADS27.
4749	56	74	Os02g0135500|mRNA|AK065605|CDS+3'UTR	TAATTGGTTGTTTATTTACAAGTAAATGTCAAGATACAAAATTGTGGATTACTAGTAAGT	Os02g0135500	AK065605	Protein of unknown function DUF563 family protein.
4750	56	75	Os04g0560200|COMBINER_EST|CI445693|6	ATATCAGAATTGGTGTACCGGTTTTTCTCTCATGCTTATGTCAAAACTGAGAAAGAATAC	Os04g0560200	CI445693	Thioredoxin domain 2 containing protein.
4751	56	76	Os10g0431000|mRNA|AK106568|5'UTR+CDS	TGTTGATATGAGTTCTTCAGATAAGAAGGTCCCCGCATTACCAGATGTTGTTGAAGGAAC	Os10g0431000	AK106568	Similar to DNA-binding protein-like.
4752	56	77	(+)E1A_r60_a135		
4753	56	78	Os08g0120600|mRNA|AK069887|CDS+3'UTR	GTGTTTTGTTTTGGTTCTGAATTTTGAAATGAATTCAAAGTGATTTTGTCTGCTGTTTAA	Os08g0120600	AK069887	Similar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13).
4754	56	79	Os01g0232700|mRNA|AK069972|CDS+3'UTR	TAAGGAAAAGGGATATGATCCAGCTATTACTCGAAATAAGGCCCATCCATTTTGAATCTT	Os01g0232700	AK069972	Similar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2.
4755	56	80	Os01g0328300|mRNA|AK064025|CDS+3'UTR	TCTGTAATTTGCTATTGCATACCCTATTAATAATAGAACTCTGGTGGTAGTTTACAAGTT	Os01g0328300	AK064025	Cyclin-like F-box domain containing protein.
4756	56	81	Os06g0644300|COMBINER_EST|Os06g0644300|8	TCAGGAGATGACTGGATCAATATCAAGCACATTCCGCATATACAAATTACAGATAGAAAT	Os06g0644300		Disease resistance protein family protein.
4757	56	82	Os08g0371900|COMBINER_EST|Os08g0371900|8	AATTCGATGCAGAAGCTCAACAGAAGGCTCAATCATGCATGTTTTAAACAGCTTTCCCTA	Os08g0371900		NB-ARC domain containing protein.
4758	56	83	Os12g0267800|COMBINER_EST|Os12g0267800|8	GAGGTGAGCACCGGCGAGGTGATGCACAGCATCTCCGGCGATGTCGCCCAAATCCAAGAA	Os12g0267800		CjMDR1.
4759	56	84	Os11g0647800|Combiner|Os11g0647800|CDS	GATCTAAAGTTTCCAGCATGCTCCTGGTTGTCGTTGAAGAACAAGTATTGGTCCTGTAAC	Os11g0647800		(No Hit)
4760	56	85	Os05g0358000|mRNA|AK101263|CDS+3'UTR	ATAGGAAGTGTTGTACAACTGTATTGTAATCCCAATGGTATGTGATACTGCTTTGTTTTG	Os05g0358000	AK101263	Drought induced 19 family protein.
4761	57	1	Os05g0234700|COMBINER_EST|Os05g0234700|8	TAAGAAGCAAGATGGGACAAGAATATTTGAATGATTGCTTGGTTACATTCATTGAAAGGG	Os05g0234700		Zinc finger, TTF-type domain containing protein.
4762	57	2	Os09g0266000|mRNA|AK061549|CDS+3'UTR	TTTTTCCCCTATCTTAATAAACTTCGACTGGCTTCCGCCAGCCCGGCGAATTAGCCACTG	Os09g0266000	AK061549	Nuclear transport factor 2 domain containing protein.
4763	57	3	Os09g0247600|mRNA|AK107173|CDS+3'UTR	TATATTTCACTCGTGATATTATCTGAACGCTCAAATTAATATAAAAGAGCTACTCCCTCC	Os09g0247600	AK107173	Lipolytic enzyme, G-D-S-L family protein.
4764	57	4	Os09g0537700|mRNA|AK104553|CDS+3'UTR	TGTGCAGGTCTTGTGCACACCTGTGAGGTGAATGGATATATTATGAATATATAACGTGTT	Os09g0537700	AK104553	Ribonuclease T2 family protein.
4765	57	5	Os06g0731500|mRNA|AK062465|UTR	CTTGAGGCAATTCTTTTATTATGATCTGGTGCTGTCAATGGATGTATTGCGGTTTGAACC	Os06g0731500	AK062465	Hypothetical protein.
4766	57	6	Os02g0144900|mRNA|AK060106|CDS+3'UTR	GAGGGAGAGGGAGGAGAGGGTGAGACGAGAGGGGAGAGGGAATGCGGGGAGTGACGGCTA	Os02g0144900	AK060106	Hypothetical protein.
4767	57	7	Os10g0166500|COMBINER_EST|Os10g0166500|8	AGATTCCTGAAGGAGAGGGCAATGGTGATGACACTGATGGGGATTATGGAATGTCTGAAA	Os10g0166500		En/Spm-like transposon proteins family protein.
4768	57	8	Os05g0103400|mRNA|AK066339|CDS+3'UTR	CCAAGACTGTTTTAAATTATTACTGTTTTCTACTAGTATTATATATGCATGGGCAGTTGG	Os05g0103400	AK066339	Conserved hypothetical protein.
4769	57	9	Os03g0269300|mRNA|AK111855|CDS+3'UTR	ATTTAGGATAACGTACGCAGAAGATACATACAGTTCCATCATGGAATCCGGTGAGTCCAT	Os03g0269300	AK111855	Acid phosphatase/vanadium-dependent haloperoxidase family protein.
4770	57	10	Os01g0119000|mRNA|AK105948|CDS+3'UTR	AGCGTATGAACATGCACATTGATTGTATTGATTTGGTAGAGTACATGTATGTCACCGAAT	Os01g0119000	AK105948	Protein of unknown function DUF563 family protein.
4771	57	11	Os09g0436400|mRNA|AK102877|CDS+3'UTR	TGTTCCAGCAAGATGTTTTGTTTGGCTTTTCTGTTTTTAACAAGTTTATGAAAGCTTGGG	Os09g0436400	AK102877	PDZ/DHR/GLGF domain containing protein.
4772	57	12	Os01g0934900|COMBINER_EST|AU082940|6	ATGTAATCAGTGGTTCGGTTGTGTTTTGTGAAGCTAATGATAATATCTCACCAGATCAAT	Os01g0934900	AU082940	Esterase/lipase/thioesterase domain containing protein.
4773	57	13	Os05g0149800|mRNA|AK070081|CDS+3'UTR	TATGCCCTTTGATGCAGTGGTTATTTGTGCCCTTCTCCGTGCCAATCACTAGTTTGCTTT	Os05g0149800	AK070081	EF-Hand type domain containing protein.
4774	57	14	Os01g0503500|mRNA|AK068046|CDS+3'UTR	AGTTTAAGAAGTCATCATATTTGGTTTTGTGGTTTAAGGATATGAATAAGATTCGACGTA	Os01g0503500	AK068046	Conserved hypothetical protein.
4775	57	15	Os02g0601800|mRNA|AB060276|CDS	ATGCTTGGAACGGCAACCACAGAACATATTGTGAGTTCTGTTGATGAGACTAGTCCTGAG	Os02g0601800	AB060276	Bromodomain containing protein.
4776	57	16	Os12g0257500|mRNA|AK106104|CDS+3'UTR	GCCTTAGGCCTTTACAGCCTTAGCCCTGGAATATATAATTTTGTTCAGGTAACGTATCTT	Os12g0257500	AK106104	Conserved hypothetical protein.
4777	57	17	Os09g0479900|COMBINER_EST|CI269495|6	CCTGACCAAAGAAGGTTTGGCTAGTTTGGTGAACAGACTTAGAAATGATAAACTGAAACT	Os09g0479900	CI269495	Conserved hypothetical protein.
4778	57	18	Os08g0104100|mRNA|AK063887|CDS+3'UTR	GAGAATCTGGCTCCATGAATGACAGGGTATTTTGCAATTGTAATACTTATTCAATAACTC	Os08g0104100	AK063887	Conserved hypothetical protein.
4779	57	19	Os03g0855700|mRNA|AK070400|CDS+3'UTR	GTTTGGTGTCTGTAATATATGCACGTTCTAACAAATATCACTGCAAGTGATAAGACATAG	Os03g0855700	AK070400	Nucleic acid-binding, OB-fold domain containing protein.
4780	57	20	Os03g0285800|mRNA|AK067339|CDS+3'UTR	GTGGCTGCTTTGTATGATATATGGTACTATGTTCGAATAAAAGGGTTTGGAACTTTGGAT	Os03g0285800	AK067339	MAP Kinase.
4781	57	21	Os08g0423700|COMBINER|CI221481|6	AGGTGTCTCATCTCTGACGAGCCCCTATATAAAGGCCCGTCAGAGGTGATGATCTCCGGT	Os08g0423700	CI221481	(No Hit)
4782	57	22	Os10g0350500|mRNA|AK070298|CDS+3'UTR	TTGTGGAAGGACATTTGGTACCAACAGAAAACATGAATTATTAGTAATTCCAGTGCTCTT	Os10g0350500	AK070298	Nucleoside phosphatase GDA1/CD39 family protein.
4783	57	23	Os11g0265400|mRNA|AK102327|CDS+3'UTR	GATTCTGAACATACGGATTTTGGTATTTACTTTTACTACTGTTACAGTAGCACCTTACCT	Os11g0265400	AK102327	Glucose/ribitol dehydrogenase family protein.
4784	57	24	Os06g0205600|COMBINER_EST|CI369537|6	CATTGTATGGAAACGATAATTTGTGCCTGATATATACGTTATATATTCCACGTTGGGTCA	Os06g0205600	CI369537	MscS Mechanosensitive ion channel family protein.
4785	57	25	Os01g0172400|mRNA|D73411|CDS+3'UTR	GTGTGTTCATCTGAACTTGATTCTTGATGCAGTTTGTGGCATTACCAGTTTATCATCGTT	Os01g0172400	D73411	Phospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1).
4786	57	26	Os09g0458900|COMBINER_EST|CI032308|0	AATTGATGTATCACTGATTGCTCTTTGAGAAATCAATTGACCCATGTATGTTCTTGATCG	Os09g0458900	CI032308	Calcium-binding EF-hand domain containing protein.
4787	57	27	POsControl0042|art		
4788	57	28	Os03g0183900|COMBINER_EST|CB629960|7	TGCAAGTCCAGCATCTGAAAGGTGTGGATTGAATTCTGAATCCAGTAGAAGGTTGGATGA	Os03g0183900	CB629960	ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter family protein.
4789	57	29	Os11g0439100|COMBINER_EST|Os11g0439100|8	AAGGCCTCTGGGAGGGGGAACATCATCAACATCTCTTCTGCGGCTACCTCCCTCGCGTTG	Os11g0439100		Glucose/ribitol dehydrogenase family protein.
4790	57	30	Os02g0743800|mRNA|AK111254|CDS+3'UTR	GTGGAGCTATAATCCTCAGATTTCGAGGTTGCAGATATGGCGGAGTATAAAATTGCCATG	Os02g0743800	AK111254	CS domain containing protein.
4791	57	31	Os09g0530300|mRNA|AK120444|CDS+3'UTR	ACATATTTACAAACGAAATGTAATTGGTGAATAAAACTTGGGTATAGCTATATTTATTAC	Os09g0530300	AK120444	Cytochrome P450 family protein.
4792	57	32	Os12g0242700|mRNA|AK109188|CDS+3'UTR	CTTGTAAACCAAGTGAATGTAATAGACTCTAAAGATATCACGATGCTTTTCTTGAAAATC	Os12g0242700	AK109188	Similar to 3-oxoacyl-[acyl-carrier-protein] reductase 1, chloroplast precursor (EC 1.1.1.100) (3-ketoacyl-acyl carrier protein reductase 1) (Beta- keto acyl-carrier protein reductase 1).
4793	57	33	Os08g0276000|mRNA|AK070103|CDS+3'UTR	CTCTCCCTATCAGAATGTTATGTACTTGTTGACCTATAATGCGACTACCATTAAAGATAT	Os08g0276000	AK070103	Similar to Transmembrane protein TM9SF3 (Fragment).
4794	57	34	RC8		
4795	57	35	Os09g0445000|mRNA|AK066356|CDS+3'UTR	CCCATGGCACCCTCCTCGAGATCGAGAGGAAGAAGAAGAAGAAGACGAGGAGGCTGGTGA	Os09g0445000	AK066356	Conserved hypothetical protein.
4796	57	36	Os07g0648000|mRNA|AK111216|CDS+3'UTR	TAATCTATTCAATTGATCAGTCAAAACTGTAAATAACAAAAGGCAAGTGTATTCTCATCT	Os07g0648000	AK111216	Armadillo-like helical domain containing protein.
4797	57	37	Os06g0490700|mRNA|AK071337|CDS+3'UTR	ATCCTCATTTGACATGCTTGTTTACGGATGCAGGGGAACAAGGAGAAACATCTGCAAGAC	Os06g0490700	AK071337	Conserved hypothetical protein.
4798	57	38	ETG08_142674		
4799	57	39	Os04g0594400|mRNA|AK067019|CDS+3'UTR	TCTTGCATTAGCGACCTTCTTAATAGGCACCAACCATTGATATACCATTTTGACATGGGA	Os04g0594400	AK067019	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
4800	57	40	Os03g0738400|mRNA|AK063056|CDS+3'UTR	AGGATAGGGGCAAAAAGGTTCCTTTGGATAAGACACAGTTTTTATGGTTCCATAGTTCAC	Os03g0738400	AK063056	Similar to Serine hydroxymethyltransferase, cytosolic (EC 2.1.2.1) (Serine methylase) (Glycine hydroxymethyltransferase) (SHMT).
4801	57	41	Os09g0298500|mRNA|AK062446|CDS+3'UTR	TCCCACATTGCAACCCTGCTTGATTCTCTCCTTCCATTTCAGATGTTGTTTCATCAAAAG	Os09g0298500	AK062446	Zinc finger, RING-type domain containing protein.
4802	57	42	Os02g0146700|mRNA|AK105609|CDS+3'UTR	CCTTTTACCTCCAGTTTATTTATCTGTATGTAGCAAAGTATGTACTGGAAATTTGAGGTC	Os02g0146700	AK105609	Similar to PSMD2 subunit (Fragment).
4803	57	43	Os09g0529900|mRNA|AK121655|CDS+3'UTR	TGTTTGGGCATCTTAGGATTCCCATTTGTAGGTGGTAACTTCTGAGTACCAATAAAAGCC	Os09g0529900	AK121655	HpcH/HpaI aldolase family protein.
4804	57	44	Os09g0571400|mRNA|L29471|CDS+3'UTR	CCGAGCGCGTCCTCATCGAGGACTGCGGCCAGCTCGCCGACGACCACGCCAACTGATTAT	Os09g0571400	L29471	Cyclophilin 1.
4805	57	45	Os07g0230400|COMBINER_EST|CI248509|6	CGAGCGAGAGCTTAGCCCAATTTCTTTGGGACAAAAGTGACTACACCTTCGGGTGTGGTA	Os07g0230400	CI248509	Conserved hypothetical protein.
4806	57	46	Os06g0718100|mRNA|AK070133|CDS+3'UTR	TTTTTGTGGTGTATTGAGAAGACTTGTCCACGTATCAATCTAGCACAAATTGCTTTGCAA	Os06g0718100	AK070133	Similar to Alpha-expansin precursor.
4807	57	47	Os03g0282300|COMBINER_EST|Os03g0282300|8	AGCCACATCTACATCCTGCTCAATTAGCCGAACTACATGCAAAAGCTGAACTTACCGAGA	Os03g0282300		Conserved hypothetical protein.
4808	57	48	Os04g0485700|mRNA|AK058766|CDS+3'UTR	GGCTGCACACTGTATTCAGATTATTTATTCTTTCAATCAAAAACATTGAATTGAATGACT	Os04g0485700	AK058766	Hypothetical protein.
4809	57	49	Os11g0249900|mRNA|AK073005|CDS+3'UTR	GTCATTTTTGTTAGTTAATGTGGAGTGAGCCCCTACAATAATCTGATGAGATGTGGGATT	Os11g0249900	AK073005	Herpesvirus glycoprotein D family protein.
4810	57	50	(+)E1A_r60_a22		
4811	57	51	Os03g0850200|COMBINER_EST|Os03g0850200|8	GGCCTCGTGCTCCACAGGAAGGCGCCCCTCGTGCTCGTGCCCACTAGATACATACAACTA	Os03g0850200		Similar to Cytochrome P450 71E1 (EC 1.14.13.68) (4-hydroxyphenylacetaldehyde oxime monooxygenase).
4812	57	52	Os11g0108700|COMBINER_EST|CI191329|6	ACCTGACCTGCCACTCTGCTAGTGCCTCCATCAACACATCAAATTAATCACCTCTTGTGT	Os11g0108700	CI191329	Similar to Laccase (Diphenol oxidase).
4813	57	53	Os03g0219300|mRNA|D17783|CDS	ATTACTTTTGGAGCGCCTATCAGTAGATTACGGTAGGAAGTCGAAGCTCGGGTTCACAAT	Os03g0219300	D17783	Similar to Tubulin alpha-2 chain (Alpha-2 tubulin).
4814	57	54	Os09g0518200|mRNA|AK121725|CDS+3'UTR	ATATTTGCGATATCTTTTTCCCACTATATTCAATGAAATGGGCACAGTCGGATGCCGATT	Os09g0518200	AK121725	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
4815	57	55	POsControl0033|random		
4816	57	56	Os08g0104600|mRNA|AY072818|CDS+3'UTR	CGAGGGTTAATTGTTGTTGTTTAATTAATGTACGTTTTGCTGCACCTGCTTAATCATATC	Os08g0104600	AY072818	Ferredoxin I, chloroplast precursor (Anti-disease protein 1).
4817	57	57	Os04g0583800|COMBINER|CI274483|6	TTTGAAAACTGGGTGCAAGTAACACCCTCATTATGGTAGGTGAAGCATGGGAGAGCAGAA	Os04g0583800	CI274483	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
4818	57	58	Os04g0469300|COMBINER|CI441424|0	CGCCGCCGGAGGATCCGACTTGCAAGCCGTGCTACCCTCGCTACAGCTACGCGCCGCCGC	Os04g0469300	CI441424	Conserved hypothetical protein.
4819	57	59	osa-miR393b|Os04|Mature	TCCAAAGGGATCGCATTGATCTTCCAAAGGGATCGCATTGATCTTCCAAAGGGATCGCAT			miRNA
4820	57	60	Os01g0799600|mRNA|AK111361|CDS+3'UTR	AAAGACACGCACCAAGTGATACGTACGTAATTGACAATCAAGCTTCTTGCCTAGTTAGGG	Os01g0799600	AK111361	Non-protein coding transcript, unclassifiable transcript.
4821	57	61	Os01g0868200|mRNA|AK119393|CDS+3'UTR	CATGGGATATCAATTTGACGCTGACATTGCGTATGCTGGTGATAATGCGTTAGAGCGTCA	Os01g0868200	AK119393	Zinc finger, DHHC-type domain containing protein.
4822	57	62	Os11g0214700|COMBINER_EST|Os11g0214700|8	GCTCCTTGCTCGACGATGGCGGTGACGCGGTGCCGCGTCAGTTCGGCGACATCGTGGCGC	Os11g0214700		Plant disease resistance response protein family protein.
4823	57	63	Os03g0397700|mRNA|AK111635|CDS+3'UTR	TCTGGTTTTCTTACATGAAAAGAGTGAAAGTGGAAAACAAATGATGCCTGATTCATTCAG	Os03g0397700	AK111635	Similar to Serine/threonine protein kinase-like protein (Strubbelig receptor family 7).
4824	57	64	Os02g0820700|mRNA|AK061365|CDS+3'UTR	TCACAAGAGATTGTACTTTGGAGTCTTAATTGCCATATATAAGACGCTATTAGTATGTGG	Os02g0820700	AK061365	Similar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a).
4825	57	65	Os11g0453900|mRNA|AK109096|CDS+3'UTR	GTACGTGTACGTAGCACTGTATGTAAGTGCGCGTGTGGTATATGGCGTGTTGGTTAATTT	Os11g0453900	AK109096	Dehydrin RAB 16D.
4826	57	66	Os12g0210800|mRNA|AK072548|CDS+3'UTR	CATTCGTTTATCGGTGACTGTTGTCTGTATTGTACTGCCTATACAATAAAGATCATTGTT	Os12g0210800	AK072548	Similar to 3-deoxy-D-manno-2-octulosonic acid-8-phosphate (EC 4.1.2.16) (Fragment).
4827	57	67	Os02g0602300|mRNA|AK066929|CDS+3'UTR	TCTGTATCGATCTTGTACTCAAAACTTATGCTCTTGTTCATGCTGTTGATTACAAAGTTC	Os02g0602300	AK066929	Similar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
4828	57	68	Os05g0249300|COMBINER|CI476617|4	TGCTTCTTCTAGGACTTGAACTTAATGGGGGTAAACCCCTAGTCGGTATGCTTGTGGATT	Os05g0249300	CI476617	(No Hit)
4829	57	69	Os04g0403400|mRNA|AK120071|CDS+3'UTR	CTATACTTGAACTTCACAGCGTATATAGTTGAAGTTTATTTCAAAAACTTTTATTGAGCT	Os04g0403400	AK120071	Tyrosyl-DNA phosphodiesterase family protein.
4830	57	70	(+)E1A_r60_a22		
4831	57	71	Os03g0177400|mRNA|AK072648|CDS+3'UTR	GCTTGTGCTATTCGCTGTTTCTGCTGCTATTGGATACTGGATCGTCTTCCTGTTAATGAA	Os03g0177400	AK072648	EF-1 alpha.
4832	57	72	Os05g0270500|COMBINER_EST|CI436001|6	TTCGTCTGATCTGTTACTCATCGTCATTGAGCTTGTTTTTCTCAAATGATGCATATTGAT	Os05g0270500	CI436001	Ribonuclease P-related protein family protein.
4833	57	73	Os03g0699200|mRNA|AK099383|CDS+3'UTR	AAATTTTGAGCTATTTACCTAGTGTCCAAAGTGTGTTCCCTGATGATTAGTAGCTATTAC	Os03g0699200	AK099383	Pescadillo, N-terminal domain containing protein.
4834	57	74	Os12g0442800|mRNA|AK069818|CDS+3'UTR	AGGGACCAATAATATAATGCTGGCTGACTTGCTTGGATGCTGGAATAAAATCCCGTGCCA	Os12g0442800	AK069818	Similar to Sulfite oxidase (EC 1.8.3.1) (Moco containig protein AtMCP) (At-SO) (AtSOX).
4835	57	75	Os11g0125900|COMBINER_EST|CI355842|1	ATTGAAGCTGTGTCACCCAAAAAACGGCTTCGAGAAATATACAAATGATCTTGAGATCGA	Os11g0125900	CI355842	Nucleoside phosphatase GDA1/CD39 family protein.
4836	57	76	Os01g0322300|COMBINER|CI150999|6	GCAAAGTTGGAGTAGAGACTTTATTCAAAAAATGGAGTGCTATGGGGCTGCTGGCTAAAA	Os01g0322300	CI150999	Inorganic pyrophosphatase family protein.
4837	57	77	Os01g0818000|mRNA|AK070194|CDS+3'UTR	GAAGTTCTGAACCCACAGTTTTCATTCACTTTTAATCTTTTGAATCTGAAGGAGAGGGAG	Os01g0818000	AK070194	Auxin Efflux Carrier family protein.
4838	57	78	Os02g0699300|mRNA|AK067761|CDS+3'UTR	CCTTGAATGTTACAGCTAACTATCGGATGCATTTGTTCACATGTGATGAGTGAAACGCAT	Os02g0699300	AK067761	Similar to ADP-ribosylation factor-like protein.
4839	57	79	Os01g0207300|COMBINER_EST|CI253280|6	TCAAGGAGCACGTCATCAAGCCGGTCATCCCCGACAAGTACCTCGACGAGAAGACCATCT	Os01g0207300	CI253280	Similar to S-adenosylmethionine synthetase 1 (EC 2.5.1.6) (Methionine adenosyltransferase 1) (AdoMet synthetase 1). Splice isoform 2.
4840	57	80	Os07g0130700|COMBINER_EST|Os07g0130700|8	AGTCCATGCACCATAACAGATCCTTCATCAGCAACAAGTTTTGGCACAATATCTAGCACC	Os07g0130700		Similar to Lectin-like receptor kinase 7;1.
4841	57	81	Os11g0169800|mRNA|AK064208|CDS+3'UTR	GGCCTTGTTTCTTGTAAATTACCTGAGATTTTCTTAGCTCTTTGAGAGGTTATCTGAGAT	Os11g0169800	AK064208	Similar to Long-chain-fatty-acid--CoA ligase 4 (EC 6.2.1.3) (Long-chain acyl-CoA synthetase 4) (LACS 4).
4842	57	82	Os11g0220400|mRNA|AK109713|CDS+3'UTR	ACCTGGAACAGGGAAAACCTCTCTTGCTACTTCTTGTGCCTATGATGAAGGAGTCAATCT	Os11g0220400	AK109713	Conserved hypothetical protein.
4843	57	83	Os10g0491000|mRNA|AK100816|CDS+3'UTR	AGCTATGGAGTTTACACAATTATTGTATTGCTTACGGATGATAGAATAAAGGGACGCTGT	Os10g0491000	AK100816	Plant Basic Secretory Protein family protein.
4844	57	84	POsControl0026|random		
4845	57	85	Os07g0607300|mRNA|AK102747|CDS+3'UTR	AGCAGTCTGATTGATCATTGCTTCTCTTATGTTTTCCTCCGGAGTCTGGACTATAGTTTC	Os07g0607300	AK102747	Bromo adjacent region domain containing protein.
4846	58	1	Os07g0631000|mRNA|AK066723|CDS+3'UTR	TGTATTGGGCACACTGCAATAAAATATTGGCAAGTGCGAGTGGTAAGAGGAAAATGCGTG	Os07g0631000	AK066723	Protein of unknown function DUF298 family protein.
4847	58	2	Os02g0186500|mRNA|AK068056|CDS+3'UTR	ATCTGTTTTCGGTATGGTTGTACCATGGCTTGTAAAATTCTGCATATCTGGTGCTGATCC	Os02g0186500	AK068056	Similar to Protein kinase-like protein.
4848	58	3	Os05g0192100|mRNA|AK061404|CDS+3'UTR	TGTACTATTGAGCAAGCTTGTCGCGTGCGTATCTTTGTCTAATAATTAAGAAAAATTGCA	Os05g0192100	AK061404	Acid phosphatase (Class B) family protein.
4849	58	4	Os08g0434300|mRNA|AK058477|CDS+3'UTR	TCTGAGAGGTTGGTTTGTAGCTGGACAAACTAAGGAATAAATCAATTCTTTGATCGTTTT	Os08g0434300	AK058477	Similar to Malate dehydrogenase precursor (EC 1.1.1.37).
4850	58	5	Os01g0684900|mRNA|AK102052|CDS+3'UTR	GTTGCATCCCACGGAAAACGTTTGGCTAGGAAAAAAGGGGTCCTTTTGTGGATAGTAACA	Os01g0684900	AK102052	Multi antimicrobial extrusion protein MatE family protein.
4851	58	6	(+)E1A_r60_n9		
4852	58	7	Os04g0679200|mRNA|AK100266|CDS+3'UTR	TTGTAAATAGTAGTAGGTTGATCCTGACTTGTTTACGTCAGAGCAATTCAAGATCGCTGC	Os04g0679200	AK100266	Similar to Receptor-like serine/threonine kinase.
4853	58	8	Os04g0340100|COMBINER_EST|Os04g0340100|8	GGACGTGGATCCTTTGGGATGGTGTTCGAGGGGATCACCAAATACTCCGTGGAGCGAGAT	Os04g0340100		Protein kinase-like domain containing protein.
4854	58	9	Os09g0349900|COMBINER|CI427432|6	AGCTCAGCTAGCCAGTTATACGTGAACCAATATATCACTTGAAGCTGTTTTCTGATTTTA	Os09g0349900	CI427432	Conserved hypothetical protein.
4855	58	10	Os01g0229300|mRNA|AF326768|CDS+3'UTR	CAATGTGTTGTAAACTTCTAGATTGATGTGTTACCTTACTCTTGAAGTCAACACCGGAGA	Os01g0229300	AF326768	Embryonic flower 1-like protein.
4856	58	11	Os05g0481800|mRNA|AK100952|CDS+3'UTR	AGATGCATTGCTCGAGTACATTAAAATTGGAGTGGCATTAGTTTTGAAGCATTATTCCTG	Os05g0481800	AK100952	Protein prenyltransferase domain containing protein.
4857	58	12	Os02g0462300|COMBINER_EST|CI032899|6	GTTCATGTTCATTGGTGTTAAGTTTTTGTGTGCTTTATAGAGTATCCACTACCATTGCTA	Os02g0462300	CI032899	Endonuclease I family protein.
4858	58	13	Os12g0250700|mRNA|AK069277|CDS+3'UTR	TTTTGGGTTCGTTTGATGTGTAAATTTTATATCCGTACAACGATTCATTATCCTCTCTCC	Os12g0250700	AK069277	Conserved hypothetical protein.
4859	58	14	Os01g0575000|mRNA|AK070726|CDS+3'UTR	CGAAAAATGTATGTACATGTCTTGAAACTGCAGTCCGATTGCTTTTGAGAATGACCCGTT	Os01g0575000	AK070726	Root hair defective 3 GTP-binding family protein.
4860	58	15	Os03g0776900|mRNA|AK107941|CDS+3'UTR	GCTGTGCTGATTGTACCATAGATCTGAACCAAAAAACAAATGCAAGTTACTGGATTGAGT	Os03g0776900	AK107941	Similar to DNAJ protein-like.
4861	58	16	Os07g0404200|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os07g0404200	CI274096	(No Hit)
4862	58	17	Os05g0244500|mRNA|AK064349|CDS+3'UTR	CTGGGTTGTTATATTCTCGAATGGAGTAGCCAAATTTTTTGAGACGAATAAATTGGGCCA	Os05g0244500	AK064349	Glycoside hydrolase, family 5 protein.
4863	58	18	Os01g0543600|COMBINER_EST|CI396297|6	GGTAGATTATAAGGATGGCATGCAGGATTCGGCTGTTATATTATTATAGGATTAGTTTCT	Os01g0543600	CI396297	Cytochrome P450 family protein.
4864	58	19	Os09g0467700|mRNA|AK061600|CDS+3'UTR	ATTCTTGGATGTGATGTATGTTGTTGTTGTTCTTGGATGATTTCGTTATGTTGTTGTTTT	Os09g0467700	AK061600	Conserved hypothetical protein.
4865	58	20	Os01g0114900|COMBINER_EST|Os01g0114900|8	CAAGAAACCGTCCCTCGATGACGAAGGTTGTAAACATGCTAACAGGAAGGTTGCAGAATA	Os01g0114900		Similar to LRK14.
4866	58	21	Os06g0587300|mRNA|AK121885|CDS+3'UTR	CTTACACTATGGATCCGCCACTGACCTTATGCCTGGTTCCATAATCCTTAATTGCTCGTT	Os06g0587300	AK121885	Conserved hypothetical protein.
4867	58	22	Os06g0115400|mRNA|AK112038|CDS+3'UTR	GAATCCTGAACTTCTGATTGACAAACCAAAGAAAATTGTAGTTCCGAAGAAATACATCAC	Os06g0115400	AK112038	Similar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment).
4868	58	23	ETG09_205211		
4869	58	24	Os04g0379800|mRNA|AK064080|CDS+3'UTR	ATGTGCGCATGAGATGTTTAAGAAATGACCAGTAAAAGCATGGGAAAACATAAACTGATT	Os04g0379800	AK064080	Conserved hypothetical protein.
4870	58	25	Os07g0657400|COMBINER_EST|CI061179|0	TACACGTTTCAGTTCTATGAACTTGATGTGAATATATACTCATAAAGATATCAAATACCT	Os07g0657400	CI061179	Protein of unknown function DUF563 family protein.
4871	58	26	Os06g0153800|mRNA|AK104520|CDS+3'UTR	ACTGCTACCGCAAATGTGATTGTAGACTCGTATAGATGCTTTTTATTCATGTTTCCTTTA	Os06g0153800	AK104520	Beta 5 subunit of 20S proteasome.
4872	58	27	Os03g0130700|mRNA|AK100822|CDS+3'UTR	GGAAGCTTAAAAAGGAGTGAAGAAAAAATAAATCGACTGTAGTTGCATATGCAGCTTCAT	Os03g0130700	AK100822	Protein of unknown function DUF265 family protein.
4873	58	28	Os05g0266800|COMBINER|CI469887|6	CTTATGACTATTACTACGAAGACCCCAATAACATAGAAAATCCCTGAAGGTTATACCTCA	Os05g0266800	CI469887	(No Hit)
4874	58	29	Os02g0616800|mRNA|AK070878|CDS+3'UTR	ATTGAGCTTTGTGTATATCTGTTTGGCCCAGTTGGCCCATTTAATCTGTGGTCCAATATT	Os02g0616800	AK070878	Conserved hypothetical protein.
4875	58	30	Os03g0350100|mRNA|AK101143|5'UTR+CDS	TCCACTGAAGAAACACCAAAGAAGCCTGAAGGTGCTTCAAAGAAGAGGAAACATCAAGAG	Os03g0350100	AK101143	Similar to SAR DNA-binding protein-like protein.
4876	58	31	Os12g0223000|mRNA|AK110855|CDS+3'UTR	TTGTAGTGCACCTACATCCTCCATCAGACATGATGGTATTGATCCAGTCAAGTTGTTATA	Os12g0223000	AK110855	Conserved hypothetical protein.
4877	58	32	Os07g0191600|mRNA|AK102563|CDS+3'UTR	TAAAGACCCTTCAAAATGCCTATCCTGTCATTCCTCAGTTCTATAGAATAAACTATTCTC	Os07g0191600	AK102563	ABC transporter related domain containing protein.
4878	58	33	Os07g0415200|mRNA|AK104106|CDS+3'UTR	TGAGATGTCTATTTGTCATCAATCACAACTGAGTATGTACAACTGATGCCTCCTCATTTT	Os07g0415200	AK104106	Ribosomal L23 and L15e, core domain containing protein.
4879	58	34	Os09g0464000|mRNA|AK060777|CDS+3'UTR	CCAAAAACATGTACGATCTTGCCACATTTGGCAAATTATTGTGTTGTATCATTTATCGTG	Os09g0464000	AK060777	Similar to Carbonate dehydratase-like protein.
4880	58	35	Os05g0568600|mRNA|AK063781|CDS+3'UTR	TTTTTTGTATGTGGGTAATACTAATACTTATGTATATATCGTGGATTTTGTATTGGTTTG	Os05g0568600	AK063781	Protein of unknown function DUF1645 family protein.
4881	58	36	Os01g0188400|mRNA|AK072842|CDS+3'UTR	ATTATAAAGAGTGCAATAAGAACATAGTTTTAGCTCCCATTGTAATGGGCAGCATATCTC	Os01g0188400	AK072842	NADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME).
4882	58	37	Os06g0683400|mRNA|AK111897|CDS+3'UTR	TACTACACTCTGCTTGTTTCTTCGTTCCAAGTGGAAACTGGAATCTGAATTAATTGATCA	Os06g0683400	AK111897	Similar to EF-hand Ca2+-binding protein CCD1.
4883	58	38	Os10g0115700|COMBINER|CI418809|x	TGTCAAGAGAAATCAGTGCAGAATGGCAAGGTAGGATGCGATTATTCGATCAGTGCAGAG	Os10g0115700	CI418809	Non-protein coding transcript, unclassifiable transcript.
4884	58	39	Os03g0285700|mRNA|D45423|CDS+3'UTR	CATCCTCAGTACGTTGTCAATGTCTCGGTGGGCTGTTATGCTCAACTGCAATGCTGCATC	Os03g0285700	D45423	Similar to L-ascorbate peroxidase.
4885	58	40	Os06g0687800|mRNA|AK072593|CDS+3'UTR	GAATCTGAGAGCCATTGCTCAATTCTTTTCAACGAAGATGTGAACTGTTGGAAGGCAATG	Os06g0687800	AK072593	Similar to Pincher (EH-domain containing 4).
4886	58	41	Os11g0461200|COMBINER_EST|CI014222|6	CGTTCCAATTTTAATGTAAACTAAACACACCTAAAAGTCTGTCGTGAAATAAGCGTGTAA	Os11g0461200	CI014222	Hypothetical protein.
4887	58	42	Os03g0728800|mRNA|AK068068|CDS+3'UTR	GAATGCTGCGTGTGCTATGCTATGCACACCATTATATAGACAGACGAGTAGAGAGTTTGT	Os03g0728800	AK068068	Similar to RNA helicase (Fragment).
4888	58	43	Os12g0420200|mRNA|AK111792|CDS+3'UTR	TGGGATTGGGAAACTGTAAGATGTGATACAAGGGAGACTAAACTTCATCTAATATATATG	Os12g0420200	AK111792	NAD-dependent epimerase/dehydratase family protein.
4889	58	44	Os01g0185300|mRNA|AK107836|CDS+3'UTR	GCGAAGCGGAGGCGAGAGGTCAAAGGGGAGGGAGATGGTGTCGTGGTGGGAAGCTTCTTT	Os01g0185300	AK107836	Transferase family protein.
4890	58	45	Os06g0645600|COMBINER_EST|Os06g0645600|8	CTGCTCAAGAGCCCCCGGCGGCCGTACCGGCGAGGCGACAGCGGCAGGATGGCGAGGTAG	Os06g0645600		Peptidase S1 and S6, chymotrypsin/Hap domain containing protein.
4891	58	46	Os12g0509800|COMBINER_EST|Os12g0509800|8	TGAGATCTCCGTCAAACCTGTCCCCTTCAAGCATCCGGGTCCGACATCCTCCGCGCATGG	Os12g0509800		Conserved hypothetical protein.
4892	58	47	(+)E1A_r60_a135		
4893	58	48	Os03g0146100|mRNA|AK059438|CDS+3'UTR	ACGTACTGTAAGTGTGGACCTTTGGGAACCCGTTGCTTTGCTTCTGTAAAACTGTGCATG	Os03g0146100	AK059438	Similar to Tonoplast intrinsic protein.
4894	58	49	Os10g0567900|mRNA|AK064083|CDS+3'UTR	ACTCCTGCAAATGACAAGGCTATTTATTTGAATGCTCTATTATTAATTTATTTTACTCCC	Os10g0567900	AK064083	HAT dimerisation domain containing protein.
4895	58	50	Os08g0386200|mRNA|AK111606|CDS+3'UTR	TTCTCCCAACTCTCTCTCATGGAGTTTGGATTTTGCTGGTTTCTGTCAAGCAAAAGAGAG	Os08g0386200	AK111606	WRKY transcription factor 69.
4896	58	51	Os06g0729000|mRNA|AY445521|CDS	GAAGAAATTGCTAGCGCTTCCAGTTGCATATGGTAGATCATTGCTGATGCCCTACTCACT	Os06g0729000	AY445521	Phytoene synthase 1 (EC 2.5.1.32).
4897	58	52	(+)E1A_r60_3		
4898	58	53	Os02g0287000|mRNA|AF052503|CDS+3'UTR	AACCATGGAAAATTGTGAGACTGATTTCATGGCCAGCTCATTTTGAATGCAGTTGAATGA	Os02g0287000	AF052503	Similar to 40S ribosomal protein S3a (CYC07 protein).
4899	58	54	Os08g0359500|mRNA|AK112034|CDS+3'UTR	TTTTTCTTAATGCGCTTTGATGCTTCATCGCTCTGCAATCATATATTAAGCTTTGGATGC	Os08g0359500	AK112034	HSP20-like chaperone domain containing protein.
4900	58	55	Os05g0112000|mRNA|AK105623|CDS+3'UTR	ATGGCATCAGCATCAGATTGTTTCTTTTCTTCAGGCTGATAAAATGAAGACTGTTGTTGC	Os05g0112000	AK105623	Zinc finger, RING-type domain containing protein.
4901	58	56	Os01g0772800|mRNA|AK120871|CDS+3'UTR	AGTTCTTACCGAGATTTTATTTATAGAATCTGTTTGGGAAGAATTACCGAATCCGCGTTT	Os01g0772800	AK120871	Similar to Signal recognition particle 54 kDa protein 2 (SRP54).
4902	58	57	Os03g0268100|mRNA|AK065357|CDS+3'UTR	AGTTACAATCAACTATAGTCAACATTGTTGTACGTGTACATTCGGTTCACTGTTGTATTA	Os03g0268100	AK065357	Conserved hypothetical protein.
4903	58	58	Os01g0520500|COMBINER|CI531058|0	TTGTGTAGGATGAGTTTGTGTTATCAGTGGTACGGATCAGTGGTATATACTATATTCGGA	Os01g0520500	CI531058	Conserved hypothetical protein.
4904	58	59	Os03g0712100|mRNA|AK106258|CDS+3'UTR	ATGACCATAACTGTGTCTGCTACTTGCTAATTTCATGGCTTAATGTCATTTGTACCAAAC	Os03g0712100	AK106258	Conserved hypothetical protein.
4905	58	60	Os01g0805900|mRNA|L19598|CDS+3'UTR	GGGCATGTATCGTAGGCTGTATTTGAGATAATCGTAAGTAATAGGCCGATTGTGTTAAAA	Os01g0805900	L19598	Tubulin beta-2 chain (Beta-2 tubulin).
4906	58	61	Os08g0498400|mRNA|AK061757|CDS+3'UTR	CCTTTGTATGTTTTTCATGCAGGTTTGTGTCTGAGAACAAAAATTAAATTCTAGAGTGAT	Os08g0498400	AK061757	Similar to Caffeoyl-CoA 3-O-methyltransferase (Fragment).
4907	58	62	Os10g0411000|COMBINER|AU173007|6	GTGGTTTAATTAATTATTAGTTAACCCGGTGGATCAACCTGGAGCTTTTAATCCCCATCA	Os10g0411000	AU173007	(No Hit)
4908	58	63	Os07g0609000|mRNA|AK106125|CDS+3'UTR	TGATCTATGGACTATGGAACATGTGCCTTTGTGATTGTAGAGTATTATATGCAGTAATCG	Os07g0609000	AK106125	Dimeric alpha-beta barrel domain containing protein.
4909	58	64	Os01g0762500|mRNA|X05662|CDS+3'UTR	TTTGCTGCTATGTACTGTCCAGTCTTTCGACTAATGATGATAAAGCCTCTCTTTATCCTT	Os01g0762500	X05662	Glutelin subunit mRNA.
4910	58	65	Os04g0460400|COMBINER_EST|AU164510|6	CTCTGTGTGTGTTTCCTTTCATAAATGTATAAGCAAGCCCGTTCGATATCTTTGATACAG	Os04g0460400	AU164510	Protein of unknown function DUF588 family protein.
4911	58	66	Os03g0736300|mRNA|AK104929|CDS+3'UTR	CGTTCAGAGCTCATGTGTGAAGTTCTTTTTGTAGAAATGGAACCTTTATAAACCGTTTTA	Os03g0736300	AK104929	Similar to CEL6=CELLULASE 6 (Fragment).
4912	58	67	osa-miR446|Os06|Mature	CATCAATATGAATATGGGAAATGGCATCAATATGAATATGGGAAATGGCATCAATATGAA			miRNA
4913	58	68	Os06g0256300|mRNA|AK105344|CDS+3'UTR	CGGTACGAAAACTGTCCCGTGTATATGTAGACCTATCTGTGCATTCTTGAATCCCCAAAG	Os06g0256300	AK105344	Similar to Calmodulin-binding heat-shock protein.
4914	58	69	Os02g0442200|COMBINER_EST|Os02g0442200|8	AGCAACCCAAGACAGTCACTCAAATTCGCAGCTTTTTGGGTTTGGCCGGGTACTACCGAA	Os02g0442200		Retrotransposon gag protein family protein.
4915	58	70	Os04g0565900|mRNA|AK109094|CDS+3'UTR	AATGTATTTTAGGTTTTTGAACTTGTACTGCGTGTCATATATGTCCAAATGGATCCCATC	Os04g0565900	AK109094	Helix-loop-helix DNA-binding domain containing protein.
4916	58	71	Os01g0276300|mRNA|AK108165|CDS+3'UTR	TCTGTAATGTAAATATGTAATGCGGCAGTTAAAAGTAATAAAATATCCCCTAATCACTTG	Os01g0276300	AK108165	Similar to Group 3 late embryogenesis abundant protein (Fragment).
4917	58	72	Os07g0589600|COMBINER_EST|Os07g0589600|8	GGCGACAAGAAAGCTCAGAGTGTTCGTCGCAGCAGGATCCTGGACTGGTTCGAGGAACTA	Os07g0589600		Conserved hypothetical protein.
4918	58	73	Os11g0664000|COMBINER|CI517285|x	GGGCAATGTATTTCTCATGTAAAAATTAATGCTGTTTGCTTCTGTTTCTCTTTTGTGAGC	Os11g0664000	CI517285	Protein kinase-like domain containing protein.
4919	58	74	Os07g0262200|mRNA|AK104133|CDS+3'UTR	CGAGTGACTCAACTTTTGGCAACCGGCAATCTTTTTGCAAATTGCAGCTAAACTTTGCAG	Os07g0262200	AK104133	Similar to Prohibitin.
4920	58	75	Os01g0364000|mRNA|AK064031|UTR	GAATTATTCATGTATTCCGAACAAGGTCATATCAATACTATATTACAGTACGATCCGACG	Os01g0364000	AK064031	"Non-protein coding transcript, uncharacterized transcript."
4921	58	76	Os08g0410300|COMBINER_EST|Os08g0410300|8	ACGACACGCATGCTCCAGCGACTCCGTTCCGCTTCTGCTCCCCACATTTAAGCAAAGCGA	Os08g0410300		Major facilitator superfamily protein.
4922	58	77	osa-miR164b|Os05|Mature	TGGAGAAGCAGGGCACGTGCATGGAGAAGCAGGGCACGTGCATGGAGAAGCAGGGCACGT			miRNA
4923	58	78	Os08g0525800|COMBINER_EST|Os08g0525800|8	ACCACCATAGATCCAACTAATCTTCAAGTTGGTGATTTGCTAGTTAGATTGGCATTACTG	Os08g0525800		Virulence factor, pectin lyase fold family protein.
4924	58	79	Os04g0500300|mRNA|AK121460|CDS+3'UTR	CATCTTGCAATGTAACTAAACTTACTTTTATTACTTCGAAATGCAATGAACCACAAAAGG	Os04g0500300	AK121460	Conserved hypothetical protein.
4925	58	80	Os06g0183900|mRNA|AK102112|CDS+3'UTR	ATCTTCTGTAGCAGCTTGTTGGAATAAAGTTGCTTATTTGTATATCTAAGGGGATTTACC	Os06g0183900	AK102112	Protein of unknown function DUF602 family protein.
4926	58	81	Os03g0754900|mRNA|AK106405|CDS+3'UTR	CAACTTGGTAGGAAAATTTTGGCTCTTGTTGGCATTCATGTAAGCAGAATTCAGAACTTG	Os03g0754900	AK106405	Similar to Cleavage stimulation factor 50K chain (Cleavage stimulation factor 50).
4927	58	82	Os08g0556000|mRNA|AK068463|CDS+3'UTR	GGTGATGGTAACAATAACAACTTGTTAATAATAAAGAGAGTGTGACCTTGTGGTGGTCGC	Os08g0556000	AK068463	Similar to YTH domain protein 2 (High-glucose-regulated protein 8) (NY-REN-2 antigen) (CLL-associated antigen KW-14).
4928	58	83	Os07g0589400|mRNA|AK104617|CDS+3'UTR	TAATTCGAATGGTACGAGTTGTTGTTTGTGTATGCTCAGGCCTTTGTTCTAGCTGTTTGC	Os07g0589400	AK104617	Quinonprotein alcohol dehydrogenase-like domain containing protein.
4929	58	84	Os04g0608300|mRNA|AK111353|CDS+3'UTR	TTTTGTTGAGTTGAGCTGATGATCTGAATTGGGTAATGCAGCCCTCATGGATGAAATTAA	Os04g0608300	AK111353	Galactokinase family protein.
4930	58	85	Os07g0405100|mRNA|AK111882|CDS+3'UTR	TTGCGGAGAAACTGACCATAGGATATAGTTATGTGTAGAGCGAAATCTTTCCAACATCAT	Os07g0405100	AK111882	Similar to F-box-like/WD-repeat protein ebi.
4931	59	1	Os08g0254500|mRNA|AK072225|CDS+3'UTR	ATTGAGTTCTATGATGTCAACCGTTTTGACCAATGATTAATGACACTGATCATTCTTTTC	Os08g0254500	AK072225	Similar to Preprotein translocase secY subunit, chloroplast precursor (CpSecY).
4932	59	2	Os12g0509600|COMBINER_EST|Os12g0509600|8	AGTTGATTCTTCTTCTCAAGTATCTCTACCGTGTTGCAGGACATTTCCGAAGGGTTCCCT	Os12g0509600		Conserved hypothetical protein.
4933	59	3	Os08g0428200|mRNA|AJ311051|CDS+3'UTR	GTGTTTATTATAATCAATAATTACCGAACTAAAACAGAACAGTGTTGTTTCATTGTTCTA	Os08g0428200	AJ311051	Similar to Typical P-type R2R3 Myb protein (Fragment).
4934	59	4	Os08g0249500|COMBINER|CI422211|6	ATTCTTAACTATCTCACTGTATATGAAGTTTTGAGGATATGATATTTTTGCAGGGGACGC	Os08g0249500	CI422211	Diacylglycerol kinase accessory region domain containing protein.
4935	59	5	Os03g0812500|mRNA|AK102548|UTR	TTGCTGGGCTAAATTTGAGTCAGTTCTTTTGTTTTGGGCCTTTAAATTGACTACAGTGTT	Os03g0812500	AK102548	Non-protein coding transcript, uncharacterized transcript.
4936	59	6	Os03g0435900|mRNA|AK107787|CDS+3'UTR	AGAGTTTAGTAATCGTGGGAACGTTGCCTTTCCTATTTCCAATAGCCAATTGTATGTATC	Os03g0435900	AK107787	Conserved hypothetical protein.
4937	59	7	Os08g0296600|mRNA|AF456246|CDS+3'UTR	GCCCTTCTATGTTACCCAGATAAATACATTGTTATTTTGTGATTATAATTGTAAGGCCGC	Os08g0296600	AF456246	Disease resistance protein family protein.
4938	59	8	Os07g0179000|mRNA|AK100008|CDS+3'UTR	GCATGTATGGTAAATGGTAATGTGCCTTCATCCCTGTATCCTACTACATATGTTGTACCA	Os07g0179000	AK100008	Protein prenyltransferase domain containing protein.
4939	59	9	Os05g0241900|COMBINER_EST|Os05g0241900|8	CAGAATTTGTCTCCTGCTGAAGCCACATGGGAAGACGCATCAGTCATTCAAGCAATGTTT	Os05g0241900		Retrotransposon gag protein family protein.
4940	59	10	Os02g0590100|COMBINER_EST|CI428672|4	AATCGGGGTATGTATAGGGAAGAAAGATTGATATATGTATCATCCATACCATTTGACACA	Os02g0590100	CI428672	Conserved hypothetical protein.
4941	59	11	Os11g0420000|COMBINER_EST|Os11g0420000|8	AATCGTTTTGCTTTTCTTCGTGGTGGATTGGGAATAATTCATCCTTTTGGCATGTTTTGA	Os11g0420000		Similar to Reverse transcriptase (Fragment).
4942	59	12	Os03g0683800|mRNA|AK099266|CDS+3'UTR	GGTGTAATATGTCATGTACATGCGCTTGGATTGTACTATCCCGCTAGCAATGGGTGTTTT	Os03g0683800	AK099266	Similar to Proline-rich protein APG-like.
4943	59	13	Os09g0539100|mRNA|AK071977|CDS+3'UTR	CCCCATTGACAAGAAGGGTTTACTGCATTTTCCTTGCTGTTGCCAATTCTTGCACCAGAT	Os09g0539100	AK071977	Similar to 3-dehydroquinate synthase-like protein.
4944	59	14	Os11g0461000|mRNA|AK062672|CDS+3'UTR	CCTCCAACCCATCAAATCCGGACAGCCGGCGGCGTCAATCCACACGCAGCCGCCATGGTG	Os11g0461000	AK062672	Peptidase S10, serine carboxypeptidase family protein.
4945	59	15	Os03g0625900|mRNA|AK101109|CDS+3'UTR	GGATTTTGAGGCCCTGAACTATGTACCAATACTTTATTGATCTAATCCCTTAAAACTATG	Os03g0625900	AK101109	WD40-like domain containing protein.
4946	59	16	Os03g0160900|COMBINER_EST|CI164683|6	TCATCAGTGTTGTTGGCATCGATCCAGCTTAGTTAGTGTGGGGGATTTTACTTACCTTTT	Os03g0160900	CI164683	Hypothetical protein.
4947	59	17	Os02g0456200|COMBINER_EST|Os02g0456200|8	TATCCTTGAAACTTCCTCAGTGAACTGCTCAGATACCATATGGATCCATCGCTCTGGCAT	Os02g0456200		Similar to G1 to S phase transition protein 1 homolog.
4948	59	18	Os02g0658600|COMBINER_EST|Os02g0658600|8	CTGGTCGAGGACGAGGACGGCGACGGCGACCTGTCGGCGGTGGACCTCATGCAGAGCGGC	Os02g0658600		Similar to Beta-expansin (Fragment).
4949	59	19	Os05g0460600|mRNA|AK072931|CDS+3'UTR	TGCATCTCAAACTGCACCGATCTTGTTATACTAGTAACAAATCTTGATTTGGAACCAAGC	Os05g0460600	AK072931	Similar to GTP cyclohydrolase II/3,4-dihydroxy-2-butanone-4-phosphate synthase- like protein (Fragment).
4950	59	20	Os02g0282900|mRNA|AK121560|CDS+3'UTR	TATTGTGCTTGCTTGGTATTTTCGTTTCACCAAGTAGTACTCTGTTTGCGTTGTAGAACA	Os02g0282900	AK121560	Similar to 68 kDa protein HP68.
4951	59	21	Os01g0862200|mRNA|AK100818|CDS+3'UTR	AAACTTGGAATTCTAAATTGGAGATGTAAATTCCCTGAGAGAAATACATGATACAGTACC	Os01g0862200	AK100818	Conserved hypothetical protein.
4952	59	22	Os10g0539900|mRNA|AK067391|CDS+3'UTR	TCTCCCTGTAACTAGTGGTCTATCACAGTTGTGTTACTGGTTTTGCCTTACTCTTGAGTT	Os10g0539900	AK067391	General substrate transporter family protein.
4953	59	23	Os01g0144100|mRNA|AK058909|CDS+3'UTR	CACGATCACATGACATGAATAAATGTGCAAATGCTTAAGAGCAAGTTCAATAATATAGCC	Os01g0144100	AK058909	Similar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15).
4954	59	24	Os08g0431800|mRNA|AK063114|CDS+3'UTR	ATGAATTTCTATTTATCATAGGTAGAAAGTGGCAACAACATTAGTATGAGCTTTCCAGTC	Os08g0431800	AK063114	Conserved hypothetical protein.
4955	59	25	Os10g0192500|COMBINER|CI332949|6	AGGTAACACAATTCATACTAGATGATCTCTTGTCACCGAAAGGGATGTTTAAAGTGAAGT	Os10g0192500	CI332949	(No Hit)
4956	59	26	Os02g0651500|mRNA|AK121865|CDS+3'UTR	TTCATCTTGCATTGTCATACTGTGAGGGTCTGTAGTATTTTGTCTTTATTTAACAGTCTG	Os02g0651500	AK121865	Hypothetical protein.
4957	59	27	Os11g0116500|mRNA|AK070010|CDS+3'UTR	TCACAATGCTGGCACAGGGGCCTTCTTCTTGAGATTTGGTGAGAGATTCTAGTCTAGGTG	Os11g0116500	AK070010	Similar to Chloroplastic outer envelope membrane protein (OEP75) precursor (Outer membrane protein).
4958	59	28	Os11g0546900|mRNA|U65958|CDS+3'UTR	ATGTCTTCGGCTTTCAGTAGCTATCTTCTAGTACACGAACTGTCGTCGCACCATCGCGGA	Os11g0546900	U65958	Similar to TaWIN1.
4959	59	29	Os01g0631100|mRNA|AK103098|CDS+3'UTR	GTAAAATCAAAGTCACTGAAACACCCAGTGGTAGATTCGTGCATTGGTCATATTTCAGAG	Os01g0631100	AK103098	Cas1p-like family protein.
4960	59	30	Os01g0254800|mRNA|AK067017|CDS+3'UTR	CTCACTGTAAAAACATGATGGTAAAAAAACAGTTTAATCCTATTGGTACTCTTTTATCCC	Os01g0254800	AK067017	Conserved hypothetical protein.
4961	59	31	osa-miR159c|Os01|3'seq	GATGAACCCACCATTGTCTTCCTCTATTGATTGGATTGAAGGGAGCTCCACATCTCTCTC			miRNA
4962	59	32	Os08g0407200|mRNA|AK067568|CDS+3'UTR	ATAGGTATCCGGATAATTTCTATCGTTTTCACAGGATACAAGCCTTACTGTATTTGTTTC	Os08g0407200	AK067568	Peptidase, trypsin-like serine and cysteine domain containing protein.
4963	59	33	Os01g0677100|mRNA|AK108595|CDS+3'UTR	GTTCATGTCACTCTCCAGGAGATGGATTTTCATCTCTCGAGGGAATATTCTCTTTTCTTA	Os01g0677100	AK108595	Conserved hypothetical protein.
4964	59	34	Os04g0113900|COMBINER_EST|Os04g0113900|8	CTGCAATTCTTAGTAAAATAAAGGCAATTAATGATTTTGAGAAGTCAAAAACATGGAACT	Os04g0113900		En/Spm-like transposon proteins family protein.
4965	59	35	Os05g0508700|mRNA|AK063235|CDS	CTTTGAAGAGACAAGAAGAGTTAATTCGAGAGGAGGAGGAAGAGGCATGGCTTCTTGGAA	Os05g0508700	AK063235	TRAF-like domain containing protein.
4966	59	36	Os03g0723000|mRNA|AK101603|CDS+3'UTR	CCTCCAAAACTGTGTTTAGGATGATTGGTATAATTGGGAAATTTTAGCTGAATTATCTTG	Os03g0723000	AK101603	GRAS transcription factor domain containing protein.
4967	59	37	Os02g0778400|mRNA|AK103372|CDS+3'UTR	ACCTCATGGACGATGAAACTTTGTCCTCCCGCCAGTTTCTGGTGGTATAATACAGAAAGT	Os02g0778400	AK103372	Similar to UMP/CMP kinase a (EC 2.7.1.48).
4968	59	38	Os09g0515200|mRNA|AK071380|CDS+3'UTR	GTATGACATTCTGATCGTGCAACTTAGATTTCTACCTTCTGTGGCCGTTAAGCCTGGAAC	Os09g0515200	AK071380	Beta 7 subunit of 20S proteasome.
4969	59	39	Os07g0279200|COMBINER_EST|CI036134|6	CTACTGGTGATGACTTCAATATCCTTAACTGGTGGCATGAGCACAACCACACCTATCCTA	Os07g0279200	CI036134	Zinc finger, BED-type predicted domain containing protein.
4970	59	40	osa-miR172a|Os09|3'seq	AAGACGCACATATACATCCGATTTGGCTGAGAATCTTGATGATGCTGCATCCGCAGACAA			miRNA
4971	59	41	Os02g0170500|COMBINER_EST|CI146605|6	GCATGTGGAGACCCTTGTATGAATTGAGTGTTTGTTCATGTCATGCATCAGTCTGTTGCC	Os02g0170500	CI146605	Histone-fold domain containing protein.
4972	59	42	Os12g0149100|mRNA|AK062909|UTR	GGAGCGGTTTTGATGTAAATATGAGAAACCGTTCAGGTTTCTTGTAAAGAAAACCACATT	Os12g0149100	AK062909	Hypothetical protein.
4973	59	43	Os09g0250300|COMBINER_EST|Os09g0250300|8	CTCGTCGGCCTCTGGACGGCCATAGGCGCCATCAAGGCCATCGACAGGCGACAGGCTTCC	Os09g0250300		Hypothetical protein.
4974	59	44	Os05g0110100|mRNA|AK121142|CDS+3'UTR	TGAGCTACTTTGTCTCTGATATACATATTCATTGTCTCTCGCTGCTCTTCCGTTTAATGG	Os05g0110100	AK121142	Conserved hypothetical protein.
4975	59	45	Os11g0452400|mRNA|AK066853|CDS+3'UTR	GAGAAATCTGCTCTCATCTGAATTATCATCATCATGTTCTCTCATATGTTGGCGGGTTCC	Os11g0452400	AK066853	Conserved hypothetical protein.
4976	59	46	Os05g0505900|mRNA|AK105820|CDS+3'UTR	GTTCGTGTGTGTGTGTGTGTGAACAATTCATTGTTGTTTTGCAATTTCACTGCATCAAAT	Os05g0505900	AK105820	Conserved hypothetical protein.
4977	59	47	Os10g0148400|COMBINER_EST|Os10g0148400|8	GGTGGCCGTGTTCGTCTACCTTGCGCAGCGATACGACTACAAGAACAAATCCAAGCCATG	Os10g0148400		TGF-beta receptor, type I/II extracellular region family protein.
4978	59	48	Os03g0333300|mRNA|AK073228|CDS+3'UTR	TGACCGTAACTCTGCTTCCAACTCTGCTGTGAATTTCAGTTTTATCCGAGACCATGAGGA	Os03g0333300	AK073228	Similar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38).
4979	59	49	Os06g0704600|mRNA|AK119551|CDS+3'UTR	CAGTGCCTCTAATTGGTGTGTAATTTGCGGTGAGGAAATAATATAATCTGCAATTCTGTG	Os06g0704600	AK119551	Similar to Delta-aminolevulinic acid dehydratase (Fragment).
4980	59	50	Os02g0545000|mRNA|AK062923|CDS+3'UTR	TTGTAGACACTCAAGCGCCACGCTTGGGTTACCTTATCCTGCACAACTTGTAGTTAGTAA	Os02g0545000	AK062923	Similar to Myosin.
4981	59	51	Os06g0267500|mRNA|AJ575245|5'UTR+CDS	AGATGATGAAACCGATAAGATAAAGCCCCGTCTTGCTGTTTATGCCCAGTTGCCAGTAGA	Os06g0267500	AJ575245	Similar to NAM1 protein (Fragment).
4982	59	52	Os09g0249000|mRNA|AK072805|CDS+3'UTR	ATCATGTTATCCTGTGTTGTGTAGCTGATGAAATAAATGTGATGCATTGGTCATTGGTGC	Os09g0249000	AK072805	Galactose oxidase, central domain containing protein.
4983	59	53	Os07g0600200|mRNA|AK062681|CDS+3'UTR	TGAGTGTAACTGGGTGTGCGAGTTCGATCGATGTCGTTGTTTTGAGTCGTTGTGTGTTAA	Os07g0600200	AK062681	Conserved hypothetical protein.
4984	59	54	osa-miR399k|Os05|Mature	TGCCAAAGGAAATTTGCCCCGTGCCAAAGGAAATTTGCCCCGTGCCAAAGGAAATTTGCC			miRNA
4985	59	55	Os02g0755600|mRNA|AK064105|CDS+3'UTR	GTCAGTCAAAATTCCTGTTCGTGTCAGAGTATAACATGGAAGGATACGGAGTTTGCTAGC	Os02g0755600	AK064105	Similar to UDP-glucuronosyltransferase.
4986	59	56	Os11g0227200|mRNA|AK065723|CDS+3'UTR	AGGACAAGGAACCGTGTCCTTTTACTTTTGAACTGCATTTGCTAATAATGATGTAACTGT	Os11g0227200	AK065723	Similar to NBS-LRR disease resistance protein homologue.
4987	59	57	POsControl0012|genome		
4988	59	58	Os06g0197000|COMBINER_EST|BI306555|7	ACACCAATGATATCATCCTCTTTTAGAATAAGATGTTTGGTGTCGTTAAATTGCACCTCA	Os06g0197000	BI306555	Hypothetical protein.
4989	59	59	Os10g0540900|mRNA|AK072078|CDS+3'UTR	TACGATTTTATTTTGTGTGGTTATATATTTTTTACCTTGATCAATTATTCATATTCAAAG	Os10g0540900	AK072078	Conserved hypothetical protein.
4990	59	60	Os05g0305100|mRNA|AK099553|CDS+3'UTR	AGCGACCTATACTTGCAAGTTGTATATTAAAACAGGCCTCGAAGAAAAAGGAAAATTTTG	Os05g0305100	AK099553	Similar to Transcription factor IIIB 90 kDa subunit (TFIIIB90) (hTFIIIB90) (B- related factor 1) (BRF-1) (hBRF) (TATA box-binding protein-associated factor, RNA polymerase III, subunit 2) (TAF3B2). Splice isoform 2.
4991	59	61	Os08g0160600|mRNA|AK106763|CDS+3'UTR	TTGTACTTGTAGCAGTAATTAAGAAATGGTGGTTAGTTAATGGTGAGAGGAGGTGAGATT	Os08g0160600	AK106763	Conserved hypothetical protein.
4992	59	62	Os04g0660100|mRNA|AK109923|CDS+3'UTR	ACCGGCTGGGAGCACAATGAATTGAATCATATATACCAAGAAGAAGGCTTTATAGAGAGA	Os04g0660100	AK109923	Helix-loop-helix DNA-binding domain containing protein.
4993	59	63	Os04g0448600|mRNA|AK104134|CDS+3'UTR	TAGTTAGCTGCAGCCTGCAGGCTTGGTCACTCGACCATGCTTTGTCGTATAAAATGTTTT	Os04g0448600	AK104134	ChaC-like protein family protein.
4994	59	64	Os07g0416600|COMBINER_EST|Os07g0416600|8	CTCGTGCGCGCTGCGGATCAGGTTTCCGCGAACAGGAGAGTCGAATCCGAGGAAGCATCA	Os07g0416600		Fatty acyl coA reductase.
4995	59	65	Os07g0636800|COMBINER_EST|CI024427|0	GACTCTCTGTGTGAACAATGTATACACCGCTTTATTTTCGTTCAATAAAGATGTAGTACG	Os07g0636800	CI024427	Plant disease resistance response protein family protein.
4996	59	66	Os02g0720400|COMBINER_EST|Os02g0720400|8	GAGATGGCCATCGGAAAGGAGAGATTGATACCTATGCCTACCGGATTGAGATCAAATACA	Os02g0720400		Protein of unknown function DUF506, plant family protein.
4997	59	67	Os06g0104400|mRNA|AK103829|CDS+3'UTR	TTGTTGCTCTTGTTAGGATCTCTGTCGGCTGTTAAACTGCCAAGATGCCCTAGTTCCATT	Os06g0104400	AK103829	IQ calmodulin-binding region domain containing protein.
4998	59	68	Os08g0492500|mRNA|AK065316|CDS+3'UTR	CAGAGTGCTCCGATCGATGGAGAGGTGTAGCACTTGTGTACAGGGCTTTTGGAAAGCGAA	Os08g0492500	AK065316	RINGv domain containing protein.
4999	59	69	Os10g0410100|mRNA|AK109287|CDS+3'UTR	GTGTGTGTTGTATGAATGAGGGAGTGGTGTCCTAGACTGCATCTCATATTTATAGCTGCT	Os10g0410100	AK109287	Conserved hypothetical protein.
5000	59	70	Os06g0234200|mRNA|AK067253|CDS+3'UTR	GATGTCTTGTGTTTGATAATTGCTTTATCTCAAAAGTTCCAGTTTGATAGTTGCATTTCC	Os06g0234200	AK067253	Similar to RAC-like GTP binding protein ARAC8 (GTPase protein ROP10).
5001	59	71	Os04g0384100|COMBINER_EST|CI455780|0	AGGGCTGTTGACTACTGCAACTACTGGTGATTCTGATCACTGCAAATTGAATTCTATCCT	Os04g0384100	CI455780	Conserved hypothetical protein.
5002	59	72	Os02g0495900|COMBINER_EST|CI510141|3	GTTCACAGTACACTGATATTTTAGTTGCAGTTGATGTCCTGTAAATTTTGGTCTGTGTGC	Os02g0495900	CI510141	Conserved hypothetical protein.
5003	59	73	Os09g0456200|mRNA|AK065873|CDS+3'UTR	CTAGTGTATCTGATATCTAGCGTGTAAACTGTAAAGGAGTATAAGCAGACCTAGTTCTCA	Os09g0456200	AK065873	Similar to BZIP transcription factor ABI5.
5004	59	74	Os01g0177900|mRNA|AK061474|CDS+3'UTR	TATAGCGCTCAAATGTGTACTGCAACTACTATGCATGCATCAATCCATTTCGTTTCTTCA	Os01g0177900	AK061474	ABC-2 type transporter domain containing protein.
5005	59	75	Os10g0561400|mRNA|AY151044|CDS+3'UTR	CAAAATCAGTAATGGTAGTGCTGATCTTCGTGGTTGTACTGTTGTAAACTCTTTTATAAG	Os10g0561400	AY151044	Similar to Transcription factor MYBS3.
5006	59	76	Os11g0198900|mRNA|AK107759|5'UTR+CDS	CGCGATCACTTCCAGCAGCAGTACGTACCCAAGCTAGACGAGATCGCCGAGTCCAAGAAA	Os11g0198900	AK107759	Non-protein coding transcript, unclassifiable transcript.
5007	59	77	Os08g0367300|COMBINER_EST|CI119300|6	TGCAGCAAAATGGACTTTATCACTGACAATTTAATGGAGGTTGACAAGATAAATGGGTGA	Os08g0367300	CI119300	Conserved hypothetical protein.
5009	59	79	Os08g0499800|mRNA|AK102014|CDS+3'UTR	AAACGTATAGATCAATCTCCGGGAAGTAAATTTTTCTCGGATTGGTGGCAGATAAACATT	Os08g0499800	AK102014	Protein prenyltransferase domain containing protein.
5010	59	80	Os01g0773100|mRNA|AK102008|CDS+3'UTR	TTTTTTCATCTCTTATCACCTCTGACGCGGGAAGGCCACTCTGGTGTTTTAACATGTCTA	Os01g0773100	AK102008	Conserved hypothetical protein.
5011	59	81	Os03g0387100|mRNA|AF022735|CDS+3'UTR	TCTGTATCCTCTTGTGCCCATCCTAGTCTCCTCGGCCAGTGCTACAACTATTTGGCGTCT	Os03g0387100	AF022735	Proteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
5012	59	82	Os12g0189700|COMBINER_EST|CI437783|6	GGGCTCTCATGATCTAGCTTGATTGCTTGATTAATCAAGCTAACTGTTCATAATCCACAC	Os12g0189700	CI437783	Tetratricopeptide-like helical domain containing protein.
5013	59	83	Os03g0121700|mRNA|AK099300|CDS+3'UTR	TTTTCAGACTTGTTTGAACGGCAACACCAATAGAGTTCGATATTTTGAGTCAATTAAGAG	Os03g0121700	AK099300	Similar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3).
5014	59	84	Os06g0277700|mRNA|AK063745|CDS+3'UTR	CGACGGAGGTGGAGGACGATGTGCTGCTTGCTGCTTGACGAAGAACGACGATGACGACGC	Os06g0277700	AK063745	Conserved hypothetical protein.
5015	59	85	Os06g0571000|COMBINER_EST|CI348391|6	TTCAGTATGTGAAATAGTGTAACTCAGCTAGCTTATTCATTAACTGTTGGTTACAGATGT	Os06g0571000	CI348391	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
5016	60	1	Os01g0834500|mRNA|AK069399|CDS+3'UTR	TGCCTTGTCAGATTTTTGCTTCTGTTAAGGGGAAAGTACTGTGCTGAGCTATTTTCTCCG	Os01g0834500	AK069399	Similar to 40S ribosomal protein S23 (S12).
5017	60	2	Os01g0686800|mRNA|AK098893|CDS+3'UTR	TCTATGTAGTAGCTCCAGTACTGAGCTCATGGATACTGTGGAATAGGGATCTGTTTTGCA	Os01g0686800	AK098893	Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD).
5018	60	3	Os04g0661300|mRNA|AK103942|CDS+3'UTR	GTAAGAGCAAAACAATTGGTTTAGGAAAAATGCTGATTCCTTTCACCGTCCTGTGAAGGT	Os04g0661300	AK103942	Conserved hypothetical protein.
5019	60	4	Os09g0467200|mRNA|AK061838|CDS+3'UTR	GTCTTAGAGAGACAAACTTAATGCTCTATGATATGTTATCCAGTGTACAATATTGCCTAC	Os09g0467200	AK061838	Similar to Glutathione S-transferase GST 23 (EC 2.5.1.18) (Fragment).
5020	60	5	Os03g0693900|COMBINER_EST|CI243533|6	TAAAATGATGTTGTTCTCCTTATAATGAATTAAGTAAACGTGTGTCTTTTCGTATGTGCA	Os03g0693900	CI243533	Similar to Oxalate oxidase 1 (EC 1.2.3.4) (Germin).
5021	60	6	Os12g0638700|mRNA|AF110268|5'UTR+CDS	ATGGCAAAATGTATCGTGTTAGTAAGGGTGCACCTGAGCAGATTCTCCACCTTGCTCATA	Os12g0638700	AF110268	Plasma membrane H+ ATPase (EC 3.6.3.6).
5022	60	7	Os04g0537800|mRNA|AK103654|CDS+3'UTR	CGGAGCAGCACTACCTTACTTTGGGTCATCGTTTTTTCGTCCACTAATAATTGGCCTACT	Os04g0537800	AK103654	Protein of unknown function DUF26 domain containing protein.
5023	60	8	Os04g0401800|mRNA|AK103868|CDS+3'UTR	GATGTAGTTGAGATTTAACAGTGCCTTCAAAATTTCATGCACATGTGTGCTTATGGACCC	Os04g0401800	AK103868	DNA repair metallo-beta-lactamase domain containing protein.
5024	60	9	Os01g0167500|mRNA|AK062253|CDS+3'UTR	GTTCAACTTCAGCATCTGCTTCAGCATTGTAACAACTTGCCAGCAGGACATAATATCAAC	Os01g0167500	AK062253	Protein of unknown function DUF250 domain containing protein.
5025	60	10	Os02g0580300|mRNA|AK068248|CDS+3'UTR	CATGTCACTTATTGGATCGATTGTTTTCGGTATGTCAGTTGTGAGCCTTATCTCCAGAGT	Os02g0580300	AK068248	Similar to 14-3-3 protein 6.
5026	60	11	Os05g0305100|mRNA|AK099553|CDS+3'UTR	AGCGACCTATACTTGCAAGTTGTATATTAAAACAGGCCTCGAAGAAAAAGGAAAATTTTG	Os05g0305100	AK099553	Similar to Transcription factor IIIB 90 kDa subunit (TFIIIB90) (hTFIIIB90) (B- related factor 1) (BRF-1) (hBRF) (TATA box-binding protein-associated factor, RNA polymerase III, subunit 2) (TAF3B2). Splice isoform 2.
5027	60	12	Os03g0392400|mRNA|AK073726|CDS+3'UTR	TTAATGCTGTAACGGTTTTTGGTATGCCTGCTTATGATCCAGTGTTAATTAAGAATCTCT	Os03g0392400	AK073726	Heat shock protein DnaJ, N-terminal domain containing protein.
5028	60	13	Os02g0252200|mRNA|AK101280|CDS+3'UTR	CAGACAGTCTGAATGCCGTATGAACTTCTTTCTAAATGTTTCAATTCAAGTTTGTTCATC	Os02g0252200	AK101280	Similar to GRAB2 protein.
5029	60	14	Os02g0280300|COMBINER_EST|Os02g0280300|8	AGCAAGTCATCAGTATGCCAGTTGAGTGATTCAGAGCTCGCACGGATGCGGAAAGTGCAG	Os02g0280300		Similar to Xyloglucan endotransglycosylase (Fragment).
5030	60	15	Os11g0549500|COMBINER_EST|Os11g0549500|8	TGAGACTGTGCAAACGCATCCTGAAGATTTAGCAGACAATGTGTTTCACTGCTGGTCAAA	Os11g0549500		Hypothetical protein.
5031	60	16	Os05g0406800|mRNA|AK099640|CDS+3'UTR	GATCATGATGATGGTGGTGTTAGAAATCTGTGATGTTATTTATATATCGCATTGCCATTG	Os05g0406800	AK099640	Leucine rich repeat, N-terminal domain containing protein.
5032	60	17	Os07g0238600|COMBINER_EST|Os07g0238600|8	TTGCTAGAAAGCATTGTAAGAATGTGGATCTGTTGATGGATGTATACCACAAAATTATAT	Os07g0238600		Conserved hypothetical protein.
5033	60	18	Os01g0584300|mRNA|AK073289|CDS+3'UTR	GCAACGTTGAGGGAGAGGAATAAACAGAGAAAGTGAGGACGGAGAGAGGCGGAGAAAGAC	Os01g0584300	AK073289	Non-protein coding transcript, unclassifiable transcript.
5034	60	19	Os01g0167800|mRNA|AK101983|CDS+3'UTR	ATCATTCATTCATTCCTGATCCATTCAGTTACCAATGGAGAGCAGGAGTGGAAACGGAGT	Os01g0167800	AK101983	Protein of unknown function DUF1723 domain containing protein.
5035	60	20	Os11g0183300|COMBINER_EST|Os11g0183300|8	GATGGATGGAAGAGGAGGGGGTTTTCTCTGGCTATTTATAGGCAAGGAGAGGCGGTGGAG	Os11g0183300		Conserved hypothetical protein.
5036	60	21	Os02g0252300|mRNA|AK102101|CDS+3'UTR	GCCTGTGGGACTCTGTCTGGGACTGGACGGTGGGAGACTGGGAGTGGACTGGATCTGAAT	Os02g0252300	AK102101	Non-protein coding transcript, unclassifiable transcript.
5037	60	22	Os07g0142900|mRNA|AK064848|CDS+3'UTR	TGTAGAAAATGAGTCAGAAATTTCTGCCTGCATGAATAGAAAAGGTTTATATGACTTTGA	Os07g0142900	AK064848	Aldo/keto reductase family protein.
5038	60	23	Os07g0121100|mRNA|AK102706|CDS+3'UTR	GAAAACTGAAAATGTCACCTAGTGGTCTGCTCTTTCTTGACCTCTGTAACTGCTTCTCCT	Os07g0121100	AK102706	Protein of unknown function DUF1719, Oryza sativa family protein.
5039	60	24	Os05g0147400|mRNA|AK065883|CDS+3'UTR	TGACTGTAACAGATTTCACTTGTAATCTTTGTCACACTGTCATTTATGCCGTCCTGATGA	Os05g0147400	AK065883	Similar to T-complex protein 1, zeta subunit (TCP-1-zeta) (CCT-zeta) (CCT-zeta-1) (Tcp20) (HTR3) (Acute morphine dependence related protein 2).
5040	60	25	Os05g0217800|mRNA|AK104572|CDS+3'UTR	ACGTCGACACTACACGTGTTTTATTTTGTTAATTAATAAGTCTGGACAACCAGGTCATCT	Os05g0217800	AK104572	Virulence factor, pectin lyase fold family protein.
5041	60	26	Os01g0742300|mRNA|AK065837|CDS+3'UTR	CTGTTTACAGTACAGTGGTTAAAAGATTCAGATCAATAAAAGAAGCATACGTGGTGTTTC	Os01g0742300	AK065837	Hydroxyacid dehydrogenase/reductase family protein.
5042	60	27	Os03g0785900|mRNA|AF050102|CDS+3'UTR	AGTTGCCTCCGATTCTCTGAGATTGTCACTAAATAAAGTTTGTCCTTTGAAACTAAAAAA	Os03g0785900	AF050102	Similar to Glutathione-S-transferase.
5043	60	28	Os08g0549600|COMBINER|CI096761|6	CGGAGGTAGTAATAGATTAGTTATAATGTTGGCTTTAATTTTTCTTCTCCACTCTCTCTC	Os08g0549600	CI096761	Basic-leucine zipper (bZIP) transcription factor domain containing protein.
5044	60	29	Os04g0588600|COMBINER_EST|Os04g0588600|8	TCGCACGAAAAACGAGCTTCGCTCGGTAGTAATGCTAGATGTGGTTGCCATTCAGAAAAA	Os04g0588600		ABC transporter, transmembrane region, type 1 domain containing protein.
5045	60	30	osa-miR399c|Os05|3'seq	GCGGTGAAAAATCTCTAGCTAGCCATGCGTGCCAAAGGAGAATTGCCCTGCGATTCACCA			miRNA
5046	60	31	Os03g0294200|mRNA|AK105724|CDS+3'UTR	TGTTTGTTGAGGATTTGCATGTACAGCTTCAATTATAGTGACCAATGTGGGTTCCTTTGA	Os03g0294200	AK105724	Similar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase.
5047	60	32	Os08g0558700|mRNA|AK103638|CDS+3'UTR	GTTGTAAAAACAGCTTGTATACTCTTCTTGAATACATTGTCTGTTTTTAACTTGCACATG	Os08g0558700	AK103638	Conserved hypothetical protein.
5048	60	33	Os02g0649900|COMBINER_EST|CI446246|4	ACCTGTGTGGTAACGTTACAACGCTTCAACCTCTTCAAAAATTTCCTTTGACTATATATC	Os02g0649900	CI446246	Similar to Iron-phytosiderophore transporter protein yellow stripe 1.
5049	60	34	Os06g0121300|mRNA|AK064715|CDS+3'UTR	AGTATGTATTACTACATGCTTTTTTTAATGAAAGTATTACTACATGCTTGATGATAATGT	Os06g0121300	AK064715	Conserved hypothetical protein.
5050	60	35	Os05g0446900|mRNA|AK101748|CDS+3'UTR	AGAACCAAACATCAATAAGCTGTCAAGTTTGTTCTCAGCTAATGAGCAGCCACACTTCAA	Os05g0446900	AK101748	Glycoside hydrolase, starch-binding domain containing protein.
5051	60	36	Os01g0179600|COMBINER_EST|CI041005|0	TAATTAGCCGAATTTCCTATGTAATTGTGGAAATATATGCTAATGCATATTTGTATTTCA	Os01g0179600	CI041005	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
5052	60	37	Os03g0808100|mRNA|AK061688|CDS+3'UTR	TGGTAGAAACCCCAATGAGTGTATGCACAATGTATGCATAAATATGACTGATTCCTTCTG	Os03g0808100	AK061688	Similar to Cellulose synthase-5.
5053	60	38	Os10g0484800|mRNA|AK105510|CDS+3'UTR	TTACTGTAATCTATGTTTTATGTATCAAACAATGTGAGGTACTCTAGTTTGAATGCAAGA	Os10g0484800	AK105510	Type III polyketide synthase family protein.
5054	60	39	Os03g0167700|mRNA|AK072010|CDS+3'UTR	TGTATTTTGTAGCGTAAGCTTGTATCGATAGTCTTGTAATTTGTATCATCAATGGCAAGG	Os03g0167700	AK072010	Similar to Serine/threonine protein phosphatase PP2A-3 catalytic subunit (EC 3.1.3.16).
5055	60	40	Os10g0520100|COMBINER_EST|CI423152|6	TTTCTTTTTTGACGCCATGTTCGTGTAACTAGCCGGGTCATGATTGGATTAAGTACCTTA	Os10g0520100	CI423152	Protein of unknown function DUF295 family protein.
5056	60	41	Os08g0130100|mRNA|AK120454|CDS+3'UTR	TGGTGCTAGCCTATGTGCTTTTTAGCAAAAAGGAATGGAAATGAGATGAGCAGCATTGTG	Os08g0130100	AK120454	Zinc finger, LSD1-type domain containing protein.
5057	60	42	Os04g0555600|mRNA|AK100443|5'UTR+CDS	TTGGAATCCCATCCAAATCTGATACATTTGGTGGCGGTGGAAGTGGTTGGGAATTTTGGA	Os04g0555600	AK100443	Concanavalin A-like lectin/glucanase domain containing protein.
5058	60	43	Os11g0693800|mRNA|AK061978|CDS+3'UTR	GACGATGACTGGAATCTGCAAGCAAGCAATTGAATGCGTTATGGCCGCAGCATAAATGAA	Os11g0693800	AK061978	Conserved hypothetical protein.
5059	60	44	Os05g0481800|mRNA|AK110987|CDS+3'UTR	GTCCTTTGCTTATGAGACCTGAACTGTTTATCTGAGATTGTTCCACCATAGCGCAAACTT	Os05g0481800	AK110987	Protein prenyltransferase domain containing protein.
5060	60	45	Os01g0908400|mRNA|AK062957|CDS+3'UTR	AGATCTTATAACTTTTTGTCAAATGCAAGCGGCTAAGCTCATGATGAGTTATTTGCAGTT	Os01g0908400	AK062957	Conserved hypothetical protein.
5061	60	46	Os03g0125900|mRNA|AK060370|CDS+3'UTR	GGTGTATCAATACTAATGTATGGTTTTGTACATACTTATGAGTGTCCATTTTGTGCTTGT	Os03g0125900	AK060370	Conserved hypothetical protein.
5062	60	47	Os05g0519000|COMBINER_EST|CI028715|1	CTCGTTCTTGGTGCTTAATTGCTGTAATTTTTTTCTCACTTCATTGAGCGATTTGCTCGC	Os05g0519000	CI028715	VQ domain containing protein.
5063	60	48	Os07g0114500|mRNA|AK064629|CDS+3'UTR	ATGATTTGCCCCCCTTTCATATGAACAATTAGTTAATGATTTAACGTGTCTGACAACTTC	Os07g0114500	AK064629	Conserved hypothetical protein.
5064	60	49	Os04g0690500|mRNA|AK105853|CDS+3'UTR	ATCTGAATGTTCATTCATGTACTTGTGTAAAACTGCTTTTAAGGGCCTCCTATTTTTCTG	Os04g0690500	AK105853	Conserved hypothetical protein.
5066	60	51	Os01g0832300|COMBINER_EST|CI424998|0	GCCTTGTTCCTATGGGGTACCTGATGCCAAGTGTTGTACAATGTTTTGCCGTGTTCAAAT	Os01g0832300	CI424998	Protein kinase domain containing protein.
5067	60	52	Os02g0546500|COMBINER_EST|CI053324|0	TTTTGTTTCGCTATTTTTGTTTTATTTTAAGATGGTGGTATAGCATTTTTCTTCTTTTGT	Os02g0546500	CI053324	Hypothetical protein.
5068	60	53	Os07g0645200|mRNA|AK069294|5'UTR+CDS	AAGCTCGGGATATAATGGACATGTTTTCCTTTTGCATGCCAGACCTCTTTGATTGCATGA	Os07g0645200	AK069294	Armadillo-like helical domain containing protein.
5069	60	54	Os03g0177400|mRNA|D29703|5'UTR+CDS	TTGACAAGCTCAAGGCCGAGCGTGAGAGAGGTATCACCATCGATATCGCCCTGTGGAAGT	Os03g0177400	D29703	EF-1 alpha.
5070	60	55	Os04g0190000|mRNA|AK107543|CDS+3'UTR	TTACTGTAACGAAATCTATCTACTAATAGAAGGTGTAATTTGTTTACTGTAACGAAATCT	Os04g0190000	AK107543	Conserved hypothetical protein.
5071	60	56	Os01g0663800|mRNA|AJ575235|CDS	GATAACAGTCAATACATTGCCTTGCAGCAGAACGACAACTCTGCAATGTGGCTTCATGGA	Os01g0663800	AJ575235	Protein of unknown function DUF1296 family protein.
5072	60	57	Os09g0433400|mRNA|AK062933|UTR	TTTTTTCACGATTTTTCCTTTTCGCTTGCAGTTGCACGGGCCGCATATCTCGTCCTAAGC	Os09g0433400	AK062933	Non-protein coding transcript, unclassifiable transcript.
5073	60	58	Os04g0272700|mRNA|AK106222|CDS+3'UTR	TTTATGGGCTTGTGGCTTGGACTTCTGGCCTGGCCTACTGGGCTGGCGCTAGAGAAAAGT	Os04g0272700	AK106222	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
5074	60	59	Os01g0958200|mRNA|AK107370|CDS+3'UTR	TATGTTTTTGTATTCAACATTTGTTTGTGGGTTTTAACAAAATATAAAGAAAACATTTTT	Os01g0958200	AK107370	Quinonprotein alcohol dehydrogenase-like domain containing protein.
5075	60	60	POsControl0035|random		
5076	60	61	Os12g0114100|mRNA|AK067447|CDS+3'UTR	TATCTAGCCCGCGGCCACAAAATTGTGTATATTTGGAGAGAAGTGCATATATGAGTGTTG	Os12g0114100	AK067447	Similar to MAP kinase-like protein.
5077	60	62	Os03g0637900|mRNA|AK060224|CDS+3'UTR	GTTCATGGTTTCTTAGGTAAATAAGTGGACATGTAAGGATTGTAAATGGTAGTCATTGAC	Os03g0637900	AK060224	Conserved hypothetical protein.
5078	60	63	Os07g0633800|mRNA|AK103878|CDS+3'UTR	GTTGTGAACTATGATGGTGATGAGAACAGTCATTCAGATCTGGAACATATCAAATCACTG	Os07g0633800	AK103878	Conserved hypothetical protein.
5079	60	64	Os02g0197600|mRNA|AK119554|CDS+3'UTR	GTAACATGTAAATTTGTGCTCCAACTGATTTGCACGCATGGTCGCATGGATCGATTTGCT	Os02g0197600	AK119554	Similar to PSI type III chlorophyll a/b-binding protein.
5080	60	65	ETG07_105829		
5081	60	66	Os02g0526700|COMBINER_EST|CI042177|0	TCGTCTGTAATTTCAAGATGGAACAAAACTGCTCATAAGTTGAAATGTGCTGTGGATTTT	Os02g0526700	CI042177	Conserved hypothetical protein.
5082	60	67	Os05g0253200|mRNA|AK066537|CDS+3'UTR	GAATGCGAATGAAGAATTGAACTACTGCAGATGATCTTGCAATGCGTATTGAACCAAGAT	Os05g0253200	AK066537	Protein kinase-like domain containing protein.
5083	60	68	Os07g0532500|mRNA|AK068052|CDS+3'UTR	ATCGTGCTAAATATTGCAAAGCCCAACTGCTGAGTCGGCAAGAATTTGAGGATCGGAAGT	Os07g0532500	AK068052	Ankyrin repeat containing protein.
5084	60	69	Os03g0835600|mRNA|AK101677|CDS+3'UTR	CCTTGTATCGCATTCAATTCTTATTAGGTCGTAAAAAAGCTTGTATACACCTTTTTGTGG	Os03g0835600	AK101677	Acyl-coA-binding protein, ACBP family protein.
5085	60	70	Os07g0152200|COMBINER_EST|Os07g0152200|8	CCTCTGCTTATGATTCTTTTTCGTCTCCAGCATCGGAGGCGCCTATAGAAGATGATTCTT	Os07g0152200		Protein kinase domain containing protein.
5086	60	71	Os01g0857400|mRNA|AK103684|CDS+3'UTR	AGAAGATTTTTTTTCCTTTTATTTTTCTTTTTTTTAAAAGAAGTCATCTTCCCACTTATG	Os01g0857400	AK103684	Amino acid/polyamine transporter II family protein.
5087	60	72	Os09g0506000|mRNA|AK073281|5'UTR+CDS	CCTACATGATTGCAAGTGGAAACCATGAACGGGATTGGCCAAACAGTGGATCTTTCTTCA	Os09g0506000	AK073281	Similar to Diphosphonucleotide phosphatase 1 precursor.
5088	60	73	Os04g0485800|mRNA|AK102446|CDS+3'UTR	TGCGTGCCACAATGTTGTTGTAGTTCTGAGAACATTTGTCACACTACCATGTAATTTACA	Os04g0485800	AK102446	Cyclin-like F-box domain containing protein.
5089	60	74	Os03g0806500|mRNA|AK073308|CDS+3'UTR	GTTGTCAAGATAACTACTGTAAATTTGAGATGTGTGGTGCCAGTTTGAGTAGCCTTTAGA	Os03g0806500	AK073308	Thioredoxin domain 2 containing protein.
5090	60	75	Os05g0473400|mRNA|AK100933|CDS+3'UTR	TCGTCAGGCTGCTTTGGCCATGGCGGTTTGCTGCAACGTGGAGGGGATGAGTGGTCGGAG	Os05g0473400	AK100933	Hypothetical protein.
5091	60	76	Os02g0729400|mRNA|AK058726|CDS+3'UTR	GAATCCGTATAAACAATAGTTGTGCCATGTGTGATATTCCAAATCGGTTTGAATCCTGTG	Os02g0729400	AK058726	Rhodanese-like domain containing protein.
5092	60	77	Os05g0116000|mRNA|AK058320|CDS+3'UTR	CTGTGGTGATTCGCCACTTAAAATTCTATTCTATTCGAGAGTGCCTTCTGGTGCAAATTT	Os05g0116000	AK058320	11-S plant seed storage protein family protein.
5093	60	78	Os10g0504200|mRNA|AK111107|CDS+3'UTR	TCTATGGGCATGTGATGTAACTTTGTAAGTAACTGACGATATTAATTACGAGATGCGAAA	Os10g0504200	AK111107	Cytochrome b561 family protein.
5094	60	79	Os11g0668300|COMBINER_EST|CI477768|6	CCTAATGAGCAGCGGGTGTATTAGCATATTTATATATACACCTTGAACTGTAATTTTCTG	Os11g0668300	CI477768	Hypothetical protein.
5095	60	80	Os02g0514700|COMBINER_EST|Os02g0514700|8	CCAATGATGTACCTTGCACTAATGTATGACCATAGGCTGATCGATGGTAGGGAAGCTGTT	Os02g0514700		Dihydrolipoamide succinyltransferase family protein.
5096	60	81	Os04g0632300|mRNA|AK119388|CDS+3'UTR	ATTGATGTACCCCTAATCCGATTTGCAACATATGGGTAAAAATAAATAAGTGGTTCCATG	Os04g0632300	AK119388	Non-protein coding transcript, unclassifiable transcript.
5097	60	82	Os02g0213100|mRNA|AK062445|CDS+3'UTR	TGTAGGGCCGAGCGATCAGATTGGTACATCTTCAAAAACAATATCCTAGACTTGATTAAT	Os02g0213100	AK062445	Conserved hypothetical protein.
5098	60	83	Os02g0671100|mRNA|AK109758|CDS+3'UTR	TTGGGTTTTGTGTGTCACACAACAATAAGCATCAAATTACATGTATTTCCCATTGTGTTG	Os02g0671100	AK109758	Protein of unknown function DUF295 family protein.
5099	60	84	Os04g0530900|mRNA|AK072297|CDS+3'UTR	TCGTTTTAGACAGGGTTAAAAATTCGTTGTTGATGTGTTCCATAATAAAATACGCAACAA	Os04g0530900	AK072297	Glycosyl transferase, family 8 protein.
5100	60	85	Os09g0299300|COMBINER|CI261388|6	TTTGAAGCGCATCCCAAAACTGTAACGATAATATCATCGTCCGATTTCTCATCCTACGTG	Os09g0299300	CI261388	(No Hit)
5101	61	1	Os03g0196000|COMBINER_EST|AU031675|6	TTTAATGTATCATCGTCTAGATCAAATAAATTTCATTGTTTGTTTGTGTTGATCGATCAA	Os03g0196000	AU031675	Similar to Sulfate permease (Fragment).
5102	61	2	Os07g0484800|mRNA|AK108481|CDS+3'UTR	AGTGTGTAAGTGTACAACTCTAATGGATGGCAACTCTGCTGATCGCGGTGTGGGTGTAGT	Os07g0484800	AK108481	Similar to Adenine phosphoribosyltransferase (EC 2.4.2.7)-like protein.
5103	61	3	Os03g0853500|COMBINER|CI278829|6	ACAAGTAAATAGAGTTTGTGTTCCAAGTTGGAGCTGGGAAAGATTAAGATAGGAGGTGGG	Os03g0853500	CI278829	Disease resistance/zinc finger/chromosome condensation-like region domain containing protein.
5104	61	4	Os12g0583900|mRNA|AK065030|CDS+3'UTR	CCATCTTTTCACTGCATTTGATTGAGAAAACTTCAGAATCAGACCTGATGCACATTGAAC	Os12g0583900	AK065030	Similar to Permease.
5105	61	5	(+)E1A_r60_a104		
5106	61	6	Os03g0127900|mRNA|AK062977|CDS+3'UTR	CATTCTCTTGTCCTAGTATGAGCTACCATTGGAAAGTAGCAGCATTTTATTCTCCCGTGA	Os03g0127900	AK062977	Sodium/hydrogen exchanger family protein.
5107	61	7	Os06g0225200|mRNA|AK104692|CDS+3'UTR	ACTTCATTTTGTAATGTCTAATGTTGACTCTTCTGGTGAAAAAGCATGTAGGTTGTTTGG	Os06g0225200	AK104692	Mitochodrial transcription termination factor-related family protein.
5108	61	8	Os03g0701800|mRNA|AK099707|CDS+3'UTR	CTTGGAGAAGGTTTTCCCCGAGCAAGATTGAACAGTAAATAGATATTGCAAGTTTCTTGG	Os03g0701800	AK099707	Phosphatidylinositol-4-phosphate 5-kinase family protein.
5109	61	9	Os01g0675100|mRNA|AK058509|CDS+3'UTR	TGCCTAGTTGTGAGGACTTTATGATAATGTTTGAATCTGTATCCACTGTTGAATCAAGTA	Os01g0675100	AK058509	peroxiredoxin [Oryza sativa (japonica cultivar-group)].
5110	61	10	Os04g0628400|mRNA|AK072594|5'UTR+CDS	GGCCAAATTCATCAGAAGGGTTTATTTTATCCTTCTAGCGTGCCTAGTTTGAAGTCCAGG	Os04g0628400	AK072594	Zinc finger, BED-type predicted domain containing protein.
5111	61	11	Os02g0208300|COMBINER_EST|CI444593|0	TTGTTTCATTCGTAGGCAATTGACATCTCTATCTGTTCAGTTTGGCATTTATCAAACAGA	Os02g0208300	CI444593	ABC-2 type transporter domain containing protein.
5112	61	12	Os01g0233500|mRNA|AK063476|CDS+3'UTR	GTTCGTGTTGCTTTTGTGAAATTCTCAATAAGAGCACCACATTTTCAACAGTGCTCATTC	Os01g0233500	AK063476	Cyclin.
5113	61	13	Os04g0367200|COMBINER|CI081093|6	AACCTCTTGTCCTTGCCAATGATGTAACGAAAGTCTTTTTCGTGAAGGATATGTCTAGCA	Os04g0367200	CI081093	(No Hit)
5114	61	14	osa-miR419|Os12|3'seq	TGAACTTTTTTTTTCTCTGTTGTCTATGATGAATGCTTGTTGTCCTGGAGATATTGTAGA			miRNA
5115	61	15	Os10g0149700|mRNA|AK064371|CDS+3'UTR	CACAGTGATGAAAATATTGCAGAACTCTATTCATGGCCAATTTTGGGAAGTTATTAACAG	Os10g0149700	AK064371	Conserved hypothetical protein.
5116	61	16	(+)E1A_r60_a20		
5117	61	17	Os05g0543700|mRNA|AK103912|CDS+3'UTR	TGATGCTGTCGTGAGCTCTGAACACGAAGATTTTGTTGGTGCTCTGCAACCTGCATATTA	Os05g0543700	AK103912	Similar to Chaperone protein dnaJ.
5118	61	18	Os01g0710000|mRNA|AK111794|CDS+3'UTR	GGAGTCTCGTATTGGACCTAGTTGTATTGTTAGCCTGACTTGGTGACTTAATCAGATGGT	Os01g0710000	AK111794	Similar to WD-repeat protein RBAP1.
5119	61	19	Os03g0217900|mRNA|AK119980|CDS+3'UTR	GGTATATCGGAAAGGATCCCGTAATGTTCAATTGTAATTGCCTTAACAATCATGTAAGGA	Os03g0217900	AK119980	Conserved hypothetical protein.
5120	61	20	Os01g0873900|COMBINER_EST|CI359283|0	AAAGAAATTCTTTGTGTTTGTTAGCTCTTGTACAAGAAATGCAAGTTTTGAAGAAGGGGG	Os01g0873900	CI359283	Conserved hypothetical protein.
5121	61	21	Os11g0103100|COMBINER_EST|CI270730|6	TGTACCAAGTATTCCAAGAACGTCAGAACAAGTGACTGATGATACCCCTTGACAGCAATC	Os11g0103100	CI270730	Conserved hypothetical protein.
5122	61	22	Os07g0562300|COMBINER_EST|Os07g0562300|8	GAGGAGGCCGGCACCGGCGGCTTGCGCCTCGCCGCCGAGCTGGCCTCCTTCTTCGCGTCG	Os07g0562300		Major facilitator superfamily protein.
5123	61	23	Os11g0264700|mRNA|AK071935|CDS+3'UTR	AGTGACGAAAGTCTCATGAGCTGTGAATTATATATACACACACACACAACACACTTTTCG	Os11g0264700	AK071935	Cyclin-like F-box domain containing protein.
5124	61	24	Os08g0280100|mRNA|AK119420|CDS+3'UTR	ATTTGTGCTCGTGAGTTTGAGTTTGAGTTTGAGTTTGTGCAACATCTGCGGAGTTAACAT	Os08g0280100	AK119420	Similar to Phytase.
5125	61	25	Os10g0536400|mRNA|AK061357|CDS+3'UTR	GTTTTTTGTCCCTGGTTTTGGATATTAGGAGGGTCTCTTAGTATCTTTCTTTTTGTGGAA	Os10g0536400	AK061357	Conserved hypothetical protein.
5126	61	26	Os05g0477100|mRNA|AK108641|CDS+3'UTR	CTGGACAACATGGGGCTCGCATGGTTTTTTGCAGAAAAAGGTTAATACGGGATGACTACA	Os05g0477100	AK108641	Conserved hypothetical protein.
5127	61	27	Os12g0468300|COMBINER_EST|CI312500|6	TGTCTAAGTAACGCGTGTTGCTTATATTTTTAAGTCCTACGTAGCATGGTTTGTAATACT	Os12g0468300	CI312500	NB-ARC domain containing protein.
5128	61	28	Os07g0486500|mRNA|AK068175|CDS+3'UTR	TCCTCTCTAAGAACAAAACAGTTGTTGCAGTGGTTAATATGAGGATTCAGCCGTATAGAT	Os07g0486500	AK068175	Rho GTPase activation protein domain containing protein.
5129	61	29	Os01g0512200|mRNA|AK070837|CDS+3'UTR	TGAGCATAGCACTTGATGTTCTTCATAGCTCCATGGCAATATATTTGTTCATAGTGTACA	Os01g0512200	AK070837	Conserved hypothetical protein.
5130	61	30	Os01g0832900|mRNA|AK068489|CDS+3'UTR	AGGGCAATTCTTGGAGTGGAAGCCCTGCTCTCAGTGTTAAGATTCGTGAGTGTATGTAAA	Os01g0832900	AK068489	Similar to Ser-Thr protein kinase-like protein.
5131	61	31	osa-miR535|Os11|Mature	TGACAACGAGAGAGAGCACGCTGACAACGAGAGAGAGCACGCTGACAACGAGAGAGAGCA			miRNA
5132	61	32	Os01g0279100|mRNA|AK058287|CDS+3'UTR	CATCACAGTGGGGGTTACAGTTTTCCAACAGAAGGGTAATTATATGATGTTTTGGGGTTG	Os01g0279100	AK058287	Similar to Basic leucine zipper transcription factor CAT103 (Fragment).
5133	61	33	Os09g0488600|COMBINER|CI140333|6	TATCTGCTCCGATGTATAATATGCCATTTGGATCTGCACAGTCAGCGTCTCTCTGCTCTT	Os09g0488600	CI140333	Protein kinase PKN/PRK1, effector domain containing protein.
5134	61	34	Os06g0297700|COMBINER_EST|AU101963|6	CTAGTTCTGATGCGCCTTATTACCTGCATCCAACTTCTGTAATTTTTAGTACAAATAATG	Os06g0297700	AU101963	Conserved hypothetical protein.
5135	61	35	Os01g0274300|mRNA|AK107917|CDS+3'UTR	ATGACAGTTTGAAACTGTAGGTGTAACCTTTCGCTCAATACTAAAATCTACAATTGAAGC	Os01g0274300	AK107917	Non-protein coding transcript, unclassifiable transcript.
5136	61	36	Os03g0658800|mRNA|AK063030|CDS+3'UTR	TACCGAATTGATTTTTCTGGACGACACTTTTTAGGACGCAAGTGGACCAAAACTGTTCCT	Os03g0658800	AK063030	Cytochrome P450 family protein.
5137	61	37	PAtControl0003|mRNA|AY056447|3'UTR		
5138	61	38	Os06g0271000|COMBINER_EST|Os06g0271000|8	ATTGGTGGGTCATCGTATAAAAAACTAGAGGAGATGGTCCATGAGATCAGTGAGCTAACT	Os06g0271000		UDP-glucuronosyl/UDP-glucosyltransferase family protein.
5139	61	39	Os08g0561700|mRNA|AK104240|CDS+3'UTR	TTCTCCACCCTGTCAAACTATAAATTGTGAAACATGAGCTGTTCTGGGTATACAACGCAT	Os08g0561700	AK104240	Superoxide dismutase [Cu-Zn], chloroplast precursor (EC 1.15.1.1).
5140	61	40	Os08g0541500|mRNA|AK120995|CDS+3'UTR	TGTTGAAATGAAAAAAGAAAATGAAAGAGTAAATTACACTCGTAATACAGGGACAACAAC	Os08g0541500	AK120995	Protein of unknown function DUF936, plant family protein.
5141	61	41	Os08g0112700|mRNA|AF141868|CDS+3'UTR	GAGATGGGCTATTCCTTCTAACACTAATAATGGCCTGGGGGATACTTGTGTTCATTACTA	Os08g0112700	AF141868	Similar to TAGL12 transcription factor.
5142	61	42	Os07g0272300|mRNA|AK120992|CDS+3'UTR	TCTGATGACAACATGGGCTGAAGAATATCCAAATTTTGTCAACAATGCAAACGTTATTCT	Os07g0272300	AK120992	Hypothetical protein.
5143	61	43	Os11g0151600|mRNA|AK103658|CDS+3'UTR	CCCAATCATAATTAGAATCCCCAAATAGGGTTTTATAAGATATCAGCAGAGTACCAGCTG	Os11g0151600	AK103658	Similar to Schizosaccharomyces pombe (Fragment).
5144	61	44	Os05g0159300|mRNA|AK070904|CDS+3'UTR	TGTGTGTATATCCTAGGGGGTTGATACGTGCAGGTTAATACTATGTATAATTCTTTTCTT	Os05g0159300	AK070904	Lipolytic enzyme, G-D-S-L family protein.
5145	61	45	Os06g0550800|COMBINER_EST|CI413897|5	TTGGTTCATATATATCACGAAATGTATGTAATTCATTGAGAAAAAAGAATAAGAAGGTCC	Os06g0550800	CI413897	Conserved hypothetical protein.
5146	61	46	Os09g0275200|mRNA|AK070953|CDS+3'UTR	TTTAATCTTTCTCAAACATGATTAGCAAGAAGTATAACAAATATAATACCAATTAAGTTT	Os09g0275200	AK070953	Similar to Fimbriata-associated protein (Fragment).
5147	61	47	(+)E1A_r60_a107		
5148	61	48	Os07g0577600|mRNA|AK103966|CDS+3'UTR	ACTATGATGTAACCGATGTAAAAAACAAGTTGATACTCTTTTAGAAGTGAAGTTCTCTTC	Os07g0577600	AK103966	Similar to Type II chlorophyll a/b binding protein from photosystem I precursor.
5149	61	49	Os04g0128300|mRNA|AK072006|CDS+3'UTR	TGCAATCTCATATTGGTATGCTCACAATTTGTTTGCGAGCGCATTGTGGAAAAGACCACT	Os04g0128300	AK072006	Conserved hypothetical protein.
5150	61	50	Os09g0433000|mRNA|AK069858|CDS+3'UTR	CATAATTGTTGTTTGTTAATTTCTTCCCCGTTTGATTAATTCTAATTAACTAATCGTTCG	Os09g0433000	AK069858	Glycosyl transferase, family 31 protein.
5151	61	51	Os08g0476100|mRNA|AK066585|CDS+3'UTR	TTGTAAAGGGAAATACACATGAAGAGTTGAGAGTGATATATATCATGTTGCTTTCCACTG	Os08g0476100	AK066585	Non-protein coding transcript, unclassifiable transcript.
5152	61	52	Os05g0581000|mRNA|AK062968|UTR	ACCTTTTCCACCCGAGTTTGCCATGAGGGCAAAAGTGGCAAATAGTTAAGACCATCTCTT	Os05g0581000	AK062968	Conserved hypothetical protein.
5153	61	53	Os03g0828100|mRNA|AK059132|CDS+3'UTR	GCCCACCTGTCGAACAGAGTTTTTCTTTGTAGTAATTTGATTTGCTCTGCAGGCTTGGCT	Os03g0828100	AK059132	Similar to 50S ribosomal protein L18.
5154	61	54	Os11g0707000|mRNA|AK119513|CDS+3'UTR	TTTTCTCTTTGTTCTGTGTATCAGATCGCGCCCAAGCCATAGCTGGGCATGACAAGTTTT	Os11g0707000	AK119513	Similar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments).
5155	61	55	Os01g0918300|mRNA|AK069668|CDS+3'UTR	GCTGTTATGACTCGTTTATCCATACCCTAATATGTCCATCGTTGCTGGTGCTTGGCATGT	Os01g0918300	AK069668	Ubiquitin-like protein SMT3.
5156	61	56	Os01g0946100|mRNA|AK099261|CDS+3'UTR	GGGTTGATGATCTACTCTGATGGATATATTGGAGGATATGAATTAAGGAGTCATGAAGGT	Os01g0946100	AK099261	WD40-like domain containing protein.
5157	61	57	Os06g0715600|mRNA|AK102724|CDS+3'UTR	AGTTTGATGCAAGTGACCTCTGGCTGCTATGGTTTACTGTACTTAATGATTTACTAGTAC	Os06g0715600	AK102724	Brain and reproductive organ-expressed family protein.
5158	61	58	Os01g0856800|mRNA|AK063895|CDS+3'UTR	CCAGTTCACTCCATGTAACTTTCTTTAATAAGGTACGATTTGTTTGGTCAATTGGTCTGT	Os01g0856800	AK063895	Pleckstrin homology-type domain containing protein.
5159	61	59	Os01g0916000|mRNA|AK106300|CDS+3'UTR	AGACTGTTTTTTGTGTTGTACTCTAGCTATCTGTATGCTGTGTGTATGTTCAGTGTGCTG	Os01g0916000	AK106300	Conserved hypothetical protein.
5160	61	60	Os06g0650600|mRNA|AK066545|CDS+3'UTR	CTCTCTTATCCCCGGATGCTTCAGGGGATCTACAGTTTAGTCAAGTTGTACTAGTAGCTT	Os06g0650600	AK066545	Nonaspanin (TM9SF) family protein.
5161	61	61	Os11g0116400|mRNA|AK059833|CDS+3'UTR	TGCATATGTGCGTACATATTTCACCAGAGCAGATGATTAATGAGACAAACACATTGTAAG	Os11g0116400	AK059833	Similar to Elongation factor P (EF-P).
5162	61	62	Os03g0750800|mRNA|AK066914|CDS+3'UTR	GTTCCGATACCAGACGCTATTTAATTGTTGTATTTCACTGCCTAAGAGGTTTCCTTTGTG	Os03g0750800	AK066914	Similar to Transcriptional adaptor (Fragment).
5163	61	63	Os07g0677400|mRNA|AF014469|CDS+3'UTR	ATGTCACCGAGAATGTCACGGGGAATGTTACTGAATCTGCGTCCGTTTATTAGCAGGTTT	Os07g0677400	AF014469	Peroxidase.
5164	61	64	Os03g0238600|mRNA|AK070684|CDS+3'UTR	GGTATCCATTAGATCTGATTCATACAACTTCTTGCCAGAGGACCATCGATTATGCCATGT	Os03g0238600	AK070684	Similar to Purple acid phosphatase.
5165	61	65	Os05g0358400|mRNA|AK071714|CDS+3'UTR	TTGAATGATTGATGTACCACAACAATAACAGTGACTATTTTGTCACCACCACCACCACCA	Os05g0358400	AK071714	Conserved hypothetical protein.
5166	61	66	Os03g0752700|mRNA|AK122157|CDS+3'UTR	TAACTGAGAATGTCACGCCTTATTTTCTTTGTAAACAGTCGAACGATTTATGCCTATCAA	Os03g0752700	AK122157	Heat shock protein DnaJ, N-terminal domain containing protein.
5167	61	67	Os02g0684300|mRNA|AK108514|CDS+3'UTR	CTGTCTGAACTTGGCATCCTGTACCAAATCCTTACCGGCCATTTAAATTATTCTTGGATG	Os02g0684300	AK108514	Conserved hypothetical protein.
5168	61	68	Os06g0708100|mRNA|AK066901|CDS+3'UTR	TGCATTGTGCGTGGGCATAACTCATAAGAAGTGGCAAAACATCTTTGGACGACTGTTTGC	Os06g0708100	AK066901	Carboxylesterase, type B family protein.
5169	61	69	Os07g0208000|mRNA|AK062943|CDS+3'UTR	TCCATCGTATGATGGCTCAGAATCTTGCATGATGCGTGCCTGCCTTTTTGATACTCCTAA	Os07g0208000	AK062943	Similar to 40S ribosomal protein S15A.
5170	61	70	Os01g0182600|mRNA|AK067038|CDS+3'UTR	TCAAGCATATGAAAACTGCTTGTGCTGTAACTTGTATGTCTGTAACGTAAAAATCTTTCC	Os01g0182600	AK067038	GIGANTEA protein.
5171	61	71	Os06g0167500|mRNA|AK069490|CDS+3'UTR	CAATTTGTAAAGCTTTTTTGCACCCATATCAATGTGTCAATTGACACCGAAGATCATTTG	Os06g0167500	AK069490	Leucine-rich repeat, plant specific containing protein.
5172	61	72	Os04g0535600|mRNA|AK099126|5'UTR+CDS	GATCGGCGAGACCGACAGCGAGCGGGCTGACATACTCAAGGGCTGGGCCTCCCTTCAGTC	Os04g0535600	AK099126	Similar to Beta-fructofuranosidase 1 precursor (EC 3.2.1.26) (Sucrose 1) (Invertase 1).
5173	61	73	(+)E1A_r60_a107		
5174	61	74	Os04g0459800|mRNA|AK105401|CDS+3'UTR	AAGTAAACTTGTTTTGTTTCAGTTCTGTTTGAATCAATGGCAGCGGTATAACCTTCTGCA	Os04g0459800	AK105401	Helicase, C-terminal domain containing protein.
5175	61	75	Os02g0308400|mRNA|AK061195|CDS+3'UTR	CGTGTCCTATTTTGTATGTATGCAAGAGTATTTATATATGTTGATGATGATTCACTCAGT	Os02g0308400	AK061195	Beta-Ig-H3/fasciclin domain containing protein.
5176	61	76	Os04g0584700|mRNA|AK108387|CDS+3'UTR	ATAATCTGCAACTCTGGAAATTTCATTTTCTCGTGTTATTTATCTCTACCTTTGATTATT	Os04g0584700	AK108387	Protein prenyltransferase domain containing protein.
5177	61	77	Os03g0656900|mRNA|AK066416|CDS+3'UTR	TGCAAACTTTTCCTACGAAATTCTTTGTAAGTAGCATGGGTTGTAACCTGCTTAACGATC	Os03g0656900	AK066416	NusB/RsmB/TIM44 domain containing protein.
5178	61	78	Os05g0388400|COMBINER_EST|Os05g0388400|8	CTTTGATACTACCTGAATATGTGACATTGCGTGTGCAAGTGCCAATCAATAGCAGAGGGC	Os05g0388400		ATP-NAD/AcoX kinase family protein.
5179	61	79	Os01g0611000|mRNA|AK072500|CDS+3'UTR	ATTCTGTTCTAAAAAGCCAGATCCTTTTTGAAAGTTGAGTCATACATTTGAGCTATGCTC	Os01g0611000	AK072500	Similar to Unidentified precursor.
5180	61	80	Os05g0368700|mRNA|AK064686|CDS+3'UTR	CTATCGTCAATTAACCCATGTCATCGATATTTATACATTTCAAGAGGTAAAGTTTACAGC	Os05g0368700	AK064686	Similar to Subtilisin-like protease (Fragment).
5181	61	81	Os02g0234500|mRNA|AK071487|CDS+3'UTR	TGTGTGCTGTAGATAGCGTCATTGGAATCTAGATCGACCATTTTGTAAAATCAAATACAT	Os02g0234500	AK071487	NAD-dependent epimerase/dehydratase family protein.
5182	61	82	Os03g0174900|mRNA|AK069348|CDS+3'UTR	TGTGACAAGGACAAAACTAGCACCCCGTTATGTTTCCTGGCTTCTGAATTTGGTGGTCAT	Os03g0174900	AK069348	Similar to Similarities with DEHA0F28138g Debaryomyces hansenii IPF 5920.1.
5183	61	83	Os04g0566500|mRNA|AK111587|CDS+3'UTR	CTTGTTGGACCTTTGTTGTGCTTGAAGAACCAAGTTAAATAATCCTGTCAGTATAGGGAT	Os04g0566500	AK111587	Similar to Argonaute protein.
5184	61	84	Os05g0225100|mRNA|AK109834|5'UTR+CDS	TCTACATGGCTACCGACGTCGCCATCTAGGCCGTTGGTCCCGCTACATCGCCTTATACTT	Os05g0225100	AK109834	Conserved hypothetical protein.
5185	61	85	Os08g0178300|mRNA|AK068383|CDS+3'UTR	TGCCACTCTTAAAAACATTTTGTAACATCGATGAACATCTTTACTCGGAATTAGAAGCTG	Os08g0178300	AK068383	Conserved hypothetical protein.
5186	62	1	Os05g0104600|COMBINER_EST|Os05g0104600|8	TGGTGCCCACCGGCGGCAACATGCCCAGCTTCGATGCCTACTGCTTCCAGCACAACAAGT	Os05g0104600		Leucine rich repeat, N-terminal domain containing protein.
5187	62	2	Os07g0204800|mRNA|AK105480|UTR	TCACTTGATGCACAGATATTTTGCATGTTAACAGCTGAGGGGTTTTGTTAATCATAAGGC	Os07g0204800	AK105480	Non-protein coding transcript, uncharacterized transcript.
5188	62	3	Os01g0140100|mRNA|AK068990|CDS+3'UTR	ACTCTCTTCTTCTCCGGTGCTTTGCTGTTTCGTCTTTGATGTCTCGGCAAAGACGAATTA	Os01g0140100	AK068990	Peptidase A1, pepsin family protein.
5189	62	4	Os03g0174100|mRNA|AK065337|CDS+3'UTR	AACCCCTTTTGCTGAGCCTCTTCTAAGTGAACAGATTACTGCCAATGATGCGGCTACTTT	Os03g0174100	AK065337	Similar to RNA Binding Protein 45.
5190	62	5	Os02g0715300|mRNA|AK059816|CDS+3'UTR	GATGTAAATGTCTCCGGTCAAATTCCTTATGCTTTTGCCTCCTGCAGTAAATAAAAAGCT	Os02g0715300	AK059816	Conserved hypothetical protein.
5191	62	6	Os06g0682900|mRNA|AK072958|CDS+3'UTR	TCTCTACTCCTGCCCGGAAACTTATTACTCCTTGTCACAGTTTATAGGGTGTTCTTTTAC	Os06g0682900	AK072958	(2R)-phospho-3-sulfolactate synthase, ComA family protein.
5192	62	7	Os08g0326400|mRNA|AK098843|CDS+3'UTR	TCATATCTTCTCTGTTCACCGGACCATGTTGGGATACTATGCAATTAGTACAACCGTGCT	Os08g0326400	AK098843	60S ribosomal protein L7a.
5193	62	8	Os05g0535800|COMBINER_EST|Os05g0535800|8	TTAAGATTCAGCAAATCTGACAAAACAAACTTTAACCCTCGTGCTGAATCGGGGGACGGT	Os05g0535800		Nucleic acid-binding, OB-fold domain containing protein.
5194	62	9	Os03g0774200|mRNA|AK119532|CDS+3'UTR	TGGTTCAGAATGCACCTTTTGTTAGTAAATTGCTTGCATCTAGACAATGCAGGACCGATG	Os03g0774200	AK119532	Similar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3).
5195	62	10	Os05g0202500|mRNA|AK068507|CDS+3'UTR	AGAACAAACAAAATTGGGAACAACATGACTATGGGAAACAAAGGAAGGTTATTTCTGCAC	Os05g0202500	AK068507	Conserved hypothetical protein.
5196	62	11	Os11g0132400|mRNA|AK059074|CDS+3'UTR	AGCAGCTGATGGCAATGTGTTTTTTGTACTGCTTTTCTCCATCATGATATTTGTACGGAT	Os11g0132400	AK059074	Protein of unknown function DUF872, eukaryotic family protein.
5197	62	12	Os06g0274200|mRNA|AK073155|CDS+3'UTR	GGACTAATTGATTCCCTACCTGGATCATATATAATTAGCTCCTCTATAAATCATTTTGTG	Os06g0274200	AK073155	Similar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
5198	62	13	Os05g0424700|mRNA|AK107848|CDS+3'UTR	TTGATTGATGCTGCCTCCCGGCTTTAGTTTCAATTGTCTCAGATTGGTTATTATAGTGTA	Os05g0424700	AK107848	Similar to Copper transporter 1.
5199	62	14	Os03g0359000|mRNA|AK064512|CDS+3'UTR	GGGATATACTGTACAAGTGGTGTATATATACAGCTAGGATGGTAGTGATCCCATTGATTG	Os03g0359000	AK064512	Esterase/lipase/thioesterase domain containing protein.
5200	62	15	Os09g0538000|mRNA|AK104263|CDS+3'UTR	GAATATGTGCGGCCTTGTTAATGTTTTCATGAATAACTCGTGTAGTGGGATTACTTTGTC	Os09g0538000	AK104263	Ribonuclease T2 family protein.
5201	62	16	Os06g0160700|mRNA|D16202|CDS+3'UTR	TTGTTGAGTCTTAAGGTGAAGACTAAATAGTGTTTGGAAGCTGTAGCTACTGCGATGTCA	Os06g0160700	D16202	Similar to Starch synthase I, chloroplast precursor (EC 2.4.1.21) (Soluble starch synthase 1) (SSS 1).
5202	62	17	Os03g0789600|mRNA|AK106967|CDS+3'UTR	CTACAATTTTATTGGCCTCAGAGCATAAACAGTTTGTAACCGCAACACAAGAACATAAAA	Os03g0789600	AK106967	Conserved hypothetical protein.
5203	62	18	Os05g0450300|mRNA|AK071191|CDS+3'UTR	GACAGGGATATGACAGGCAATTTGGACAGTAATGATATGTTACATGTAATAACTTTACAC	Os05g0450300	AK071191	Conserved hypothetical protein.
5204	62	19	Os02g0214600|mRNA|AK106388|CDS+3'UTR	AAGTCAGCTCTCCAGGGGGTATAATCTCTAGTTCAGTAGTATGTCCAGGTTGTGCAATCT	Os02g0214600	AK106388	Conserved hypothetical protein.
5205	62	20	Os12g0182600|mRNA|AK120295|UTR	TAAGTGTTCACCTGGAATTTCATTAATGCACATTATGATGGTGTAAGTTTTTTCAGTGCG	Os12g0182600	AK120295	Non-protein coding transcript, putative npRNA.
5206	62	21	Os12g0228500|COMBINER_EST|CI041790|0	GTTTTGGTACTGTTTTATGTAGCCGGAGCATTTGCTACTACTACAAATTGCTGGAAATTG	Os12g0228500	CI041790	Homeodomain-like containing protein.
5207	62	22	Os01g0357100|mRNA|AK061893|CDS+3'UTR	TTCTCGTTACAGTCTTACAGAGGATGATTGATTGATAAATAAAGAAGAAACAGATTCTGC	Os01g0357100	AK061893	Ferredoxin-nitrite reductase (EC 1.7.7.1).
5209	62	24	Os10g0512100|COMBINER|CI124955|6	GTTTTACGACTGGAAAGGCCAGATCTGTGCTTTGCAAAGAAGTGTATATCTGATACGCTT	Os10g0512100	CI124955	Protein of unknown function DUF726 family protein.
5210	62	25	Os07g0138400|mRNA|AK111433|CDS+3'UTR	CAGGGTCTAGGGGAAAAAGATTACTAGAACCCATGAATTTGATTTTGAGTCCTAATAAAC	Os07g0138400	AK111433	Conserved hypothetical protein.
5211	62	26	Os11g0622600|COMBINER_EST|AU094687|7	TGCGCCTGCTAGAGATGCTTTTGTGTGTACTATCCATACCATACATGTAAATTTTACTCA	Os11g0622600	AU094687	TRAF-like domain containing protein.
5212	62	27	Os07g0412100|mRNA|AK102058|CDS+3'UTR	CCATACATTGATTTCATCAAGAATTTTGGTCAACTGTGGAATTGCAAGCTCCTTGTTCTG	Os07g0412100	AK102058	Similar to Granule-bound starch synthase Ib, chloroplast precursor (EC 2.4.1.21) (Fragment).
5213	62	28	Os02g0536100|mRNA|AK107922|CDS+3'UTR	CACATGTCTATTCAGTTATAATTTACATATGTGTTTACAATGTAAGCATTATGTTGCTTT	Os02g0536100	AK107922	Conserved hypothetical protein.
5214	62	29	Os10g0457700|mRNA|AK068079|5'UTR+CDS	AAGAGATGTTGCATCTTTTCGAGTTTGGTGATGAGGAACTACTGGAGCAGAGCGGTTCTA	Os10g0457700	AK068079	Zinc finger, FYVE/PHD-type domain containing protein.
5215	62	30	Os08g0382700|mRNA|AK066272|CDS+3'UTR	ATTTACATCACTATATGCTCGGAGCAACTTACATCAATCTTGGTGCACATTGTTATCCTG	Os08g0382700	AK066272	Non-protein coding transcript, unclassifiable transcript.
5216	62	31	Os12g0132600|COMBINER_EST|Os12g0132600|8	ATCATCTTACTAAAGATAACCATGCATTCATGGAAGTTCATCCTTTCTTCTTCTTGCTCA	Os12g0132600		"Zn-finger, CCHC type domain containing protein."
5217	62	32	Os01g0539900|COMBINER_EST|CI482234|6	GGTGCTGAAGAGGAAAAGGATATTATAACAAGTATCTTGCTTTCTGTTTAATGATGCATC	Os01g0539900	CI482234	Conserved hypothetical protein.
5218	62	33	Os03g0266800|mRNA|AK060798|CDS+3'UTR	TTACTACTACATGTCAAGTTAATAAGAAACTTACCAGGAGATTACTGTACTTGTATTGAA	Os03g0266800	AK060798	Protein kinase-like domain containing protein.
5219	62	34	POsControl0025|random		
5220	62	35	Os02g0500500|COMBINER|CI396069|6	CTTCATGGTTAATTATACTCTCTGGAACTTTCTCGGATTTTTCGGAGCTCAATTCCTAAT	Os02g0500500	CI396069	(No Hit)
5221	62	36	Os11g0134300|mRNA|AK112043|CDS+3'UTR	ATTCCCATTTCTAGAGGCTGGAAAAGCAGAAAGCATGTTTATTGCATCTGTAATTAGATG	Os11g0134300	AK112043	Similar to Serine/threonine kinase.
5222	62	37	Os11g0668000|COMBINER_EST|Os11g0668000|8	TGGCACAAGATCCAGCATATTCCTAGAGTAACAATTGCTTTGGAATCTACTCATTCTCCC	Os11g0668000		Disease resistance protein family protein.
5223	62	38	Os03g0610900|mRNA|AB125311|CDS+3'UTR	CAGTAAGCTCAGTACACGAACTTGTTTCCATTTTCAAAGCACCATCTGCACTGCACGTCA	Os03g0610900	AB125311	Serine/threonine-protein kinase SAPK10 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 10).
5224	62	39	Os03g0725300|mRNA|AK063969|CDS+3'UTR	TATCTTCGGCAACCAAACGACGGGTACAAACTGGAATATCAACCAGTACTGGTTCAGACT	Os03g0725300	AK063969	Similar to Dbr1-prov protein.
5225	62	40	Os04g0503500|mRNA|AK101695|CDS+3'UTR	CCTCTGCATTTTCGATGTTATGTAATGTTTCGTGTTATCGTGTTAATGAACTGGTATTGT	Os04g0503500	AK101695	Leucine-rich repeat, cysteine-containing subtype containing protein.
5226	62	41	Os10g0507800|mRNA|AK066499|CDS+3'UTR	AAACATGCACTGAACTGATAATTTCTTTATCTACGAAGATGCAGCTGTCGCCTTTCCACT	Os10g0507800	AK066499	Heat shock protein DnaJ, N-terminal domain containing protein.
5227	62	42	Os12g0105200|COMBINER_EST|CI408226|6	TTCGAAGTTTACAAGGAAGGCTTGGCGCAACTGCGAGCTGAAGCTGATGATTCTTCTTAA	Os12g0105200	CI408226	Ribosomal protein L10 family protein.
5228	62	43	Os01g0805200|mRNA|AK066239|CDS+3'UTR	CCAGCTAATGTCTTCCATGTTTGTGCATCATTCTGAAATAAAAATAGTTGGTAATTCTGC	Os01g0805200	AK066239	Conserved hypothetical protein.
5229	62	44	Os11g0184900|mRNA|AK064292|CDS+3'UTR	TCAATCATTTCTCCTCACCAACGAATTTACCCCCATTTTATTTTTTAAAATTCTACAAGG	Os11g0184900	AK064292	Similar to NAC-domain protein 5-7.
5230	62	45	Os06g0717200|mRNA|AK111824|CDS+3'UTR	ATAACAGGCGGATTACTACTGCTTTTCTGCTATGCGTAATAGCTAAATGAATATGTGCAT	Os06g0717200	AK111824	Protein kinase-like domain containing protein.
5231	62	46	Os05g0524200|mRNA|AK071990|CDS+3'UTR	GGCTGCTCGTTGTCGGCGCTTGAGTTCTTTTTCCTACCCAGCTTTATCATATGTATGTTT	Os05g0524200	AK071990	Dual specificity protein phosphatase domain containing protein.
5232	62	47	Os02g0118400|mRNA|AK101004|CDS+3'UTR	TAATTCGTTTGGCAGTAGACATGCACTATTTGATTGGCATGATGGCATCACATTCTGGAA	Os02g0118400	AK101004	Similar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75).
5233	62	48	Os05g0100900|COMBINER_EST|CI462559|0	GCAAGCTGAAGGAACGATGTTGCAAACAAAATACTCGTGCATTTTGGCATGGCTAAGTGC	Os05g0100900	CI462559	Hypothetical protein.
5234	62	49	Os07g0567000|COMBINER_EST|CI533235|6	TACCTGAATTTTGGCTGACGCTGAGCTCTGTAACTATGTGCAGCGAGGATCCTAACAATT	Os07g0567000	CI533235	Exostosin-like family protein.
5235	62	50	Os01g0527700|mRNA|AK061861|CDS+3'UTR	ACTGTAAAAATTGATGTCCATTTACATTTGATGTCTTGAGTAACATGAATGCACATACTT	Os01g0527700	AK061861	Protoheme IX farnesyltransferase family protein.
5236	62	51	Os04g0598800|mRNA|AK111623|5'UTR+CDS	TTACAAAGGAATCCTTCCGAATAGGACTACGATTGCCATAAAGAAGTCTATTTTGTTTGA	Os04g0598800	AK111623	Similar to Wall-associated kinase-like protein.
5237	62	52	Os08g0431100|mRNA|AK072110|CDS+3'UTR	ATGAAGAAGTATGCAAGAGCAGTGGAGAACCTCTTTTCATGAGGGTTTCCAACCTGGTGA	Os08g0431100	AK072110	Bromo adjacent region domain containing protein.
5238	62	53	Os04g0119500|mRNA|AK063189|UTR	ACGACGACGAGGATAAATCGGATCTTTTCTTCCTCCTTGATTAATTCCTGAGGCGTGTGT	Os04g0119500	AK063189	Similar to Membrane related protein-like.
5239	62	54	Os05g0507600|COMBINER_EST|Os05g0507600|8	CAGCGACGTCGACGATGAGTACGACTTCGACAACTTCGCTTGCTACGACGATTACTATGG	Os05g0507600		Hypothetical protein.
5240	62	55	Os03g0608700|mRNA|AK063928|CDS+3'UTR	AATTATCTACTATTATGTGAGACTTTGAATTGGAAAATTTGTGGATTTCAATTTTGTTTG	Os03g0608700	AK063928	Similar to Transposase (Fragment).
5241	62	56	Os01g0639200|COMBINER_EST|C98974|6	GCACGTACGACGACTACTACTCCGTCGCATTCGACTAGATATCTAGCTAGGCTAGGCAAA	Os01g0639200	C98974	NAD-dependent epimerase/dehydratase family protein.
5242	62	57	Os07g0681500|mRNA|AK103662|CDS+3'UTR	GCTATCTAAAATTTCTGAATTCTGTCAGCGGAGAGATGCTAGCTAATCTTGTTTGCTGGG	Os07g0681500	AK103662	Ankyrin repeat containing protein.
5243	62	58	Os01g0753500|mRNA|AK072330|CDS+3'UTR	AGTGCTATGTATGGTTTGCTTGTCAACATTTGTTTCTGTATCGGTACAAATCACTATGTT	Os01g0753500	AK072330	Transcriptional factor B3 family protein.
5244	62	59	Os04g0485000|mRNA|AB037149|CDS+3'UTR	AGACCCGTTGTTTCTAGACTCTCTTCTGTGATGAATTCATCCATTTATTTCATATCGGTG	Os04g0485000	AB037149	Similar to 26S proteasome subunit RPN7.
5245	62	60	Os04g0247700|COMBINER_EST|Os04g0247700|8	AAGTCTCCTTTTCTGATGTAGATACTGTGGATTTAGGTGGTCATGGGCAGCCTGACCAAT	Os04g0247700		Ribosomal protein L9 N-terminal-like domain containing protein.
5246	62	61	Os05g0550300|mRNA|AK062463|CDS+3'UTR	ATCCTGCTCTGTATTGGGTATGTATGTATGTATGAATAAATAAAGCCAGAAATGCAGTTG	Os05g0550300	AK062463	Similar to Lipid transfer protein (Fragment).
5247	62	62	Os10g0478600|mRNA|AK073485|CDS+3'UTR	GATGAAACTTTGTTATGATGCCTATTCAATATTGCTTGTGATTCAGTTGATTTCTGGGAC	Os10g0478600	AK073485	Conserved hypothetical protein.
5248	62	63	Os05g0474600|mRNA|AK066733|CDS+3'UTR	ATGTACAGCCAGTGCTGTAAGATAAATAAAAGTATCATGGCTTTGCCGTTGCACTTGCTA	Os05g0474600	AK066733	Similar to Aldose reductase-related protein (EC 1.1.1.21).
5249	62	64	Os03g0828800|mRNA|AK107160|CDS+3'UTR	AACGGTCCTAGCAGATGCTGTTATGCTAGAAGTCTAATAGATCATTTCAGTGCAGGAAAA	Os03g0828800	AK107160	Curculin-like (mannose-binding) lectin domain containing protein.
5250	62	65	POsControl0029|random		
5251	62	66	Os09g0321500|mRNA|AK062743|UTR	CTTGTTCCTGTTCGATGTCTGCTCTAATTTTTGATGAACAACGATGTCTGAATCTGAATA	Os09g0321500	AK062743	Non-protein coding transcript, uncharacterized transcript.
5252	62	67	Os04g0224200|mRNA|AK066486|CDS+3'UTR	CTGTATTGGTTGAGTGTCACATGAATGTATAAAGTCTGACATAAGACTTGATGTTTCCTT	Os04g0224200	AK066486	Conserved hypothetical protein.
5253	62	68	Os05g0114000|mRNA|AK069313|CDS+3'UTR	GGTGCCACTACGATATGGAGTATTGGTGAATGATGATACTTTATGCTGATTCTATTGATA	Os05g0114000	AK069313	Similar to PRLI-interacting factor F (Fragment).
5254	62	69	Os03g0103100|mRNA|AK103618|CDS+3'UTR	CCTGATCTCTGTATCTTGTTATTTGTATACCGTCAAATAAAAGTTTCTTCCACTTGTGTT	Os03g0103100	AK103618	Similar to Physical impedance induced protein.
5255	62	70	Os03g0339300|mRNA|AK106109|CDS+3'UTR	CAACGTGATATTGAATTTATGTAAGGGCTTGTCCGGTTTATTGCCATTTTCAACACTATC	Os03g0339300	AK106109	Similar to Peroxidase (EC 1.11.1.7).
5256	62	71	Os07g0468900|mRNA|AK062868|UTR	CAAAGAGATGCAAGATTGGTCTAAATGGGTTGAGGCAAAGTCATGTTTCTAGGGACATGC	Os07g0468900	AK062868	Non-protein coding transcript, putative npRNA.
5257	62	72	Os01g0843500|COMBINER|CI528551|x	AACAGCTTAGCTTGAGATTGTTCTGTTCACTTGCAATTTGCAGGAGTAACACAGCTTATT	Os01g0843500	CI528551	(No Hit)
5258	62	73	Os02g0452700|mRNA|AK108220|CDS+3'UTR	GAGCTCGGCGGCGGCCGGGAGGAAGGCGCACTCCTCCTTGGCGTTCTTGGCGGCGGCGTT	Os02g0452700	AK108220	Conserved hypothetical protein.
5259	62	74	Os01g0919700|mRNA|AK059028|CDS+3'UTR	TTTGGAATGCGCACTTGCACACCGACTACGCAACATATAATTAATCTGCTACTGCGCCTT	Os01g0919700	AK059028	Epoxide hydrolase family protein.
5260	62	75	Os04g0180400|mRNA|AK071546|CDS+3'UTR	TGTAAGGGTGCACGTAATGTTTGTCCCCGGATAATGGACAAACAAATAATAATTGTGAAC	Os04g0180400	AK071546	Similar to Cytochrome P450 CYP99A1 (EC 1.14.-.-) (Fragment).
5261	62	76	Os03g0377700|mRNA|AK111424|CDS+3'UTR	ACAAAAGGTCAAAAATGTCAATAACAATCCAGTATATATCAACAAATTCACAGGTCTGCC	Os03g0377700	AK111424	Cellulose synthase-like A5.
5262	62	77	osa-miR169k|Os09|5'seq	TCTGTCTAGATAGCCAAGGATGACTTGCCTGTGGCCTCTTGGAGAGAGAGGTGTAGCTTA			miRNA
5263	62	78	Os03g0294300|COMBINER_EST|Os03g0294300|8	CGATGGAGATGGAGAAGGCCATGCAGGAAGCCGTTAAGCTGAAGGAGGAGAAGCTGGACA	Os03g0294300		Homeodomain-like containing protein.
5264	62	79	Os03g0247500|mRNA|AK065489|CDS+3'UTR	ATGGACCCTGTATTTTCAGAGAGGGAGAAGCAGTTCTCCACCTCAATCCTGCATTGTTTA	Os03g0247500	AK065489	Non-protein coding transcript, uncharacterized transcript.
5265	62	80	Os03g0801200|COMBINER_EST|Os03g0801200|8	CGGCGCGGTGGCGCCGTACGAGCCCTGCTGCTCGCTGCTCGACGGCCTCGTCGACCTCGA	Os03g0801200		Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
5266	62	81	Os03g0102400|mRNA|AK121721|CDS+3'UTR	GTCCACAGCGTATAAAAGGTCGGCTCCACAGCTTGTAACGTGGATTCTGAAACATCATTT	Os03g0102400	AK121721	Conserved hypothetical protein.
5267	62	82	Os11g0641500|mRNA|AK103094|CDS+3'UTR	GGCAAAGTGTAAGTAAATCCATTTGGATTTAATTTATGAAGAAGAGAACAATTATTTATG	Os11g0641500	AK103094	Cupredoxin domain containing protein.
5268	62	83	Os05g0461000|mRNA|AB042259|CDS+3'UTR	TCCCTTCATTGACACTATCTGGTTCAGTTTTGCGAGTATTTAAAAAACTGCACAAACAAG	Os05g0461000	AB042259	Clathrin adaptor complex, small chain family protein.
5269	62	84	Os02g0454300|mRNA|AK108068|CDS+3'UTR	AAATAACTAGAGCATGACATGTGGGACCTAGACCTAATTATAAATACATAAAACTTTGAG	Os02g0454300	AK108068	Conserved hypothetical protein.
5270	62	85	Os03g0301700|mRNA|AK101878|CDS+3'UTR	GCCGAACAGACTAATTTATTTATCTCATGCTATCCTAATCAATGGTAATGTCTTTCGGTG	Os03g0301700	AK101878	Similar to Calmodulin-binding protein phosphatase.
5271	63	1	Os01g0952700|mRNA|AK103457|CDS+3'UTR	AAATCTCTTAAATTTGTGGATAGGGAGTACTGTAATTGTCATAAGCAAAGTCGACAGCAT	Os01g0952700	AK103457	Metallo-dependent hydrolase, composite domain containing protein.
5272	63	2	Os12g0508200|mRNA|AK099463|CDS+3'UTR	CTTCTTTTATGTATATGTATATGACACTAATTCAGAGTAACTGGAAGGCTCAAAAGAGTG	Os12g0508200	AK099463	Hypothetical protein.
5273	63	3	Os02g0796300|mRNA|AK119386|CDS+3'UTR	CAAACCATCTGCATTGCACAAGCTTCCTCCCATGGATAATGCAAATGTGTAATGCTTATG	Os02g0796300	AK119386	Similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1).
5274	63	4	Os11g0423000|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os11g0423000	CI274096	(No Hit)
5275	63	5	Os06g0178400|COMBINER_EST|Os06g0178400|8	CGGCAAGATACAAGAGGGTGAAGATTATGGACTACCTTGCAGGGCTCTTTGAACATTTCT	Os06g0178400		Iron/ascorbate-dependent oxidoreductase.
5276	63	6	osa-miR159d|Os01|3'seq	GATGAACCTGCCATTGTGTTCCTCTATTGATTGGATTGAAGGGAGCTCCGGCTACACCTA			miRNA
5277	63	7	Os06g0603600|mRNA|AK063544|CDS+3'UTR	CTACATCCTCTTTCATGAACTCTCGGTACAGAATTAGTTAATGTTGCAGTATAACAATTC	Os06g0603600	AK063544	Similar to Ids4-like protein.
5278	63	8	Os06g0110100|mRNA|AB028887|CDS+3'UTR	AAGATTCTGTGCTGTTCGTGTTGCCATTTTACTCTGACCAGGCAAATCGTTCGTCTGTTG	Os06g0110100	AB028887	OSEYA1.
5279	63	9	Os01g0821800|mRNA|AK073951|5'UTR+CDS	ACTGATCCAAGTTCAAAGAAAGTTGTTTCAGGACAGAAGAATGTGGGCAAATCGGATGCA	Os01g0821800	AK073951	Endothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein.
5280	63	10	Os05g0269800|COMBINER_EST|Os05g0269800|8	AGCATTCGATGGACTTTCATTTGAAAACAAGATGCATTGGTTTGCTATGTTCATTAGTGA	Os05g0269800		Transposase, IS4 domain containing protein.
5281	63	11	Os08g0369300|COMBINER_EST|Os08g0369300|8	AGCAAAGGAAGCAGCAATCACTCTTTTAATCTCAACGATGACGCCTTCCTTCCTTGATGA	Os08g0369300		Similar to ARP2 (Actin-related protein 2).
5282	63	12	Os11g0128300|mRNA|AK063715|CDS+3'UTR	ATGTACAGATTATATTCAGATGAACATCTTAATTATATTCTGTAAAATAACTGTGCTTTT	Os11g0128300	AK063715	Similar to ZF-HD homeobox protein (Fragment).
5283	63	13	Os01g0758900|mRNA|AK067793|CDS+3'UTR	GAGTTGATCATCAAATGTAATTGCATGTATCATAGAATAAAATGGCACAAGAAGTCAGGC	Os01g0758900	AK067793	Protein of unknown function DUF688 family protein.
5284	63	14	Os03g0411100|mRNA|AK062135|CDS+3'UTR	CTCCAATTATGTAATCAGTCATGGTTTTATAGAACCTTGCCACATGTAATCAATCACCTG	Os03g0411100	AK062135	Similar to Nuclear Y/CCAAT-box binding factor A subunit NF-YA.
5285	63	15	Os03g0225200|mRNA|AK065907|CDS+3'UTR	ACCAAAGGTTGAGACTTTGTTGTTCTAATCAAACATCCTGTTTACAAATTGCAACTGGTG	Os03g0225200	AK065907	Cyclin-like domain containing protein.
5286	63	16	Os07g0598300|mRNA|AK122151|CDS+3'UTR	TGCCAGTTGGCTGTCATGCCATTTCTTAAGCATGGTGAAGAATGATAATTTTGCGATCAT	Os07g0598300	AK122151	DEAD/DEAH box helicase, N-terminal domain containing protein.
5287	63	17	Os11g0242200|COMBINER|CI245889|6	TAACTTGTGTAAATTCGATCGATGTAGTATATTGAAGTCTTTGAACACTGAGGCAATTCC	Os11g0242200	CI245889	Protein phosphatase 2C family protein.
5288	63	18	Os07g0592200|mRNA|AK110717|CDS+3'UTR	ACATTTTTGTCGGGCTTGGGTGTGTGCATAGACATTTATTGTTCCAAAATTCAAAGTCTT	Os07g0592200	AK110717	Peptidase A1, pepsin family protein.
5289	63	19	Os03g0711700|COMBINER_EST|AU088743|6	TTTGATCACTTCTACGATTGTGGTCTAAAAAATGGCCATGCTTTGACATGACAAGTGATT	Os03g0711700	AU088743	Transcription factor TFIIS domain containing protein.
5290	63	20	Os03g0177500|mRNA|AK061464|CDS+3'UTR	AAACTTGTTCTGAGCCTGATTATTGCCCTTCGGCTGTTGTGGAATGCGGGTATTTACATT	Os03g0177500	AK061464	EF-1 alpha.
5291	63	21	Os02g0766700|mRNA|AK072062|CDS+3'UTR	CTTCTCTTGCCATTTTGGATAAGATGTATCTGAACTTATACATATGTACTTTTCCTTGCC	Os02g0766700	AK072062	Similar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2).
5292	63	22	Os03g0803800|mRNA|AK063484|5'UTR+CDS	ATTGGCTTCCTAAATGTTGCCGTTAGAGCGATGGGATGTGGTCTGCTGGATAGTCTTTAT	Os03g0803800	AK063484	Conserved hypothetical protein.
5293	63	23	Os02g0133200|mRNA|AK100898|CDS+3'UTR	TTTCTTGCTTACTGGACTGAACTGTGTACCCCACTGTTGTGCTGCACGTGCTTTATCAAA	Os02g0133200	AK100898	Similar to Phosphatidylinositol transfer-like protein IV.
5294	63	24	Os07g0623300|mRNA|AK070292|CDS+3'UTR	CCTTTTCATACAGACTTGTCTCTTAGCATTTGATAGTATCACTTCTCTTTTGGTACTTGG	Os07g0623300	AK070292	Similar to Splicing factor SC35.
5295	63	25	Os02g0131600|COMBINER_EST|CI028540|0	TGCTCTGATGAGATGTCGTCGCCGCTTTCCTTTCCTGATGTTACTATTTTTCACGCTCAT	Os02g0131600	CI028540	Similar to Mitochondrial import receptor subunit TOM22 homolog (Translocase of outer membrane 22 kDa subunit homolog) (TOM9).
5296	63	26	Os11g0191000|COMBINER|CI434131|6	AGCCTTACTACAGCATGAGCCAGGAATACATTCAATCTCCTGGTAGGCAGGCGGTTCAGG	Os11g0191000	CI434131	(No Hit)
5297	63	27	Os06g0166900|mRNA|AK058497|CDS+3'UTR	GCTGATATCTGGATGATTGAATTGTGTTTGTATCTTATGATTGAAACTTCTGCACAACAC	Os06g0166900	AK058497	Protein kinase-like domain containing protein.
5298	63	28	Os08g0414700|mRNA|AK099398|CDS+3'UTR	ACTTGCCAGTTATTACCAGTTGCCAGTGTTTACCTGAATGACTGAATCCAATCTCCTGCT	Os08g0414700	AK099398	Similar to Trehalose-6-phosphate synthase (Fragment).
5299	63	29	Os01g0625300|mRNA|AY344495|CDS+3'UTR	AGTAATTCTTCCATTCCACTTACTGATTCAGTCACTCGATCCTACGTACACACTGCCAAG	Os01g0625300	AY344495	Similar to Heat shock transcription factor 31 (Fragment).
5300	63	30	Os12g0277900|COMBINER|CI414008|6	GTCAAATGTAACTACATTGTATACTTATAGTGTAAAATTAGATTGTAATAAATAGTGTGT	Os12g0277900	CI414008	(No Hit)
5301	63	31	Os02g0714700|mRNA|AK067734|CDS+3'UTR	TGCTTCCTCAGATTACAGATTCCGGATACCCTATTGGTTTCTTTATGCTTCCTCAGATTT	Os02g0714700	AK067734	Conserved hypothetical protein.
5302	63	32	Os05g0217900|COMBINER_EST|Os05g0217900|8	AAGTAAACGCCTTTGCCCTCCATGACGCAACGCATGCCGTAGTGTGTTTATATAGCATTT	Os05g0217900		Conserved hypothetical protein.
5303	63	33	Os06g0318500|COMBINER_EST|Os06g0318500|8	GGGAAGATCGGAGCAGTGTAGATGACGACGAACGACGATGGGCGATGCAAACCTGTTCTC	Os06g0318500		Sodium/hydrogen exchanger family protein.
5304	63	34	Os11g0306400|mRNA|AK106179|CDS+3'UTR	TTGACTTTGGGTACTATACAATGTTTGGTCAACATCTATTGCAGAAAATACTGAATTGCG	Os11g0306400	AK106179	Similar to Herbicide safener binding protein.
5305	63	35	Os11g0115400|mRNA|AF017359|CDS+3'UTR	ACTACTTGTACTACGTGCGTGTACGTTGTGGATTATACATTATATAGACAGCTTCTTTTG	Os11g0115400	AF017359	Lipid transfer protein LPT IV.
5306	63	36	Os01g0521300|COMBINER_EST|Os01g0521300|8	GCGGAGCACTGTTCGACCCCCTGTATGCTACGACAAAGGGGGCTTTGATTGGGATAGCTT	Os01g0521300		Conserved hypothetical protein.
5307	63	37	Os06g0185100|COMBINER_EST|CI273660|6	CGGACATTCCTCAAACAAATATATGAGCCTGTATATACCGTACTGTTTAATGGTCATCTC	Os06g0185100	CI273660	Glucose/ribitol dehydrogenase family protein.
5308	63	38	Os09g0507200|mRNA|AK072867|CDS+3'UTR	AGTGCAGTGCCTGTACATTTCATAATTTGCGGTAAAGTTTATTGACTATATATCCAGTGT	Os09g0507200	AK072867	MADS box protein.
5309	63	39	Os02g0556800|mRNA|AK100187|CDS+3'UTR	GATGAAGGATATGCACGTATACACTACATGGTAGATTGATGAAACCATTTTTAAGTTTCG	Os02g0556800	AK100187	Conserved hypothetical protein.
5310	63	40	Os01g0918500|mRNA|AK072446|CDS+3'UTR	ACGTAGACTGACCTGTTAGCTGCCAGCCTGCCACTTTGTTGTAGTTGGAGTGTTATTTTA	Os01g0918500	AK072446	Conserved hypothetical protein.
5311	63	41	Os07g0168300|mRNA|AK099137|CDS+3'UTR	TGGACTGCGGGGATGTTAGAATATATGGTAGTTAGAGTTATATTAGAATGGACTGATTTG	Os07g0168300	AK099137	Similar to Glutathione S-transferase GST 40 (EC 2.5.1.18).
5312	63	42	Os04g0339400|mRNA|AK103553|CDS+3'UTR	TATAGATAGCTTGGTGTATCAATCACATGTTTATTATGCAAATAAAAGTTTGTATGGATT	Os04g0339400	AK103553	Aldo/keto reductase family protein.
5313	63	43	Os04g0532700|mRNA|AK109796|CDS+3'UTR	GCAGTAGTCTGAAAGCAGATGCAATTTTTAGCGAAATAAAATTACAAGGTTTGGCACTTG	Os04g0532700	AK109796	Conserved hypothetical protein.
5314	63	44	Os10g0189800|COMBINER|AU068625|6	GAGACACCCATCAATCATAAATTTTTGGTTTGTATGCAGAACCCATTCCGCTTATCGTTC	Os10g0189800	AU068625	(No Hit)
5315	63	45	Os05g0508400|mRNA|AK073221|CDS+3'UTR	CTCAGGCAGGCAGGCATATACTTAATGCATGACGATTTATGAGTAAATTCAAATGAAATT	Os05g0508400	AK073221	Jacalin-related lectin domain containing protein.
5316	63	46	Os02g0748300|mRNA|AK100919|CDS+3'UTR	CATGGGGTGCTGATTTGTGCCACCCTCTTGCCGAACATACTGTGAACATGAAAGATTGTG	Os02g0748300	AK100919	Similar to VMP3 protein.
5317	63	47	Os06g0508700|mRNA|AK059433|CDS+3'UTR	TTTGACTGATTTTTATCGGAATTGCTGCTGTTTCTTTATGATGAAAATTTTGATCCTGCC	Os06g0508700	AK059433	Similar to Scye1-prov protein.
5318	63	48	Os01g0280000|mRNA|AK103348|CDS+3'UTR	CTGAAGTTTGGGCTTGCAGGTTGTTTTGCTCACATTGTGCCAGTAAGAGTGATTGTTAGA	Os01g0280000	AK103348	Exonuclease domain containing protein.
5319	63	49	Os04g0108300|COMBINER_EST|CI066576|3	AAATTTCATTTTTTGAGCTCATATCCTACTGTAAGACGGAAAAATTGATGCCATGACGTG	Os04g0108300	CI066576	Protein of unknown function DUF177 domain containing protein.
5320	63	50	Os10g0563600|mRNA|AK067167|CDS+3'UTR	CCGCTGATTATGTACAAACCACCTTAGAAAACTTGATATAGTATTATCCTTTTCGATGCG	Os10g0563600	AK067167	Similar to Peptide methionine sulfoxide reductase (EC 1.8.4.6) (Protein- methionine-S-oxide reductase) (Peptide Met(O) reductase).
5321	63	51	osa-miR414|Os11|5'seq	GTTGCCGCTGCCGTCATCCTCATCATCATCGTCCTTGCATGAAACCGCCAGCAAATCCTT			miRNA
5322	63	52	Os03g0587100|mRNA|AK110975|CDS+3'UTR	TAAATTGTTGCCACTTTTATCTGCTGCTGAGGAAATACCTTCAACTGACGTATTTGATCG	Os03g0587100	AK110975	Expressed protein.
5323	63	53	POsControl0012|genome		
5324	63	54	Os08g0162500|mRNA|AK121633|CDS+3'UTR	AGTCCGTATGTTGGATATGGTTGCCACCTTGTTACCTCCCAGCTGCATTCTGTTTCTTTT	Os08g0162500	AK121633	Conserved hypothetical protein.
5325	63	55	Os01g0265700|mRNA|AK111252|CDS+3'UTR	TGTGGGATGCAATCTTTATGGGATCGATATTCGATAGAGAATGTGATCTGAAATTGTTGT	Os01g0265700	AK111252	Conserved hypothetical protein.
5326	63	56	ETG10_234183		
5327	63	57	Os05g0397700|mRNA|AK067298|CDS+3'UTR	AACAGTAGAACTTCCACTCCTGTCCTGACTTCTCAAAGGCTGTTCTGTTCACTTTTCCAA	Os05g0397700	AK067298	SecY protein family protein.
5328	63	58	Os01g0942900|COMBINER_EST|CI343980|0	CCTAGTGGCATTTTGCTGTTGATAACCATAGGTCTGCAAAGTATTATGCTGCGCACGTCT	Os01g0942900	CI343980	Ankyrin repeat containing protein.
5329	63	59	Os10g0517400|mRNA|AK120676|CDS+3'UTR	GAATATATATAGACTGTGACACGCACGAAGTGCCATAATCTTACTGAGAAAGAAGGTTGC	Os10g0517400	AK120676	Aldo/keto reductase family protein.
5330	63	60	Os09g0420000|COMBINER_EST|Os09g0420000|8	TACAACTGCGCAGCTCCCATGACCAAATTAGTGCATTACTGCAAGAAATGCAACCGTTGA	Os09g0420000		Zinc finger, RING-type domain containing protein.
5331	63	61	Os01g0649100|mRNA|AK071699|CDS+3'UTR	CTTGTACGAGAGGAACTATTTGTGTCAAGTTTTGAGTTGTTACATTGGACAAACATTGGA	Os01g0649100	AK071699	Malate dehydrogenase.
5332	63	62	Os11g0531700|mRNA|AK059751|CDS+3'UTR	ATGAAATTGTAACATTGCGACATGTTCATTAAAAGTTTGAGAAATCTCCCGTGTTCCAAG	Os11g0531700	AK059751	NUDIX hydrolase domain containing protein.
5333	63	63	Os01g0253300|mRNA|AK099336|CDS+3'UTR	GTCCGGACATGTAAACCATTATGCCTTTTAAATTATATATTGCTAGGGTTTGTTCGGTTC	Os01g0253300	AK099336	Importin alpha-1a subunit.
5334	63	64	Os03g0719500|mRNA|AK106321|5'UTR+CDS	GCAGTGAGGTGCGTGAAAGTCTGATTGGAGGAAGCAGCGAAGGAGATATTGAATACTTTA	Os03g0719500	AK106321	Similar to Ser-Thr protein kinase-like protein.
5335	63	65	Os01g0589200|COMBINER_EST|CI412588|6	ATGGTGTATTGTACTCCTATACTGTTTGTTTTGTTTAGATGGAGAGTATTACGTGAAAGG	Os01g0589200	CI412588	Conserved hypothetical protein.
5336	63	66	Os06g0214800|mRNA|AK070299|CDS+3'UTR	TCAAGAGTTGGAAATCATCGAACAAATTGGAAATTTCTATTCGAATCATCAATCAGTTAT	Os06g0214800	AK070299	Esterase/lipase/thioesterase domain containing protein.
5337	63	67	Os02g0215900|mRNA|AK064556|CDS+3'UTR	TTGGATCGATTGATCACAGCCGAATTTGGAATGCAGGAATCTTGTCTTGTCCATGCAAAA	Os02g0215900	AK064556	Similar to Receptor kinase-like protein.
5338	63	68	Os07g0527800|COMBINER_EST|Os07g0527800|8	GATCAAGGAGAAGAACATGCCAAAGTACGACAGCATCTCATTGTCGTCATCTGCACCTTT	Os07g0527800		Ankyrin repeat containing protein.
5339	63	69	Os06g0115700|mRNA|AK073098|CDS+3'UTR	TGTGTGCTAAGTATTTAGTGATGAAACCATTGAAATGTGATGCTAATCTCTGAATTAGTC	Os06g0115700	AK073098	Conserved hypothetical protein.
5340	63	70	Os07g0468200|mRNA|AK103051|CDS+3'UTR	GCGCAGGTAAATATCTTGATTATCTCGCGAGCTGTGTGTGTGAATTATGAAAACCTGATT	Os07g0468200	AK103051	Hypothetical protein.
5341	63	71	Os10g0364700|COMBINER_EST|CI546627|3	TGGTTCTGTGGGTATCATACTCCCAATTTTTGTATCTATTTTGTTTACGCACTTTGTAAC	Os10g0364700	CI546627	"Mitochondrial import inner membrane translocase, subunit Tim17/22 family protein."
5342	63	72	Os01g0668900|mRNA|AK110235|CDS+3'UTR	GTCCGACCCCGAGGTCCCCTGAGAAGGAATATCGCTACAAGGGAACCCAGATCGCGTTAA	Os01g0668900	AK110235	Conserved hypothetical protein.
5343	63	73	Os08g0103500|mRNA|AK067883|CDS+3'UTR	CCGAGCTGTAGATCATTCCTTTTATTTGAGGCAATATTTTTCTGCATATCAAGTGATCTT	Os08g0103500	AK067883	Phosphatidylinositol-specific phospholipase C, X region domain containing protein.
5344	63	74	Os07g0539100|mRNA|AK062569|CDS+3'UTR	TTTTAAATAAATAAATGTACTGTTTGCTCCTGTTGAATGAAATTCCGCAGTTACTTGTTT	Os07g0539100	AK062569	Glycoside hydrolase, family 17 protein.
5345	63	75	Os03g0360700|mRNA|AY224463|CDS	GCCTACTGATGAGCGTCACTGTGTGAACAGTGTTTCGATCAAGTTCACCCCGGCCTCCTA	Os03g0360700	AY224463	Similar to Protein-methionine-S-oxide reductase, PilB family.
5346	63	76	Os08g0445900|COMBINER|CI136254|6	AGAGACCCAAGGTCAAAGAGCCATTGGACAAAGGTGCAAGATTCTTTTAAGTTCAGAGCT	Os08g0445900	CI136254	(No Hit)
5348	63	78	Os03g0714100|COMBINER|CI443539|x	ACAGAGACTTCAGAAGTCAGAGTTCCACTTCCACCAGATGTATGATGTACCATTTGTGCA	Os03g0714100	CI443539	Conserved hypothetical protein.
5349	63	79	Os12g0626400|mRNA|AK073290|CDS+3'UTR	CAACTCTTGTTAGAAACAAATACAGAGGGGGTAAGCCCCACAGTTCAAGAAGCATATTAC	Os12g0626400	AK073290	Similar to Phytoene synthase 1, chloroplast precursor (EC 2.5.1.-) (Fruit ripening specific protein pTOM5).
5350	63	80	Os06g0624200|mRNA|AK069810|UTR	CAGATATAGGCAGACAGTGAGGTTTTGGAATGGAAGCCTGCAAGCTGCAAACGTACATAT	Os06g0624200	AK069810	Non-protein coding transcript, putative npRNA.
5351	63	81	Os11g0481500|mRNA|AK069452|CDS+3'UTR	GAACTGGCACCAAATAGCCTTTATGTAGTAGTGTTATTCTCTAGCCTGAGCATTCCGCGT	Os11g0481500	AK069452	Conserved hypothetical protein.
5352	63	82	Os01g0708600|mRNA|AK111377|CDS+3'UTR	GTTTGGAACTGTAAAACATTTGCTTGGATTTACCTCGTATATAATGAATATTCAAGAATT	Os01g0708600	AK111377	Transport protein particle (TRAPP) component, Bet3 family protein.
5353	63	83	Os01g0162800|COMBINER_EST|Os01g0162800|8	TGGCTGCGTCTTCCCACGAAAAGCTAGTGAGGCACAGAGAGAGCCGCATCCCCCAGCAGA	Os01g0162800		Leucine rich repeat, N-terminal domain containing protein.
5354	63	84	Os07g0678300|mRNA|AK111746|CDS+3'UTR	CATGGACGGCGTCATGGAGGTGGTATGTAAGCACGATTTGGTGATGTCTGGGCTGGAAAA	Os07g0678300	AK111746	Similar to OsPK4.
5355	63	85	Os12g0539800|COMBINER_EST|AU166889|6	TAGTGTAAGTAGTAAAGCCCTATAATTTCTATGTATGGTGGTTAGCTATGTTTGTCGGTA	Os12g0539800	AU166889	Conserved hypothetical protein.
5356	64	1	Os02g0759100|COMBINER_EST|Os02g0759100|8	CACCACAGCTTCCAGCGCCATGAGAGCCTTCTCCTACCTACCAACCAAGCTTCCACTCAC	Os02g0759100		Hypothetical protein.
5357	64	2	Os05g0420500|mRNA|AK070104|CDS+3'UTR	TCTACCGTCCAAGAATTTACCTAGAACATTGTATATACCTGAAATAAATGGAGCTTTTGG	Os05g0420500	AK070104	Conserved hypothetical protein.
5358	64	3	Os02g0722800|mRNA|AK061221|CDS+3'UTR	GCTGTAAACTAGGCTTGTAACAGTCTTAATTTGGAGTATTTCAATATCCAGTTTAGTGTC	Os02g0722800	AK061221	WD40-like domain containing protein.
5359	64	4	Os04g0561200|mRNA|AK107862|CDS+3'UTR	TCTGTACAAATCGGAGTGTTGGCGGGAAGTGCGCGAATGATAAGATGAAATGGTCCGAGT	Os04g0561200	AK107862	Cellular retinaldehyde-binding/triple function, C-terminal domain containing protein.
5360	64	5	Os11g0702200|mRNA|AK102649|CDS+3'UTR	TTATGTTAATTTAGTTTTGAAATATAAAAGAATCCAGCATGTTTCACTGTGCTGTTTACC	Os11g0702200	AK102649	Glycoside hydrolase, family 18 protein.
5361	64	6	Os07g0448800|mRNA|AK072519|CDS+3'UTR	TGTACTCCCATTTAATTTAGCGACGATAAGCATCGATGCCCGCCTCTCCTATCTGGAATA	Os07g0448800	AK072519	Aquaporin.
5362	64	7	Os12g0111500|mRNA|AK104550|CDS+3'UTR	GTACGATGTATAAGTGTAATTAAATGATAGTACATGCATATCTCTGGAATTAATGTGATC	Os12g0111500	AK104550	BTB domain containing protein.
5363	64	8	Os05g0411300|mRNA|AK073142|CDS+3'UTR	CGTTGAGATATAAGTGCAACTAGTAATATGGGTAGTCGAGAACACGTGCAGAATATACAT	Os05g0411300	AK073142	Conserved hypothetical protein.
5364	64	9	Os03g0793000|mRNA|AY526867|CDS+3'UTR	ACAAGCTGGCCACCCGGATTTGAGCTCTCCTCTCTCTCTTCCATGGAATCCAACAGCAGT	Os03g0793000	AY526867	Zinc finger, A20-type domain containing protein.
5365	64	10	Os10g0562100|mRNA|AK121235|CDS+3'UTR	CATGTGGCGTTTCTTTCAGCAGTCTTATATAATACAGTGAGAATGTCAGTACCTTCCGAG	Os10g0562100	AK121235	Homeodomain-like containing protein.
5366	64	11	Os04g0481800|mRNA|AK109152|CDS+3'UTR	TGCTGCTAAATTTAAAATTAGAAATTCATGATGAATTAATACAAAGTTATACTCGTTCTA	Os04g0481800	AK109152	Membrane bound O-acyl transferase, MBOAT family protein.
5367	64	12	Os08g0148500|COMBINER|CI535526|x	CGCTCTCCCGTTGATATATATTTTGTTTATCATCAAGTTAATGGCCATCAAGACTCTAAA	Os08g0148500	CI535526	Peptidase, trypsin-like serine and cysteine domain containing protein.
5368	64	13	Os02g0473200|mRNA|AK071189|CDS+3'UTR	GCAACAACAGTGATCAGCTATTTAATGTTGTAACCTGGCTTTGGAATCTTGGGTGCACAA	Os02g0473200	AK071189	Peptidase A1, pepsin family protein.
5369	64	14	Os12g0244800|mRNA|AK101891|CDS+3'UTR	CACAGGCAAATCTTCCCAAAATATAAGACCATGAAACGTCAGGACAACAACAATGAAGGA	Os12g0244800	AK101891	Hypothetical protein.
5370	64	15	Os02g0658900|mRNA|AK066526|CDS+3'UTR	AGTTTTATATAGTAAACTTTAAAAATTCTGATTAAGGTCTCTATTAACTTTTTTTACCGA	Os02g0658900	AK066526	Sec20 family protein.
5371	64	16	Os04g0218000|COMBINER_EST|Os04g0218000|8	TTCCGTATACATTAAGGAAATCTGTCCCGTGATAGGAACAGAATCTACGGATGGAGAGTC	Os04g0218000		Hypothetical protein.
5372	64	17	Os12g0116000|mRNA|AK102691|CDS+3'UTR	AGTTTTGCTTGGTTCTTGCGGAAAAAGAAAAATCAGGCATTCCATACATGTTGGTGGAAA	Os12g0116000	AK102691	Similar to PV72.
5373	64	18	Os08g0154600|mRNA|AK070325|CDS+3'UTR	CTGAGGAATTTTAGCTCGCTGAGAACGAATGGACATTCATTTTATACCGAATTAATCTCA	Os08g0154600	AK070325	Similar to Topoisomerase I.
5374	64	19	Os01g0708500|mRNA|AK099170|CDS+3'UTR	TGAACGCATGGTTATAGTCCGTATAATATTTCCTGCCTTACATAAATTAAGAGGCATTTG	Os01g0708500	AK099170	Conserved hypothetical protein 730 family protein.
5375	64	20	Os03g0843700|mRNA|AK070364|CDS+3'UTR	GTTTGTTCTTGTGTAAATACCCGAGCGGTGAACATTGAAGGTAAAGAAAAGACCAAGCCT	Os03g0843700	AK070364	FAR1 domain containing protein.
5376	64	21	Os06g0225300|mRNA|AK100258|CDS+3'UTR	TCTTGTAGCATGTGTATGTATTTTAGTTTTTCCCCTTTTTTTCAAGTAATTCATAATCAC	Os06g0225300	AK100258	Similar to SERK1 (Fragment).
5377	64	22	Os01g0130000|mRNA|AK061853|CDS+3'UTR	TATTGAGAAGAGAAAACTGATCGAATTCTTCTAGTGGATTATATACGCTGTCTTTTGCTG	Os01g0130000	AK061853	Cation efflux protein family protein.
5378	64	23	Os08g0459300|mRNA|AK060409|CDS+3'UTR	TTTTCTGCACTTATAGATGATGAATTACCTGTGCAGGCTGTTCATCTGTTGTATTTATAG	Os08g0459300	AK060409	Conserved hypothetical protein.
5379	64	24	Os01g0590800|COMBINER_EST|Os01g0590800|8	ATTCTTGAAGTTCACTTTCTCACAGATAGTGCCATCATCGCGCGGACACTTGCAAGAGAA	Os01g0590800		Conserved hypothetical protein.
5380	64	25	Os12g0509900|mRNA|AK101963|CDS+3'UTR	CAGCGGCGGCGTGAGCCGGAGGTGGCGCACCCGGCAACGGCCACGCGAGGCAGAAGGGAA	Os12g0509900	AK101963	Conserved hypothetical protein.
5381	64	26	Os07g0606900|COMBINER_EST|CI069388|0	ATTTAGGGTGTTGAGTTGTGCATGTGAACAGTTGAGTTGTGATGTTCTTGGTGTCTAGTT	Os07g0606900	CI069388	Heavy metal transport/detoxification protein domain containing protein.
5382	64	27	Os04g0457700|COMBINER|CI480436|4	GGCTAGTTATAGTTTTGCACTTTTGGCTGTCCTTGGTAGAGTACGTAATTAACCTGGGCG	Os04g0457700	CI480436	Conserved hypothetical protein.
5383	64	28	Os01g0590700|mRNA|AK059215|CDS+3'UTR	GGTCACTCTTGTTCTTTGCACATTGTTCACAGCATATGCTCAGTGCTGTAGTGAGTTCAT	Os01g0590700	AK059215	Conserved hypothetical protein.
5384	64	29	Os01g0550800|mRNA|AK064194|CDS+3'UTR	ACCAAGCTAGCATTACAAGCTGGCAATAAATGTATTGTCACAGTTTACTGGAAGTTATGT	Os01g0550800	AK064194	Protein of unknown function DUF239, plant domain containing protein.
5385	64	30	Os01g0101600|mRNA|AK122118|CDS+3'UTR	TAGTACTGTGAGGTCAAACCAACCATATATTTGTCGTTGCAGGCTTGTGGTTCCATGAAG	Os01g0101600	AK122118	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
5386	64	31	Os03g0222500|COMBINER_EST|Os03g0222500|8	TGGCCTGGCAAGCGTTCGCCGTCTCAAAAACCTCACTCTAGCGATGCATGGGCATAACTG	Os03g0222500		Conserved hypothetical protein.
5387	64	32	Os02g0532300|mRNA|AK119210|CDS+3'UTR	TATCCTATCCTATATAGAGAAATGACAATAATATTTTGCGGAGTCATTTTGCCTCGTTTC	Os02g0532300	AK119210	Esterase/lipase/thioesterase domain containing protein.
5388	64	33	Os03g0122000|mRNA|AK060784|CDS+3'UTR	TGCCATAGAACTGAAATGACCTCTTGGCTCTGTATATAAGTAGCATGTAAAAAGAGCAAA	Os03g0122000	AK060784	Protein kinase-like domain containing protein.
5389	64	34	Os10g0156300|mRNA|AK121576|UTR	AACTGTGATTTGGTGAATTAGAGCTATGAACTATGATTTGTGATACTGCTAATTGGTGAA	Os10g0156300	AK121576	Non-protein coding transcript, unclassifiable transcript.
5390	64	35	Os03g0266100|mRNA|AK058507|CDS+3'UTR	TCGATCACATTGGTGAACCATGAATATCATGTCCCTTTCAAAGAAATCGTTGTGCAAGTA	Os03g0266100	AK058507	LIM, zinc-binding domain containing protein.
5391	64	36	Os10g0455300|COMBINER_EST|Os10g0455300|8	ATTGGATTAGCTAGTGCTGTAAGGGTAGAAAGATACTCAAATGCCCAAGGTTCGGGCACA	Os10g0455300		Conserved hypothetical protein.
5392	64	37	Os03g0738600|mRNA|AK073529|CDS+3'UTR	TCGTTGTGTAATTTCCCTTTCAGTTCCTAATAAAGAATAAGGAAGCATATGGTTGTGTAG	Os03g0738600	AK073529	Similar to Lipoxygenase L-2 (EC 1.13.11.12).
5393	64	38	Os02g0136000|COMBINER_EST|CI549716|3	GGAACATGCCTTAGAGAGTGTCAATATACCATGAACATTGTTTCATCTTGAATAATAACC	Os02g0136000	CI549716	Plant regulator RWP-RK domain containing protein.
5394	64	39	Os10g0503700|mRNA|AK059398|CDS+3'UTR	CGTTTCGTAATATGTATCCTTGCTATTTGTGATGTTTTACACCTACTTCTGTTTGACCCA	Os10g0503700	AK059398	Similar to RNA helicase (Fragment).
5395	64	40	Os08g0565800|mRNA|AK062820|CDS+3'UTR	ATGTAACCGCTTCCCTTGATCAGCTAGGGAATTTTGACTAATGTGTATCCACCGGTGAAC	Os08g0565800	AK062820	Similar to Glutaredoxin.
5396	64	41	Os12g0109900|mRNA|AB036988|CDS+3'UTR	CATTTGTATGCCTGATGATATGAATGAAATGTATTGCCTGCTGCTTTAGTGAGTATTACT	Os12g0109900	AB036988	Double-stranded RNA binding domain containing protein.
5397	64	42	Os03g0219400|mRNA|AK121985|CDS+3'UTR	GAATTGTTCAAGAAAGTCGCGGACTTATGCCGTGCAGAAAAGAAAGTTTTCTTTGTGAGT	Os03g0219400	AK121985	Glycoside hydrolase, family 20 protein.
5398	64	43	Os09g0380400|mRNA|AK073073|CDS+3'UTR	TGTTCTACATCTCCTACTCCTGAATTTCCAGCTGCAAGTTTTTACATGTTATAAGTCTGC	Os09g0380400	AK073073	Conserved hypothetical protein.
5399	64	44	Os09g0254600|COMBINER_EST|Os09g0254600|8	CTATCAGCAAGGACAACGACCTCAACGGCAGCACTGCCAGCCATGTCACCATCGATATCA	Os09g0254600		MtN3 and saliva related transmembrane protein family protein.
5400	64	45	Os07g0162900|mRNA|AK106266|CDS+3'UTR	GTCCCTCTGAAAGTTAGCGAAACTTTCTTTAATCGAATCAGTATAAGATGGTGCTATTTC	Os07g0162900	AK106266	Esterase/lipase/thioesterase domain containing protein.
5401	64	46	Os07g0295800|COMBINER_EST|CI468959|3	ACGGTCGTCCGACATCAAATTGTAAATTTCTTCCAGATATATGCATTACCAAAACAGTAA	Os07g0295800	CI468959	Acid phosphatase/vanadium-dependent haloperoxidase family protein.
5402	64	47	Os02g0588500|mRNA|AK062989|CDS+3'UTR	GAGAAGAAAAATGCTCAAATATATGCGCGTTGTTTCTTGAAACACCATAAAAGAGATACA	Os02g0588500	AK062989	Glycerophosphoryl diester phosphodiesterase family protein.
5403	64	48	Os03g0823700|mRNA|AK067508|CDS+3'UTR	TTTGGTAGAGACTGTTGCTGGGCAAGACTTTCTACAGTTTCATATCTATATCATGTTTTC	Os03g0823700	AK067508	Similar to Ras-related protein Rab11C.
5404	64	49	Os04g0289800|COMBINER_EST|CI460801|0	GGTGCAACTTTCACTTCCTCAGGTTCAGACATTAAGCTGCTGCATTATTGAAACTTGAAA	Os04g0289800	CI460801	Conserved hypothetical protein.
5405	64	50	Os07g0110400|mRNA|AK058681|CDS+3'UTR	GCAATACTCCAACAAACAGGTTGTGCTCCTTTCTAATTCAATGGAAAAGAAATGCTTTCT	Os07g0110400	AK058681	Armadillo-like helical domain containing protein.
5406	64	51	Os02g0200800|mRNA|AB118005|CDS+3'UTR	TATTTACTCCTTTGCTGTAAGTGCCCTGCTTCACTGTTATGTATAATCAATCAGTGAGAA	Os02g0200800	AB118005	Targeting for Xklp2 family protein.
5407	64	52	Os06g0175400|COMBINER_EST|Os06g0175400|8	GCGTGAAACGCTGTGTTCTTCGCTGTCTGGATTCAGTGGTGGAGCTAGAAAAATTTTTGA	Os06g0175400		BSD domain containing protein.
5408	64	53	Os06g0116100|mRNA|AK069526|CDS+3'UTR	CAAATATTGTTATAGGACTATTACCACTACGTGGTGCGGCTATGCTTGTCCAGTTGTTTA	Os06g0116100	AK069526	Similar to GAMYB-binding protein.
5409	64	54	Os06g0654000|mRNA|AK067618|CDS+3'UTR	AGCAAAAGATGGTTTTACGAACATGCCCTTGTGTATGTTCATCAGGCTTAATTTGCAGTG	Os06g0654000	AK067618	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
5410	64	55	Os03g0151800|mRNA|AK099889|CDS+3'UTR	GTAACATACGGGGAAACAGTGTACTATTTTTAAGTTAATATTTTGAGAGGTACTGAACCG	Os03g0151800	AK099889	Similar to Cell division control protein 48 homolog A (AtCDC48a).
5411	64	56	Os06g0110000|mRNA|AK069429|CDS+3'UTR	GAAACACGCAAGCATTCCCCTTCTTTTCTATCTATCCACCTCACTGAATTTGGATTGTTC	Os06g0110000	AK069429	Similar to DWARF3 (Fragment).
5412	64	57	Os07g0653900|COMBINER_EST|CI396090|0	TGTAATGCTATCCATGTAGGAGATCTGCTAAATTAAGAGTTGGTATCTAAATTAAGAGCG	Os07g0653900	CI396090	Conserved hypothetical protein.
5413	64	58	Os12g0159300|COMBINER|CI385760|6	AAGGCTGTCTGGATGTTGGTTGACACTGGGGACAAGATCTTGTGATGACAGTTCTGTTTT	Os12g0159300	CI385760	(No Hit)
5414	64	59	Os08g0473900|mRNA|AK073487|CDS+3'UTR	TATATAATGTCAGGTTCAGGATGCAGTAAAAAATCATACTGCACCGATCAGTGAGTTTTT	Os08g0473900	AK073487	Alpha-amylase isozyme 3D precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase).
5415	64	60	Os01g0574400|mRNA|AK103979|CDS+3'UTR	TTCAGGCAATTATATTGGACTAGTCTAGGGTCGCACGTATAATTCGAGTTAAATTATCGG	Os01g0574400	AK103979	Similar to Cell division protein ftsH (EC 3.4.24.-).
5416	64	61	Os10g0556100|mRNA|AK060096|CDS+3'UTR	CTTTTATAATTTATCATTTTCAAATGGTGATGATATGATGATTAATCAAAAGGATTATAT	Os10g0556100	AK060096	beta-expansin EXPB4 [Oryza sativa (japonica cultivar-group)].
5417	64	62	Os01g0970900|mRNA|AK101688|CDS+3'UTR	CTGTTGGTTCGCTACCTCTGTCTGTCTGATTGCTGTGTCTTGGGTAATGCTGAAACAATT	Os01g0970900	AK101688	Protein prenyltransferase domain containing protein.
5418	64	63	Os02g0531200|mRNA|AK064103|CDS+3'UTR	CGTAGGAAACAACAATGAAACTATTTTTGTGTAGAAAGTTCATTGAGTTGCTTCCATGGA	Os02g0531200	AK064103	Bile acid:sodium symporter family protein.
5419	64	64	osa-miR398b|Os07|5'seq	GGAGTTCCTACAGGGGCGAGCTGGGAACACACGGTGATGAGGCGGTCTGGTCTTTCGTGT			miRNA
5420	64	65	Os01g0772200|mRNA|AK060471|CDS+3'UTR	TAGGCAAACTAACATGATGATTTTCATGATCATTAAACACCTTGACCTACTCTTCCCTGC	Os01g0772200	AK060471	Transcription initiation factor IIF, beta subunit family protein.
5421	64	66	Os05g0420200|mRNA|AK067880|CDS+3'UTR	ATGCAACTATTGAATATGCATTTATCATGCTCAAATAAGCTCTGCACGATGATTGCGAAT	Os05g0420200	AK067880	Protein of unknown function DUF179 family protein.
5422	64	67	Os11g0457300|mRNA|AK121144|CDS+3'UTR	GACTGTGAAGAGAAGGAATCAACGGCTGTGATTGCTTGATACTGCATCGCGGTTCTCGCT	Os11g0457300	AK121144	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
5423	64	68	POsControl0034|random		
5424	64	69	Os04g0676200|mRNA|AK106412|CDS+3'UTR	TCCTTCGTAAACGAAATTGGTTTTCAGTAGGGCAAATATTATCATTTGAACTTGCTTAGC	Os04g0676200	AK106412	Tetratricopeptide-like helical domain containing protein.
5425	64	70	Os09g0530600|mRNA|AK062804|CDS+3'UTR	TTGTAGTTATAAATCATGTGCATCCTACCCTTCTGTTTCTTGCTTCGGAACAAGCAGTAA	Os09g0530600	AK062804	Conserved hypothetical protein.
5426	64	71	Os05g0486600|COMBINER|CI439702|6	CATTCGATGTTTACTGACACATCTGGTTAGCCTGATATTCACCTACTAAGAGCAGGTACA	Os05g0486600	CI439702	(No Hit)
5427	64	72	Os03g0411900|COMBINER_EST|Os03g0411900|8	ATTACCAGCAGATCATGCTACTTGGGAGGACTATCATGTTGTGAAGACTCGCTTTCCAGA	Os03g0411900		Conserved hypothetical protein.
5428	64	73	Os03g0399400|COMBINER_EST|CI469249|4	TTGAGTGATCCAATTATGTGATTTCAGATTTGTTTCATGGATATCAAATTGAGTCCTTTT	Os03g0399400	CI469249	Cyclin-like F-box domain containing protein.
5429	64	74	Os02g0822400|mRNA|AK102173|CDS+3'UTR	TGTAAGCGTTCCCCGATCGATGTAAGCTGATCTGAAACCTGAATACGCGCTCTTCATTTT	Os02g0822400	AK102173	No apical meristem (NAM) protein domain containing protein.
5430	64	75	Os03g0346500|mRNA|AK063139|CDS+3'UTR	AATCGATTTGCTTCCTGTGAAGGATTTGTTTATGTTAATTTTTTTATGTGAGTCTGCTGA	Os03g0346500	AK063139	Hypothetical protein.
5431	64	76	Os02g0668400|COMBINER_EST|AU085895|6	TTACTTATTTGGAGGCAGTGTCATGGCAAGTTATGACGCCTGAGAAATGCTTCTGCAATG	Os02g0668400	AU085895	tRNA pseudouridine synthase family protein.
5432	64	77	Os02g0562700|mRNA|AY224558|CDS	GTCAACATGATCATGGGAAGTATGATGAATGCTTTGTCTGAGGGACTCTCTCTGGCTGAT	Os02g0562700	AY224558	Similar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61).
5433	64	78	Os01g0757200|mRNA|AK099350|CDS+3'UTR	CGGTATACGTAACGTACTTTTACCTATGTGTGTATAGTACGTGGCTTGTGTTAACAAGTA	Os01g0757200	AK099350	Similar to GA 2-oxidase 4.
5434	64	79	Os11g0169100|mRNA|AK072561|CDS+3'UTR	CATTGTAACTGAAAGAACATCATTACTCAGTTCAGTGAACTGAAGTGTACATGCACTATG	Os11g0169100	AK072561	Sec1-like protein family protein.
5435	64	80	Os05g0526400|mRNA|AK061354|CDS+3'UTR	TGTTTAACTCAACTTCCGCCCCTGGAAGCTGTTGGTACTAAGTGCTATCAATATGTGACT	Os05g0526400	AK061354	Reticulon family protein.
5436	64	81	Os02g0103600|mRNA|AK070945|CDS+3'UTR	GCACTTCTCTTCTAGATTTTGTACAACCTAAACCGAAATGGTAAATAATCGTGATTTGCC	Os02g0103600	AK070945	Protein of unknown function DUF6, transmembrane domain containing protein.
5437	64	82	Os08g0110300|mRNA|AK067360|CDS+3'UTR	ATAGATATGCTTCTCCTCTTGTACATGGCAATTCGAATGTACATACGCTTCACCCCTTGT	Os08g0110300	AK067360	Longin domain containing protein.
5438	64	83	Os05g0516800|mRNA|AK061969|CDS+3'UTR	CAATGCAAGTATTATGTTGACAGAAGAAGCATATATCCATTGTTTGAGAGTGTCTGCTCT	Os05g0516800	AK061969	Similar to Ras-related protein RIC2.
5439	64	84	Os11g0652600|COMBINER|CI431565|x	AACTGTGGTGTTGCTTTTCACGCGAAGCAGCTATGCGCTGGTGGGGAGTTGGTCACCCAT	Os11g0652600	CI431565	Conserved hypothetical protein.
5440	64	85	Os01g0302500|mRNA|AB007626|CDS+3'UTR	TGCCTCATTGTTTTGGCAGATCATGTGTATATGGCATCGTACCAAATCAAAATGTATAAT	Os01g0302500	AB007626	Knotted1-type homeobox protein OSH6.
5441	65	1	Os02g0616600|mRNA|AK105414|CDS+3'UTR	TACTTTGTATAATTTTTTCCCTCTCTATTAATATATGAGGCAAAGCTTTTGTCCTCCTTT	Os02g0616600	AK105414	Conserved hypothetical protein.
5442	65	2	Os11g0251400|mRNA|AK104835|CDS+3'UTR	CATACATTGTTAAATCTTTAACTTCATGTATATAATCTAAATAATGTACTCTGAACATTA	Os11g0251400	AK104835	Ankyrin repeat containing protein.
5443	65	3	Os06g0724600|mRNA|AK103177|CDS+3'UTR	GAAACCAAACAGCCCCTAGTCTGTAATCTGGAATGATTTTAAGTACGACTGGTATGTCTT	Os06g0724600	AK103177	Similar to Transformer-SR ribonucleoprotein (Fragment).
5444	65	4	Os12g0553200|mRNA|AK070342|CDS+3'UTR	AGTTAGCATTTGTTTCGGAACAACTATAGGAAAAGCTCACTATCCACAGAGGTGCATGTG	Os12g0553200	AK070342	Disease resistance protein family protein.
5445	65	5	Os03g0132200|mRNA|AK099870|CDS+3'UTR	TTTCCAACTTTGTACATGAGCTACTAACTAATGTGTAAAGATAAAATTAAAGCAAGTTAC	Os03g0132200	AK099870	Expansin-like protein A.
5446	65	6	Os04g0505200|mRNA|AK104903|CDS+3'UTR	GATGAACCACAGAAGCTTGTAATAATTCAGATCACCATGAAAGATCAGCTTTAAATTTCC	Os04g0505200	AK104903	Leucine-rich repeat, plant specific containing protein.
5447	65	7	Os10g0119100|mRNA|AK108086|UTR	TGAGACCATTGAACAAATGGTTTAGAGATAATAACTTAGCTGCTTTCTTTGAATTGCCAC	Os10g0119100	AK108086	Non-protein coding transcript, unclassifiable transcript.
5448	65	8	Os09g0343200|mRNA|AK064806|CDS+3'UTR	ATCATGGTACGTACTGTCAATGAATACTTGAGGCCTGTTCGTCACTTTTATGTGACACTT	Os09g0343200	AK064806	Ankyrin repeat containing protein.
5449	65	9	Os12g0428600|mRNA|AK071849|CDS+3'UTR	TTCAATGCACATTGACTAAAAGTGTCTGGAGCCACGGGCTGCGGCTATAAATTTTACTCC	Os12g0428600	AK071849	Similar to E3 ubiquitin protein ligase UPL2 (EC 6.3.2.-) (Ubiquitin-protein ligase 2).
5450	65	10	Os02g0506500|mRNA|AK063549|CDS+3'UTR	TTCTGTTGTACTGCATCTTGACATGCTTGATGAATAAAAATGTGGCTTTTGTAGAATTGC	Os02g0506500	AK063549	Molybdenum cofactor biosynthesis domain containing protein.
5451	65	11	Os02g0274900|mRNA|AK060819|CDS+3'UTR	AATAACAGCACTGGCTCTGCCAGCTACATGAAAATAAAGTGCGTTCTGCCTGAGCTAATT	Os02g0274900	AK060819	Major facilitator superfamily protein.
5452	65	12	Os07g0110500|COMBINER_EST|CI076185|0	TATATATTTCATGTAACTGCAAAGTATGCTGTGCAAATGCTTACCGGTGTTTCCTTTTCG	Os07g0110500	CI076185	Conserved hypothetical protein.
5453	65	13	Os03g0101900|mRNA|AK072180|CDS+3'UTR	CTACAAAAAGACTTGTATCTTCTGTAGGGAAGTAAAGGAAACTATTGCCATTTTGACTTG	Os03g0101900	AK072180	Similar to Phosphatidylserine decarboxylase.
5454	65	14	Os01g0119800|mRNA|AK105502|UTR	TAGAGACTAGTATAATCCCGAGCACATGGATCTTTATCAAATGCCACTACAGGGACATTT	Os01g0119800	AK105502	Non-protein coding transcript, putative npRNA.
5455	65	15	Os10g0337500|mRNA|AK073496|CDS+3'UTR	ATGGCATTCTTTCAACAGTTTGTTTTGCTAGAGCCCCTTTTTCATATGCAAAATTTAGAC	Os10g0337500	AK073496	Zinc finger, DHHC-type domain containing protein.
5456	65	16	Os05g0137400|mRNA|AK065206|CDS+3'UTR	TGAATGATGCAGTCTGAGAAATAATCCTCTGATCATATTGTGGATTCTGAAATATATCCG	Os05g0137400	AK065206	Similar to Aspartic protease precursor.
5457	65	17	Os10g0142100|mRNA|AK071673|CDS+3'UTR	AAATGCTTGGATGCGATATACATACCGGTCACATGATCATTCAGTCATTCGGTTCAAAGT	Os10g0142100	AK071673	Zinc finger, RING-type domain containing protein.
5458	65	18	Os02g0781600|COMBINER_EST|Os02g0781600|8	TTGCCAGCATTGATGTTGCTGGAGCTTTCATTGTACCTTTATGTTTGTGCAGCGACATCT	Os02g0781600		Hypothetical protein.
5459	65	19	Os02g0590700|mRNA|AK100917|CDS+3'UTR	TAGTGCTCCGTAATGGGTGCTGATGACAGTGATAATTAAAAAACTAGTCGTACGGCATCA	Os02g0590700	AK100917	Conserved hypothetical protein.
5460	65	20	Os04g0401700|mRNA|AK100669|CDS+3'UTR	GCCTCTGTACAGTGTGGTTTGTGTAAACGGCGTGTGCCAACTTGAGTAGAAGGTTTCTCA	Os04g0401700	AK100669	Potassium transporter 1 (OsHAK1). Splice isoform 2.
5461	65	21	Os03g0637600|mRNA|AK061561|CDS+3'UTR	AATTAATATTCTATCATCCATCCATGCATCCAAATTTCAGAATTAAATGGTTGTTGTTAA	Os03g0637600	AK061561	Leucine-rich repeat, plant specific containing protein.
5462	65	22	Os10g0548300|mRNA|AK073764|CDS+3'UTR	TACCTGAGTTTTTGAAAATTAAGGGTTGGGTCTTCTTTGAACTAATTCATGTGGAAATCC	Os10g0548300	AK073764	Protein kinase domain containing protein.
5463	65	23	Os11g0536800|mRNA|AK059236|CDS+3'UTR	GATTGACCACTGTGTTAATTTCCTTGAGAAACATGAGATGTAATATATATGAACTTACAG	Os11g0536800	AK059236	Amidase family protein.
5464	65	24	Os10g0503200|mRNA|AK121595|CDS+3'UTR	GAAGAGTGCCACCCAATTGTGGAATGTACAAACATTGAATAATTATATGATGTCACTGAT	Os10g0503200	AK121595	Similar to Dihydrofolate synthetase /folylpolyglutamate synthetase.
5465	65	25	Os03g0624000|COMBINER_EST|Os03g0624000|8	GTGCTTGGTAACACCTCTTCAATTGCAATCGCCAATATTAGGGCCTTCAATCTCAAGGAT	Os03g0624000		Similar to CDPK substrate protein 1.
5466	65	26	Os12g0283300|COMBINER|CI406903|1	TCTCAATTGGTCCATGGATTAGTGAAATCGCATTTGTTTTCCATGGCAAGAATTGTGGAT	Os12g0283300	CI406903	Hypothetical protein.
5467	65	27	Os11g0146200|mRNA|AK073231|CDS+3'UTR	AAACAGCTGACAGATTAATTCTTCAGAAATGAATGAGGCGGCTGAAGTTGGATTTCAACC	Os11g0146200	AK073231	Ankyrin repeat containing protein.
5468	65	28	Os06g0710800|mRNA|AK063542|CDS+3'UTR	GAGAAAACAATGAGGCATCAAGCCCTCAATTTATCTTAAGCATAGAAATAAGGTTCTCAT	Os06g0710800	AK063542	Protein prenyltransferase domain containing protein.
5469	65	29	Os02g0133800|mRNA|AK109376|CDS+3'UTR	TGATCAACATCGATTGTGTTTTGGACCGATTATTTACATGTGATGCGGACAGAAAATCTC	Os02g0133800	AK109376	Proteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2).
5470	65	30	Os10g0503300|COMBINER_EST|CI215191|6	ATGTACTTGAATAACTCCGATGAATTGCAATGTATAATACTCCTTCCATTTTATATTATA	Os10g0503300	CI215191	Similar to Benzoyl coenzyme A: benzyl alcohol benzoyl transferase (Benzoyl- CoA:benzyl alcohol/phenylethanol benzoyltransferase).
5471	65	31	Os04g0629500|mRNA|AK072821|CDS+3'UTR	CTGAATGGTGTCCCTTTGAACTGATAGGCTTGTGCCTTGCGGTAGTTTGTTCTGCAGGCT	Os04g0629500	AK072821	Similar to Thioredoxin h.
5472	65	32	Os01g0318400|mRNA|AB110194|CDS+3'UTR	ATGAACAAGGGTAGCAGCAGTAGATTTGCCTTAGCTAGGGAGGAGTGAGATTTGTGAGAT	Os01g0318400	AB110194	Conserved hypothetical protein.
5473	65	33	Os09g0402300|mRNA|AK063300|CDS+3'UTR	GGGCAGGTCAATAAAGGTGTAACATCTCGATTACTTGTGAAATTTGTAACAGCTCAGTTA	Os09g0402300	AK063300	Phosphatidylinositol-4-phosphate 5-kinase family protein.
5474	65	34	Os04g0443300|COMBINER_EST|Os04g0443300|8	GCGACTACGACCGGTCGGAGCCGACGACGTACACCAACGCCGCCCTCGTCGGCTGCCTCG	Os04g0443300		Similar to Endo-1,4-beta-glucanase precursor.
5475	65	35	Os09g0455000|mRNA|AK110047|CDS+3'UTR	TAGTAAAGTAGCATATAAACAAGTAGCTCATCTACAGGTCAGTCGGCCAGTTCCCGCATG	Os09g0455000	AK110047	Conserved hypothetical protein.
5476	65	36	Os07g0186000|mRNA|AK059196|CDS+3'UTR	TATCGTCAGTTTGGCTTGGGTGTCCTCGAATATCATGCGAAATCGATTCCGAGTTCTCTT	Os07g0186000	AK059196	Similar to Thioredoxin h isoform 1.
5477	65	37	Os08g0557000|mRNA|AK100496|CDS+3'UTR	CTTGGTGCTTGTCAACAATGTTGGATGTTGGTTCGTCATGAAGCATGGAAGTATGTGCTT	Os08g0557000	AK100496	Similar to Protein-L-isoaspartate O-methyltransferase.
5478	65	38	Os04g0470200|COMBINER_EST|AU172394|7	TGAACATGGGCGGATGCCTTTTCTCAGACCTTCGAGATTTTAAGTGGTATGTTGTTAGTT	Os04g0470200	AU172394	Similar to Small nuclear riboprotein Sm-D1.
5479	65	39	Os01g0252200|mRNA|AK071420|CDS+3'UTR	TAAAGTTTACTCCTTCTCTATTCAATGAAATTGGCAGCTTGCCGATTCGTTCAAAAAAAA	Os01g0252200	AK071420	Conserved hypothetical protein.
5480	65	40	osa-miR171d|Os10|Mature	TGATTGAGCCGTGCCAATATCTGATTGAGCCGTGCCAATATCTGATTGAGCCGTGCCAAT			miRNA
5481	65	41	Os10g0462600|mRNA|AK066108|CDS+3'UTR	TTGATCAAGCCGATGTGCCTATTTGTGTTTTCTATTTTCCTTTGAAATGGACATATGCTG	Os10g0462600	AK066108	Similar to Plus agglutinin.
5482	65	42	Os04g0401700|mRNA|AY324878|CDS+3'UTR	AGCCTAGTATAAACCATGGGTTTTGTTGATGATGCTGATGTTGGAAGAGAGGGCAAAGTG	Os04g0401700	AY324878	Potassium transporter 1 (OsHAK1). Splice isoform 2.
5483	65	43	Os02g0163600|mRNA|AK068043|CDS+3'UTR	TTGACCGACATTACTACTGCAGTATTGCAGCTTATTACCAGATCATGCTCACGGGTTAAA	Os02g0163600	AK068043	Conserved hypothetical protein.
5484	65	44	Os12g0290800|mRNA|AK062678|CDS+3'UTR	TGCCATGGAGATGCGTAAGAAGTAGTGTTTTTGTTGGGAAGTGGGAGCAAGGTAAAGTAG	Os12g0290800	AK062678	Hypothetical protein.
5485	65	45	Os07g0418600|mRNA|AK105956|CDS+3'UTR	TATCTATGTGTTTGTCGTGTGTTGTTCACTGGTGTATGTGTCCATGTGGCTATCTATGTG	Os07g0418600	AK105956	Conserved hypothetical protein.
5486	65	46	Os05g0318300|mRNA|AK105787|CDS+3'UTR	ATCTTTGACACCTTGTGTATGAAGGAGCTGCGAAACTGCAAGATATGCTGAATGATTTGA	Os05g0318300	AK105787	Ribonuclease III domain containing protein.
5487	65	47	Os04g0405700|COMBINER_EST|Os04g0405700|8	TATGTGCTATTCATGGCTACCCTGAATTAGGTAATCTGTTACTAATTGTCGACCCCGCCG	Os04g0405700		Aminotransferase, class IV family protein.
5488	65	48	Os02g0315600|mRNA|AK106848|CDS+3'UTR	AATCCCACACGGGAAAAGGGGGGTTTAGCAATGTCAACTTGATGCATGCTTGGTAAAAGT	Os02g0315600	AK106848	Helix-loop-helix DNA-binding domain containing protein.
5489	65	49	Os03g0330800|COMBINER|CI168028|6	TGTTGCTTGCATGTTCAAATTGTTTCTCTGTTGCTCGAATCCGACGTCAAGATCAACCTC	Os03g0330800	CI168028	(No Hit)
5490	65	50	Os06g0579800|COMBINER|CI535167|x	TCGTGCGCGGCACGGTCGCTGCCCAGATGTGCAGCACTAGGCCTTCAGCCAGGTAAGGCC	Os06g0579800	CI535167	Non-protein coding transcript, unclassifiable transcript.
5491	65	51	Os05g0375600|COMBINER_EST|CI137380|6	ACCACATCAAAAGGATAACTTGTGTAACAAACAAACAATGGGGTCACATCCCCAGCGAAA	Os05g0375600	CI137380	Protein chain release factor, RF-1/RF-2 family protein.
5492	65	52	Os09g0566700|mRNA|AK072866|CDS+3'UTR	AGATTAGCAACACTAATATGCATGCCTTTGTCTTTTGTAAACTGTCAGGATTAATAAATA	Os09g0566700	AK072866	Conserved hypothetical protein.
5493	65	53	Os04g0423400|mRNA|AK061578|CDS+3'UTR	TGGATGTACGTATAAGCGTATAGTGTGTACTATACCAATAAAGCTATCTGTTGCTCTGTG	Os04g0423400	AK061578	ABA/WDS induced protein family protein.
5494	65	54	Os07g0496900|mRNA|AK067389|CDS+3'UTR	AACCTACTTACTGCTGCGATTGTGTTATATTCAGATGTGCTGTGATCGGATCGAGATCCT	Os07g0496900	AK067389	Conserved hypothetical protein.
5495	65	55	Os10g0441800|mRNA|AK060324|CDS+3'UTR	AACCGTTTCCTGTGAAAATCTTGTGAAATTCCTGCGTTCAAAACAGAGCCTTTATTTCCA	Os10g0441800	AK060324	Similar to RAB5B.
5496	65	56	Os01g0560000|mRNA|AK105974|CDS+3'UTR	TTCTAGGTGCCATGTGTGACTGATGTACATATACTCCTGATTACTGCGCATTCCAATTAG	Os01g0560000	AK105974	Similar to Auxin amidohydrolase.
5497	65	57	Os06g0703300|mRNA|AK102730|CDS+3'UTR	TTTGAGGGGTAAGAAATCATATTCCAAACCCATTATCCAAACATGGCCTATGTGATTGTT	Os06g0703300	AK102730	Protein of unknown function DUF594 family protein.
5498	65	58	Os01g0864200|COMBINER_EST|CI434014|0	GATATACGAATCATACAAAATACAGATGCTGATTAACAGATGAAGAATAGATTATTTGTT	Os01g0864200	CI434014	Conserved hypothetical protein.
5499	65	59	Os08g0122000|mRNA|AK060794|CDS+3'UTR	GAATGCTTCCTGCTTGCATCAATCGATGCAGAGTTGCTGACTGGTGGTCAATTTGGAATT	Os08g0122000	AK060794	Similar to Protein phosphatase 2A B' regulatory subunit.
5500	65	60	Os12g0207000|mRNA|AY551912|CDS+3'UTR	ACTACTGATGTGGCTATATATATAGTATTTGTGTGCTGCTGCATTTTGTTAATCCCTTAT	Os12g0207000	AY551912	Transcription factor.
5501	65	61	Os03g0559900|mRNA|AK101433|CDS+3'UTR	CAGATGTTGAAAGAATGGTACAACAAAAACTTGATGAGCAAATGGCCATATATTTCTCAC	Os03g0559900	AK101433	Hypothetical protein.
5502	65	62	Os05g0176800|COMBINER_EST|AC144738|3'UTR	AGAAGGATATGGCCAAGGAAGAACTTTCTTTCGTTCTTTCTAACACCAAGCACCAAAGGA	Os05g0176800	AC144738	HCO3- transporter, eukaryote family protein.
5503	65	63	Os06g0642500|mRNA|AK067059|CDS+3'UTR	TTGCTGTCATGTACAAGAGCTGTGTTTTTTAAAGATAAAAGTACTGTACGTTTCCAGTTG	Os06g0642500	AK067059	Similar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2).
5504	65	64	Os07g0438800|mRNA|AY224478|CDS	GATACAGACCAGAATTGTCTGAAGGTCTGCCACGTTCCACTTTTTCTGTGTTTTGCTGCA	Os07g0438800	AY224478	Similar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1).
5505	65	65	Os03g0707600|mRNA|AB030956|CDS+3'UTR	ACGAACCGAACTGGATTTCATTAGCTCCAATGAGAATTTTGTATACAAGGCACCGATCTA	Os03g0707600	AB030956	OsGAI.
5506	65	66	POsControl0035|random		
5507	65	67	Os01g0960500|mRNA|AK065423|CDS+3'UTR	ATGGAGGTCGATCTGAATGGATCAGCTACGTTACGTGCTCAGCTCGTTGTAATCTATTTT	Os01g0960500	AK065423	Copine domain containing protein.
5508	65	68	Os05g0551000|mRNA|AK068028|CDS+3'UTR	AAATTCCTTTTGAATATATATATTGTTGTAAATATACATCAACTTAAAGAAATCCATGCG	Os05g0551000	AK068028	Zinc finger, CHY-type domain containing protein.
5509	65	69	Os05g0310600|COMBINER_EST|CI391715|0	TGTGCCATTCGATCTGTTGTCGATTGTACCGATTGCTCTGCGCTGTTTGTATTCTGTGAT	Os05g0310600	CI391715	NC domain containing protein.
5510	65	70	Os12g0134600|mRNA|AK109609|CDS+3'UTR	TTCACCTGCACCTCCATTTTATCACTCTGGTTAGATAGATAGATGATGCTTTTGTGTGAT	Os12g0134600	AK109609	Transferase family protein.
5511	65	71	Os05g0129300|mRNA|AK104844|CDS+3'UTR	TGTGTGCTGGTTTGTGATGTGATGAACTGATGATTGTAATATTTTGACATTGAACCTATG	Os05g0129300	AK104844	Basic/leucine zipper protein.
5512	65	72	Os12g0566800|COMBINER_EST|CI543487|0	TATATGTTTGTAATAGCTGCTTTTTTGTTCTGAAAAAGGATGGGTGCTATTTTGACGTGG	Os12g0566800	CI543487	Protein of unknown function DUF895, eukaryotic domain containing protein.
5513	65	73	Os12g0114200|COMBINER_EST|CI074055|0	GAGGGAACAAGTGTGGTAAAGTCAAAAAATGCTAGAAAGAGGGTGAGCTGTGTCTTGCTC	Os12g0114200	CI074055	PAP/25A core domain containing protein.
5514	65	74	Os08g0110800|mRNA|AK068995|CDS+3'UTR	TTATCCCTTGCCCTTGCATGGTTTGTGTAGTTGGTAACTGGTAAGGCTGCTTATTGCTGA	Os08g0110800	AK068995	Conserved hypothetical protein.
5515	65	75	POsControl0006|genome		
5516	65	76	Os01g0880200|mRNA|AK071195|CDS+3'UTR	GGTGATAAAATCTGGAGTGACGCAACATGAGATTGCTGACCAGCAAACACTGCCTCATTT	Os01g0880200	AK071195	Glycosyl transferase, family 8 protein.
5517	65	77	Os03g0655400|mRNA|AB011368|CDS+3'UTR	CTGCACGGTGCCTTGTAATAAGAACGCTAATTATGATGAAATTGATGTGTATTATCCTGG	Os03g0655400	AB011368	Similar to Water stress induced protein.
5518	65	78	Os12g0621000|COMBINER_EST|Os12g0621000|8	TTATAGGCGGATACAGGGGGATGATAATAGGTTAGATGATACAGAAACAGGAATAGATTC	Os12g0621000		Similar to Ubiquitin-specific protease 8 (Fragment).
5519	65	79	Os12g0219000|COMBINER|CI312063|6	TACCCCAGCCGGAGTGTGCCCGAAGATCACCGGGAGTCGTCGAAGATCGCATCTACCTGG	Os12g0219000	CI312063	(No Hit)
5520	65	80	Os02g0628800|mRNA|AK058725|CDS+3'UTR	CCGAATCACGTTGATTTGGGGGTGAATTTTTTGTTGCTTCCTGTTTCCTCGTTGGTGCTT	Os02g0628800	AK058725	Similar to Ubiquitin-like protein 5.
5521	65	81	Os07g0570900|mRNA|AK106724|CDS+3'UTR	GTTTGGTCGGATCCAGTCCAGTGTCCGTCAAAACTCTCCGATGCTTGGGGATTTTGTGGG	Os07g0570900	AK106724	Non-protein coding transcript, unclassifiable transcript.
5522	65	82	Os01g0668000|mRNA|AK061159|CDS+3'UTR	AGTTTGTGATCACCAGGTACTTGTGACTGTTCGAATGAAAATATACCATCTACCCATGCC	Os01g0668000	AK061159	CS domain containing protein.
5523	65	83	Os03g0374400|mRNA|AK069719|CDS+3'UTR	CTGTTATTGGAATTGGCCGTGATCATTTCTCACGAGATCTCTTCTCATGCTTTGTATACA	Os03g0374400	AK069719	Conserved hypothetical protein.
5524	65	84	Os05g0231700|mRNA|AK060193|CDS+3'UTR	TGCATATATTGCCAGGTAGTAATAAGATGCTTGTGCAGCTTGTAGGCCTGTAAGGGCTGT	Os05g0231700	AK060193	Similar to Tonoplast membrane integral protein ZmTIP4-2.
5525	65	85	Os03g0652000|mRNA|AK110820|5'UTR+CDS	CGATCTTCACGAGGTCCCAAAGCGGTCGCCGCCGGACAGCGCGCTGGCGCCGCAGTGGTA	Os03g0652000	AK110820	C2 domain containing protein.
5526	66	1	Os03g0339700|mRNA|AK073084|CDS+3'UTR	GCAGTTCGCTCTGCTGATTAGGGACTATAGAGTCAAGTTTTAGTTGTGGTACTTGTATCA	Os03g0339700	AK073084	Protein of unknown function DUF827, plant family protein.
5527	66	2	Os02g0150800|COMBINER_EST|CI348411|0	TCTCTCTCCTCTCTCACATGTGTTGTATGTTTAATCTTTAAACATTGTGATGACAATGTC	Os02g0150800	CI348411	Cyclin-like F-box domain containing protein.
5528	66	3	Os09g0536700|mRNA|AK105374|5'UTR+CDS	CATCCCTTTCCCCTTCCATCTCCGTACACAAAATTGAACCGCAAAATCCCCAGCGCTTAT	Os09g0536700	AK105374	Nodulin-like domain containing protein.
5529	66	4	Os12g0566000|mRNA|AK060451|CDS+3'UTR	TATTTCCTGATTTGGAGCACCATATGTGTAATCTCTGAACTACCAGAATATTAGAGTGAC	Os12g0566000	AK060451	HCO3- transporter, eukaryote family protein.
5530	66	5	Os03g0350300|mRNA|AB117990|CDS+3'UTR	TTTGGAATTGGAGAGCATATGATGCTTTTGCTCATTCTATGTGAACTAAAGTTTCTTGTC	Os03g0350300	AB117990	SAR DNA-binding protein-like protein.
5531	66	6	Os04g0553000|mRNA|AK108691|CDS+3'UTR	TGGAAGTCGATGCTATGCTTTTTGTGTGTTGTGCTAAATTATTGCTCAACTTTTTGCTTC	Os04g0553000	AK108691	Protein of unknown function DUF140 domain containing protein.
5532	66	7	Os11g0109000|mRNA|AK063260|CDS+3'UTR	TCCCTCTCTTGTAGTAGCTGAAAATGATTGCCTAGCTGTTGGATGTGGTGGCCTTTGTTT	Os11g0109000	AK063260	Protein phosphatase 2C-like domain containing protein.
5533	66	8	Os07g0253600|COMBINER|CI212932|6	GCTGTCATTCATAGCCATGGGATGGAAACTTGCATTGCAACCATGCTTAATACTGGTGCA	Os07g0253600	CI212932	(No Hit)
5534	66	9	Os08g0143500|mRNA|AK061094|CDS+3'UTR	CTATAGCCTATCTGATAGCTCAACTAGATTTCTTTGCATTGGCATCAGTTATGTAGAGCT	Os08g0143500	AK061094	Glycosyl transferase, family 14 protein.
5535	66	10	Os02g0558100|mRNA|AK062032|CDS+3'UTR	CGCTCTGTAAATGTAGAGCAAACATTCGGAACACCGAAATTTTATATCATAAAGTTGTGC	Os02g0558100	AK062032	Similar to C1C-Nt1 protein.
5536	66	11	Os08g0201500|COMBINER_EST|CI403558|0	AGAAAGAACAGGAATGTAAGGTTGCGAGGTGCGTCAAAGCACCACAATTACCGACACAAA	Os08g0201500	CI403558	Conserved hypothetical protein.
5537	66	12	Os12g0512800|COMBINER_EST|CI563304|0	ATAATTTGGATTGATATATTGTGTGTGTAAAAACATATGAATTATAGTGTGTAACATACC	Os12g0512800	CI563304	Cytochrome P450 family protein.
5538	66	13	Os01g0189700|mRNA|AK059650|CDS+3'UTR	ATCACAAATGCGGTTGTGCACGGAACATGACTGTTATTATTAAGATGACGTTGTGGCCAC	Os01g0189700	AK059650	Ankyrin repeat containing protein.
5539	66	14	Os06g0669700|mRNA|AK070871|CDS+3'UTR	TGTAATGCTTAAAGATACTGTTGACTGATTTGAGGTAATAATACAATAAACCAGTGGGGC	Os06g0669700	AK070871	Similar to Myb-related protein.
5540	66	15	Os01g0866200|COMBINER_EST|CI027348|0	TATCTGTCTTACTCTTATGTGATCCCATGGTGTTGGAATGAAATGGAAGTGAAGAATTCT	Os01g0866200	CI027348	Histone H3.
5541	66	16	Os05g0208900|mRNA|AK111244|CDS+3'UTR	GTTTCTAGGGCCAAACCAAAGAATAAATGCCCCCAAACTAAAAGCTACACAAACACAATG	Os05g0208900	AK111244	Conserved hypothetical protein.
5542	66	17	Os01g0256500|mRNA|AY072712|CDS+3'UTR	GTTTCACCACGTACCCGAGTGTGATGGTTTTAATGGAACAAGTAATAAATCAGTTTAATT	Os01g0256500	AY072712	Similar to Ramy1.
5543	66	18	Os02g0715000|mRNA|AK104296|CDS+3'UTR	TGCTTCGGAGTGGAGCTCTTAAGCAGCACAGCAATGGTTTATTATATAATGACAGCTTGG	Os02g0715000	AK104296	Similar to Cysteine proteinase.
5544	66	19	Os01g0776700|COMBINER_EST|AU058056|7	CCACCGAGTTAGTCTACGTGTTATGCGTTTATTGTATTCATGTAACGGTTGTGACTTGAG	Os01g0776700	AU058056	Conserved hypothetical protein.
5545	66	20	Os04g0534300|mRNA|AK065842|CDS+3'UTR	ATATGCGTTCGTCATGAAGTTGTAAGACTGACATGCAAGTTGTTCCATCGAAAAGCGAGT	Os04g0534300	AK065842	Ubiquitin interacting motif domain containing protein.
5546	66	21	Os03g0211600|mRNA|AK059620|5'UTR+CDS	GGTCTGGTCGTTGTTGGGATGTCCTAGATCTTTTTCAAGGAATTAAGACCAAGCATTCAG	Os03g0211600	AK059620	Protein prenyltransferase domain containing protein.
5547	66	22	Os05g0487600|mRNA|AK059850|CDS+3'UTR	CCTTTCTGTCCTTTCCTCTATTTGTTCGATAGGGTCTTCAATCTGGACCCAGGCATGTTA	Os05g0487600	AK059850	Similar to Mitochondrial ribosomal protein S3.
5548	66	23	Os05g0130500|mRNA|AK121598|5'UTR+CDS	AGCCTAAAGGGATCCTATGTCTCGACGCAAGCAGCTAGCAGCACAGTGCAGCTCTGCTCT	Os05g0130500	AK121598	Conserved hypothetical protein.
5549	66	24	Os10g0502400|mRNA|AK099393|CDS+3'UTR	CTGCATCTGCTGTGGCAAGAGCTCCATTTTGAAGATATTATATACACGCTGTTGGTGAAA	Os10g0502400	AK099393	Similar to Glutamyl-tRNA reductase 2 (EC 1.2.1.70) (GluTR) (Fragment).
5550	66	25	Os03g0810500|mRNA|AK062378|UTR	AGATGGTTTGTGTATAAAGTTTTATGGCTCTTTCTAGAAAAGAAATTGTTAGCTCCCTCG	Os03g0810500	AK062378	Non-protein coding transcript, unclassifiable transcript.
5551	66	26	Os07g0272700|COMBINER|CI135954|6	AGCTCAGAATTGAGGTGTTTATGAGTTCTGTGCTCTGATGGGTCGTAATTATTGACAAGT	Os07g0272700	CI135954	No apical meristem (NAM) protein domain containing protein.
5552	66	27	Os03g0289100|mRNA|D82038|CDS+3'UTR	TTGTTTGAGTGACTAGTGTTGTGTTAAGCACCAAAATGTTGGTTGTTACAGACTTACATA	Os03g0289100	D82038	OSK3 (OSK5).
5553	66	28	Os05g0148700|mRNA|AK069108|CDS+3'UTR	ATTCCTTCAGTAAGACATAGTCAATAGTGTTAGAATAATTGGGCTAGGCCCAACTTATCC	Os05g0148700	AK069108	Armadillo-like helical domain containing protein.
5554	66	29	Os12g0609200|mRNA|AK067245|CDS+3'UTR	GCGCGTTTGTGAACGCCCGCTTTTGTACCGTGTTTCTCGAAAAAGGAGAAACATTATAGT	Os12g0609200	AK067245	Hypothetical protein.
5555	66	30	Os03g0203700|mRNA|AK121250|CDS+3'UTR	TTTTTTGTGGCCAATCTGGGACTGTAGCAAAGTTACTTGCAATAAAATCAATCGATTTCA	Os03g0203700	AK121250	Similar to Calcium-transporting ATPase 2, plasma membrane-type (EC 3.6.3.8) (Ca(2+)-ATPase isoform 2).
5556	66	31	Os06g0686500|mRNA|AK103252|CDS+3'UTR	AGAGATGTGCCCATATGATCTTTTTTGCATTCTTAGTTGGTCTCATGGATAGAAAGCATG	Os06g0686500	AK103252	Peptidase M3A and M3B, thimet/oligopeptidase F domain containing protein.
5557	66	32	Os06g0521000|mRNA|AK119927|CDS+3'UTR	GTCCAATAGGAACAAAAACTGCTAAGGCGCAACGTAATGGTAAAGGCAGACGCAAAAGGA	Os06g0521000	AK119927	Homeodomain-like containing protein.
5558	66	33	Os03g0105000|mRNA|AK119918|CDS+3'UTR	GGAGGTGGTATACCTTTTCTTTTCATGGTTACGGCCTCCCAGGGTTGTATCCTTGTATTT	Os03g0105000	AK119918	Conserved hypothetical protein.
5559	66	34	Os01g0176800|COMBINER|CI552632|1	AAGAAGCTGCAGCACCTCGGGTCGCGGGTGTACGAGCGACTGCCGTCCATGTCGTCGGCC	Os01g0176800	CI552632	Conserved hypothetical protein.
5560	66	35	Os03g0577200|mRNA|AK099558|CDS+3'UTR	ATTGGGATATATTGCAAAGAACGATCTATTAATCCAATCGTGAGTTGCAATTGTTGCTTC	Os03g0577200	AK099558	Similar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A).
5561	66	36	Os03g0133300|mRNA|AK064510|CDS+3'UTR	CTTCCGCGGCTTAGCGTTTTATCGTTCCGGACTGCTGTTTGATCAATTAGGCGAAATAAT	Os03g0133300	AK064510	Conserved hypothetical protein.
5562	66	37	Os07g0565800|mRNA|AK062834|CDS+3'UTR	TCGATCGCGTGCTTTTGTTAGCTTTGAACTCGTAATAATGTATTAATTGGTGAGTGATTA	Os07g0565800	AK062834	Conserved hypothetical protein.
5563	66	38	Os02g0294700|mRNA|AK069078|CDS+3'UTR	AAGGGTTGAAATGTTACTAGTTGATCATGCCCTCGTACTGAAAAAATCCTAGCTAGCATT	Os02g0294700	AK069078	Conserved hypothetical protein.
5564	66	39	Os07g0560700|mRNA|AK105369|UTR	TTTTTTCCTTGGGGATTTCTTGGTCCTTTGGGTTTGGTAATTTGATTTCTGACAAACAAA	Os07g0560700	AK105369	"Non-protein coding transcript, uncharacterized transcript."
5565	66	40	Os03g0708700|COMBINER_EST|CI122858|6	TTGGAATTCATTAACACGAAACATATGCCTCTGCCGGCTTTGATGCCAGGTAGAGTGAGT	Os03g0708700	CI122858	Protein of unknown function DUF593 family protein.
5566	66	41	Os06g0130200|mRNA|AK101132|CDS+3'UTR	CGGTGTGTACTCCAGATCTGTAACTTGTTGCCAATCATCATCCAGCAAAGTTGCTTGCTT	Os06g0130200	AK101132	Conserved hypothetical protein.
5567	66	42	Os05g0529700|mRNA|AK064168|CDS+3'UTR	TCGGAATGTAAAAGATGAATATGTGCACATTCTCCTTCAACAATGGTATACATCCTGAAG	Os05g0529700	AK064168	Heat shock protein DnaJ family protein.
5568	66	43	Os08g0249100|mRNA|AK111692|CDS+3'UTR	TTTCCTGTAAATTATTCATGAGAAAATTTGGTGCTGTTGAGCCAAGCATATATCATGTGC	Os08g0249100	AK111692	UspA domain containing protein.
5569	66	44	Os03g0216800|mRNA|AK105520|CDS+3'UTR	TGCAGAGCGGAAATATTATTCATTCTTTCGATAAATAATACTCCCTCCATTCTAAAATAT	Os03g0216800	AK105520	Similar to Polygalacturonase B (Fragment).
5570	66	45	Os05g0530500|mRNA|AK104868|CDS+3'UTR	TGATCTTTACTAGCCTGATTGCCCAGCCTGAGAATCACCTCTGTCGTTATGAAAGTTGAG	Os05g0530500	AK104868	OSK1.
5571	66	46	Os04g0326000|COMBINER_EST|Os04g0326000|8	AAATTGAAGGGGCCAATGTGGGAACAACTAAACATGCTAAGGTCAAAAGGGCAGCATTAG	Os04g0326000		TNP1/EN/SPM-like transposon protein domain containing protein.
5572	66	47	Os04g0412200|mRNA|AK062016|CDS+3'UTR	CACTTGCCGTTGAAACTAGCCAGAATTTATCGTCATCTTCCACTTGGATTGAGTTAAGTG	Os04g0412200	AK062016	Similar to Ferredoxin I.
5573	66	48	Os05g0135500|mRNA|AK120246|CDS+3'UTR	GTGTGCCAATTGGGCAAAAATAAATTGTGCTTCTGACCATATATATGGGTGAATTTATTC	Os05g0135500	AK120246	Haem peroxidase family protein.
5574	66	49	Os02g0103800|mRNA|AK106213|CDS+3'UTR	TCGACTATAAAGTGGTTTCCCATTTTCTGCTGTATTTTGACAACTTTAGTGTCCCATTTA	Os02g0103800	AK106213	Similar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
5575	66	50	Os10g0459900|mRNA|AK108215|CDS+3'UTR	GCGCGGGCGGACTGGGTGGGGATCAGACTGAGGATATGGGAGAGAGAAATGATTTTTTTT	Os10g0459900	AK108215	Conserved hypothetical protein.
5576	66	51	Os06g0197200|COMBINER_EST|Os06g0197200|8	TCGGAACAATTGTTGGGCTATATGCAAAGATTTGTGCATGTACTGAGCCAAGCGAGAAAA	Os06g0197200		"20 kDa chaperonin, chloroplast precursor (Protein Cpn21) (Chloroplast protein Cpn10) (Chloroplast chaperonin 10) (Ch-CPN10) (Chaperonin 20)."
5577	66	52	Os03g0795200|mRNA|AK120623|CDS+3'UTR	TTCAGGTATGATTAACTTGTACACCCATGAGAAACTTACTGATGATTGAAGATTCATTTT	Os03g0795200	AK120623	Protein prenyltransferase domain containing protein.
5578	66	53	Os08g0479300|mRNA|AK070025|CDS+3'UTR	GAGAAAATTAGAGGCGGCAGCACTCCTTTTTGTGATCAGCAATGATGATCATCCACATGA	Os08g0479300	AK070025	Cyclin-like domain containing protein.
5579	66	54	Os01g0314700|COMBINER_EST|Os01g0314700|8	AAATCCGGAGACACATCGTTCAGGAATAAAATGCCTAAGCGCTTAAAAACCACCTCATAA	Os01g0314700		Disease resistance protein family protein.
5580	66	55	Os09g0511700|mRNA|AK101420|CDS+3'UTR	TGTCGCCCCACGTCGACTTGTTAGGCGCAGGTTTAACTTTGTTTTGTGGGATAATTAGTT	Os09g0511700	AK101420	Similar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118).
5581	66	56	Os06g0676000|mRNA|AK070574|CDS+3'UTR	TTGATATCTGGTACTGCCGATTGTACACGATGGTTAGCTAACTGTGATCCTGTGACACCA	Os06g0676000	AK070574	Similar to Integral membrane protein OsNramp3 (Fragment).
5582	66	57	Os03g0129400|mRNA|AK073820|CDS+3'UTR	ACAAAATGTATCTATGAGCTTGAAGTTATCTCAAAGCTATCAGTAACACATTATTTGGTC	Os03g0129400	AK073820	Hypothetical protein.
5583	66	58	Os09g0455200|COMBINER_EST|CI409925|0	GGACCGTGATAATGCTTCAAGAATCCAACGATCTTTTGGACGACAAGTCCGGAAAGGGAA	Os09g0455200	CI409925	Winged helix repressor DNA-binding domain containing protein.
5584	66	59	Os07g0295400|mRNA|AK060569|CDS+3'UTR	CTAGATCCGATATATTGTCGCAGATTGTTGTAGGTTTAAACGGAGCTTAGTTTGGTGATG	Os07g0295400	AK060569	Conserved hypothetical protein.
5585	66	60	Os12g0147800|mRNA|AF068333|CDS+3'UTR	ACTTGTGGGTTATGATCTGACGATCGAGTGTATGAACAGTGCTAATGGTGTAGTAAGTTT	Os12g0147800	AF068333	Phytosulfokines 5 precursor (Secretory protein SH27A) [Contains: Phytosulfokine-alpha (PSK-alpha) (Phytosulfokine-a); Phytosulfokine- beta (PSK-beta) (Phytosulfokine-b)].
5586	66	61	Os05g0493800|mRNA|AK110589|CDS+3'UTR	CCTGCAAAATGTAAGCGTTTGTCACCTCGTCAGATGTTCAGAATGGTGGCATGCATATCT	Os05g0493800	AK110589	Similar to MtN21 nodulin protein-like.
5587	66	62	Os01g0937400|mRNA|AK120699|CDS+3'UTR	AGCCGCCATTCGGTGTTGTAACTTTACCCCGATACAGTGAAGATATTTTATTGGCTGGTG	Os01g0937400	AK120699	Disease resistance protein family protein.
5588	66	63	Os04g0511600|mRNA|AK067002|CDS+3'UTR	GCATAGACGAATGGCTAAGAAGGAAGAAACTATGTCCAGTTTGCAAGTCTGGGATCACAT	Os04g0511600	AK067002	Similar to RING-H2 finger protein ATL3G.
5589	66	64	Os01g0201800|COMBINER|AU100708|6	ATCTTGACTTGTGGTGTTCGAGAAACCACCCCTGATTTCTTAACATTTGGTACAAGCCAA	Os01g0201800	AU100708	(No Hit)
5590	66	65	Os03g0656500|mRNA|AK121052|CDS+3'UTR	GCTAACAGCGATGTAGCAATTGTTCATATATCTTCGTTTGGCATCCTGTCGCAATCCCGA	Os03g0656500	AK121052	Similar to K-exchanger-like protein.
5591	66	66	Os05g0420600|mRNA|D12634|CDS+3'UTR	CCAGTCGGTGAGACTGGATTGCATCCCTTTTGGAAAAATACTGAGATCCTTAAATTTGTG	Os05g0420600	D12634	Cytochrome c.
5592	66	67	Os08g0145300|COMBINER|CI217272|6	GCCTTTTTTCCACTGTTGCTGCTTTTGTTTCGGTGTGAGGACTAAGTGCCTCTTCTGTAA	Os08g0145300	CI217272	(No Hit)
5593	66	68	Os02g0829600|mRNA|AK069290|CDS+3'UTR	GAAAATGTGTAACTGGACCGGCTGGGCACTTGCAGAAAAAGTCGATAAATGTGTTGTGTT	Os02g0829600	AK069290	Similar to Sperm protamine P1 (Po1) [Contains: Sperm protamine P2 (Po2) (Main protamine)].
5594	66	69	Os03g0784500|mRNA|AK108472|CDS+3'UTR	CAAAACTCATATTGCCAACTAACTGTATAGCTAGATTACCTGTATAACGAGAAACTTTGG	Os03g0784500	AK108472	Conserved hypothetical protein.
5595	66	70	Os05g0559900|mRNA|AK067197|CDS+3'UTR	AAGTGTATCACAGCGGAATGCAACCCCAATAATATGAGAGCTCGTTTTTGTCATTTTCCT	Os05g0559900	AK067197	tRNA-binding arm domain containing protein.
5596	66	71	osa-miR167j|Os01|5'seq	TTGTGATGTGTGCACCTTAAGCAGCTGAAGCTGCCAGCATGATCTGATCTTTTGCGATCT			miRNA
5597	66	72	Os01g0362400|mRNA|AK062630|CDS+3'UTR	TCTTCATCCGACTTACTTCGATTCATTGATCTTGTATGGAGTACTTATTTTTGTGTGATT	Os01g0362400	AK062630	Conserved hypothetical protein.
5598	66	73	Os08g0117400|mRNA|AK103863|CDS+3'UTR	CTTTGCGTTTCGCTCTGTTCAATACTGCAATGTAAATTGTGGATCTATCTATCATTCAAA	Os08g0117400	AK103863	Similar to Calmodulin 1 (Fragment).
5599	66	74	Os05g0110300|mRNA|AK067116|CDS+3'UTR	TCGATGTAAACTAAAATCTTTGTATGTATCTTTCTTTCAGGGTTCAGATTGCTCCACCGT	Os05g0110300	AK067116	NAD-dependent epimerase/dehydratase family protein.
5600	66	75	Os11g0227700|COMBINER_EST|CI250531|6	TTGGGTCTTTGCCTTGTGTTTCACTTCCAGTTCTTAAATCCGTTTCAGGCAGCGCAATGT	Os11g0227700	CI250531	Similar to NBS-LRR protein (Fragment).
5601	66	76	Os01g0218500|mRNA|AK108673|CDS+3'UTR	TTTCAAAAGAAAAAGGGCACACATTTCTTTTAATTTAGATGAAAAACAATATATATGGAT	Os01g0218500	AK108673	Similar to SP3D.
5602	66	77	Os05g0215000|mRNA|AK119543|CDS+3'UTR	TACGGTGCTACTCCCTCTATCCCGAAATAAAACAACTTATAGAGATTGAAGTTTGTCCCA	Os05g0215000	AK119543	BURP domain containing protein.
5603	66	78	Os03g0620500|mRNA|AK100451|CDS+3'UTR	AGAGTTGGCAGCTTTTAAACAACCTCGCTGATGGTAGTTGTCCTACTTGCGAATTTCTAC	Os03g0620500	AK100451	Transcriptional factor B3 family protein.
5604	66	79	Os01g0821800|mRNA|AK103171|CDS+3'UTR	TATTACCTTGCACCAAATGCAAAATCCTTCATGAACACGGTTGTTTTCAGGCAGGATTTC	Os01g0821800	AK103171	Endothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein.
5605	66	80	Os03g0626400|mRNA|AK062861|UTR	ATGTCATGCCAGTAATAATGCTGTAATGGTAAAACAGAGGGATCTAAAAGCATTTGACTG	Os03g0626400	AK062861	Non-protein coding transcript, unclassifiable transcript.
5606	66	81	Os06g0631800|COMBINER|CI480002|2	GAGTTTAAGCATGTAATTTGTTTATTGTATAGTGTGTGTCTGAATGTAACAGAACCCGTG	Os06g0631800	CI480002	(No Hit)
5607	66	82	Os04g0517100|mRNA|AK111798|CDS+3'UTR	CTGGATCATCAGAAAACGGGCTCTGCGTTTCTCATTTGATTAATTAAATTCAACTTGCAC	Os04g0517100	AK111798	Similar to Y19 protein.
5608	66	83	Os12g0119000|mRNA|AK066943|CDS+3'UTR	CTTGAGATTCTTGAAGGTTATATAAATGTTTCCCTTTTCCCCTTGTTATATTTGTTTGGT	Os12g0119000	AK066943	Cytochrome P450 family protein.
5609	66	84	ETG08_142674		
5610	66	85	Os07g0615100|mRNA|AK100874|UTR	GTCTAGCTAGATTTTTTCAGTCAATTATTTGATAGGCAGGACAGGGAATCAAACGTGAGG	Os07g0615100	AK100874	Non-protein coding transcript, uncharacterized transcript.
5611	67	1	Os03g0140200|mRNA|AK061292|CDS+3'UTR	GCCGTATATTGGCTATGTATAGGTTGGTGTGTCCCTGTTAGTGATTATCTGTTTGTTTCG	Os03g0140200	AK061292	Similar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase).
5612	67	2	Os09g0490200|mRNA|AK065473|CDS+3'UTR	TTGCTGCTGCATGATGATGATCTAATGGAATACTTGGGAACATAACATAGGTTAGGCTCC	Os09g0490200	AK065473	Similar to EIL3.
5613	67	3	Os06g0191300|mRNA|AK099769|CDS+3'UTR	TTAGTGGTAAGCTGCTTAATGATGATAGTGTGCAAGTTGCCACTCTTCAAAGTGGTTCTT	Os06g0191300	AK099769	Similar to MAP kinase kinase.
5614	67	4	Os02g0819100|mRNA|AK100156|CDS+3'UTR	TTGACCAGAATTTTCATGTCAATTTCGCTTATTCGGGGAATAAACGAAACGACATATTTG	Os02g0819100	AK100156	Zinc finger, DHHC-type domain containing protein.
5615	67	5	Os09g0349600|COMBINER_EST|Os09g0349600|8	AGTGGCTTCATGGGAAGCACAAGCACAGTCAGTGATAACACATTTTCTACGTCCAGGTTT	Os09g0349600		Protein kinase-like domain containing protein.
5616	67	6	Os11g0439600|mRNA|AK104429|CDS+3'UTR	TTTGGCAGATTTGAGTAGCAAATTCATAACACTGCGCAATTAATAACTTAATAAAATGGT	Os11g0439600	AK104429	Similar to Nod factor binding lectin-nucleotide phosphohydrolase.
5617	67	7	Os05g0163400|mRNA|AK120340|CDS+3'UTR	CGGTCGATATGGAATTATTTTGTGAGCTATTAGACTATTATAAACTCAAGCAAAACCTAT	Os05g0163400	AK120340	Zinc finger, RING-type domain containing protein.
5618	67	8	POsControl0018|genome		
5619	67	9	Os06g0725500|COMBINER_EST|Os06g0725500|8	AGAGGCTGGAGGAGCTGGAGGAGTGCATCGATGAGCTCGACAACGGCAGCGACAAGGTGT	Os06g0725500		Protein of unknown function DUF241, plant family protein.
5620	67	10	Os03g0604500|COMBINER|CI169973|6	TTCAGTACTTGCCAGTAGGTAGCGTGCTAGCTTTGCTAAATTGCTAATCAATGAGTGTTT	Os03g0604500	CI169973	Conserved hypothetical protein.
5621	67	11	Os01g0734200|mRNA|AK103747|CDS+3'UTR	GTCTGGCTAAGGCCAGAAGCACGTTTTACTTTTGTATTTATACATAACAGAAAACGAGAA	Os01g0734200	AK103747	Similar to RbohAOsp (Fragment).
5622	67	12	Os02g0741100|mRNA|AK071144|CDS+3'UTR	GCTTCAAGAAACTGTCTTATGTTGTACACTGCAGCCAGAATCCAATTCAGATTCGTTCAA	Os02g0741100	AK071144	Similar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16).
5623	67	13	Os07g0658600|COMBINER_EST|CI252790|6	GCTAATCCCTTGCTTTAATGTAGCAACATGATGTTTTAAGAGAAGTTGGGCCGTTGTTTT	Os07g0658600	CI252790	Similar to Nucleoid DNA-binding-like protein.
5624	67	14	Os09g0343500|COMBINER_EST|CB651331|7	TTGAAATTTTGTGATATTTGTTAAGCTATTGCTGAAATATAGTCAAACTTTTTATAAATT	Os09g0343500	CB651331	Protein of unknown function DUF1263 domain containing protein.
5625	67	15	Os04g0533900|COMBINER_EST|Os04g0533900|8	TGAAGTTGACACCGTCGAGATCGCCAAGAAGTTGAAGAAATTCGGGAAGGTCGATATCAT	Os04g0533900		Heavy metal transport/detoxification protein domain containing protein.
5626	67	16	Os10g0548900|mRNA|AK058225|CDS+3'UTR	CTAACTGCTAACTTCTCAGTGATACTCAGTAGGTACAAAATATATGCAATGCAGCTTCCC	Os10g0548900	AK058225	UDP-N-acetylmuramyl-tripeptide synthetase family protein.
5627	67	17	Os07g0141400|mRNA|AK104722|CDS+3'UTR	CCTGCATGCAAGGATTGATTTTCTGTGATCCGTGTGTTAAGTAATCCTAGTAATTAATCA	Os07g0141400	AK104722	Similar to 23 kDa polypeptide of photosystem II.
5628	67	18	Os01g0774200|mRNA|AK120412|CDS+3'UTR	TATAGGAATCGAGCAAATGTATAATCGTTGTAATTTGATTTGAGATGAAAAATGGTCTTT	Os01g0774200	AK120412	Conserved hypothetical protein.
5629	67	19	Os12g0554100|mRNA|AK069357|CDS+3'UTR	CTCTAACCATTTTATCTGATGTTATCATCATCTGATAAAAGCAGCTATTTTTCATGTAAA	Os12g0554100	AK069357	Protein of unknown function DUF231, plant domain containing protein.
5630	67	20	Os07g0586200|mRNA|AK073754|CDS+3'UTR	TATGGTTGATATAAAGTACATATACTGCTTCCTTTGTGCAATAAAGGGAGAATGAGATTC	Os07g0586200	AK073754	Similar to Esterase precursor (EC 3.1.1.-) (Early nodule-specific protein homolog) (Latex allergen Hev b 13).
5631	67	21	Os08g0422700|COMBINER_EST|Os08g0422700|8	GCGGAGAGCCGGAGGAAGAGGAGAGGAACCAGTGGCGTGGGCGCGTGGCTGCGCAGCTGA	Os08g0422700		Conserved hypothetical protein.
5632	67	22	Os06g0128800|mRNA|AK110551|CDS+3'UTR	CTGTATAAATGATTGCTACCACTTGATTGTGAGATGAATTGATAAGAGAAACCCTAAGTC	Os06g0128800	AK110551	Conserved hypothetical protein.
5633	67	23	Os11g0702300|COMBINER|CI552594|0	TTAGGAATCAATAAAACAGATACAATGTTTAGCCTATGACAATGTGGATGCACTACTTAA	Os11g0702300	CI552594	Zinc finger, C2H2-type domain containing protein.
5634	67	24	Os09g0491100|mRNA|AK061340|CDS+3'UTR	GACAATAATAAGAAGAAACAATAATGCTCCCTGTCGAGCAGTGTTGGGCTGGTTCAGGCT	Os09g0491100	AK061340	Similar to Beta-primeverosidase (EC 3.2.1.149).
5635	67	25	Os07g0655900|mRNA|AK058607|CDS+3'UTR	AAGAAAAAGGAAAGGAAAAATTGTATTGTTAGGTAACACTACATAATTTCTTAATCCACG	Os07g0655900	AK058607	Conserved hypothetical protein.
5636	67	26	Os05g0399100|mRNA|AK101551|CDS+3'UTR	CTTGTGTTAGGAATTTGCTTTGTGTCAACCTGAACTTCCACTTCTGTAATAAAAATGGAT	Os05g0399100	AK101551	Similar to Endo-1,3;1,4-beta-D-glucanase precursor (EC 3.2.1.-).
5637	67	27	osa-miR160c|Os08|Mature	TGCCTGGCTCCCTGTATGCCATGCCTGGCTCCCTGTATGCCATGCCTGGCTCCCTGTATG			miRNA
5638	67	28	Os01g0763700|mRNA|AK072138|CDS+3'UTR	TAGAACTTAAAACACAGTTATTCTTGATGAAATGTGCAGTTGTAATATTTGGTTTGTATT	Os01g0763700	AK072138	Exo70 exocyst complex subunit family protein.
5639	67	29	Os12g0582800|mRNA|AK111649|CDS+3'UTR	TGTGTATATGGATGTTCTTTTGCTTCAACCTATTCAGTAATGAGATTATTTGGCAGTTGG	Os12g0582800	AK111649	Protein of unknown function DUF221 domain containing protein.
5640	67	30	Os05g0199300|COMBINER|CI164552|6	GTGTTCGCTAGATGTGGCGAACCATTGTATATTCGGGAATCTGCCGCAAACCCTTTTATT	Os05g0199300	CI164552	(No Hit)
5641	67	31	Os08g0229600|mRNA|AK064286|CDS+3'UTR	TGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGT	Os08g0229600	AK064286	Exo70 exocyst complex subunit family protein.
5642	67	32	Os10g0564800|COMBINER_EST|Os10g0564800|8	CAGAGTGGGAGAATTTTGTCTCAAGGAATCCCTCTTTATTGAAGATAATGACTCTTCCGT	Os10g0564800		Calcium-binding EF-hand domain containing protein.
5643	67	33	Os07g0418500|mRNA|AK072220|CDS+3'UTR	AATTTTGTTGATGTTATTCAGACAATGTATTTGTATATTTCATTTTAACAAAATTTGGAT	Os07g0418500	AK072220	Similar to Cytochrome P450.
5644	67	34	Os01g0122200|mRNA|AK107171|CDS+3'UTR	CAACCTCGTTTTTAATCTTCAATGGATAGAAGTAGATGCCAAAAAGATCCTAATTGAAGC	Os01g0122200	AK107171	Seven in absentia protein family protein.
5645	67	35	Os02g0800500|mRNA|AK072332|CDS+3'UTR	TGCCGCATAGGTTGGCACATGTTTATAAGGTCAAATGGAATATATTTCTTGTGTTTTTAC	Os02g0800500	AK072332	Similar to Cyclin B.
5646	67	36	Os07g0608400|mRNA|AK109447|CDS+3'UTR	CTTGTTAGGCATGCAGTTGTGCTGCCCCTTAGGGGGCTAAGACTGCTTATCCATTGTACT	Os07g0608400	AK109447	Similar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)].
5647	67	37	Os03g0428800|mRNA|AK060233|CDS+3'UTR	ATGCGTTGTGGAAACAGTTTACAGTTTTAAGATTTTACGGCAGCAATGAATAAAGGTTTC	Os03g0428800	AK060233	Tetratricopeptide-like helical domain containing protein.
5648	67	38	Os06g0121500|mRNA|AK058425|CDS+3'UTR	TGGCGCCTGCTGACGACCGCACCTTGTGATCGACCCGTTTAATTTGAGATTTGCTCCGGT	Os06g0121500	AK058425	Peptidase A1, pepsin family protein.
5649	67	39	POsControl0041|art		
5650	67	40	Os12g0269700|COMBINER|CI482408|x	ATTCCCACCATCGGTGGTATCTGGTACTGAATTGTAGCAGTATAGTAGTACAGGAGAGAA	Os12g0269700	CI482408	(No Hit)
5651	67	41	Os10g0147400|mRNA|AK102729|CDS+3'UTR	TTTGCTTCTTTCTTCTTCTTCTGGTTACTGAGAGAGAGTGAGAGTGAGAATGTTTGGTGG	Os10g0147400	AK102729	Similar to Auxin influx carrier protein.
5652	67	42	Os02g0666200|mRNA|AJ224327|CDS+3'UTR	CAGTCACTGTATGTTTTTATGTGATGGAGATCTTAATTCTTAAGTTATCATCTCTGTTGC	Os02g0666200	AJ224327	Aquaporin.
5653	67	43	Os02g0146600|mRNA|AK073620|CDS+3'UTR	GGGAGAGGGAGACACTACTGGAATATTTACTTTCTTTATTAAGCTATGCTTGCCTTGTGT	Os02g0146600	AK073620	Similar to Eukaryotic initiation factor 4A (eIF4A) (eIF-4A).
5654	67	44	Os05g0292500|COMBINER_EST|Os05g0292500|8	ACATGCAAAATTTGGGAGCGTGCCGCACGAATATTCTACAATAGCAGGTATTGAAGAATC	Os05g0292500		Ribosomal protein S11 family protein.
5655	67	45	Os04g0165600|mRNA|AK062476|CDS+3'UTR	GACATCTTCAGTTCAAATTTATTATGATCTGTCACCTGTTGCGGTTGGAAAGCAGAAACA	Os04g0165600	AK062476	Peptidase S26A, signal peptidase I family protein.
5656	67	46	Os03g0238300|mRNA|AK059494|CDS+3'UTR	CTGACTTCCTGTAACTATACATATGTACTCTTCATGATCAGAAATTCACAATACCAGATC	Os03g0238300	AK059494	Inositol polyphosphate related phosphatase domain containing protein.
5657	67	47	Os02g0536400|mRNA|AK100595|CDS+3'UTR	TACATGATTTTTTGGGGAAAAGAAACAAGCCTCTTGTTTAGCAGTTATATAGAGGAAAGG	Os02g0536400	AK100595	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
5658	67	48	Os08g0224100|mRNA|AY156510|CDS+3'UTR	GGAACATGTGCAAGGCTGCAAGGCTTGATGCCTAATAGTATATATAGCATATGTATAATT	Os08g0224100	AY156510	Similar to Serine/thronine protein kinase-like protein.
5659	67	49	Os11g0701800|mRNA|AK102862|CDS+3'UTR	TGTAGGTATATGAATAAAACGAGATCCATATGTAACGATGGAGATCTCGAGTTGTTTGTT	Os11g0701800	AK102862	Chitinase (EC 3.2.1.14) III C10701-rice (EC 3.2.1.14) (Class III chitinase homologue (OsChib3H-a)H-).
5660	67	50	Os04g0535200|mRNA|AK060585|CDS+3'UTR	TGTTTCTGCTTGTAAATCTGTCTTGCTCTGCCCGTATGGAACCTGATTAACGATTAACCG	Os04g0535200	AK060585	Peptidase A1, pepsin family protein.
5661	67	51	Os02g0598200|mRNA|AK064402|CDS+3'UTR	AATGCAAAGGTCAAGGCATTGAACTTGTGTTGAATACTTGAATAAGATGTTGGCACTTTG	Os02g0598200	AK064402	Transcriptional factor B3 family protein.
5662	67	52	Os06g0637800|mRNA|AK103506|UTR	CTCCTTGCCCCATCCGTCGGCCGCGACGACGACGGATCTCCACCGCGCGCCGCCGGCTTC	Os06g0637800	AK103506	Non-protein coding transcript, unclassifiable transcript.
5663	67	53	Os02g0201900|mRNA|AK072368|CDS+3'UTR	AAGTTAAAAAGGCTCTGTCCAATGGATTTGCTTGCATATCCTTTGATTGCACTGTTCATT	Os02g0201900	AK072368	DEAD/DEAH box helicase domain containing protein.
5664	67	54	Os03g0344100|mRNA|AK061903|CDS+3'UTR	AGTTCGCCGAATGCTACTATCTGGATTATTTTTACTCAAAACATATGTCGGATGCTTATT	Os03g0344100	AK061903	Similar to ASF/SF2-like pre-mRNA splicing factor SRP32''.
5665	67	55	Os12g0566000|mRNA|AK070617|CDS+3'UTR	ACTTGGTAACCTTTTGAGTTTCATTTGCTAAATTCCTGTCAGAACTTGTGGATGATTCAT	Os12g0566000	AK070617	HCO3- transporter, eukaryote family protein.
5666	67	56	Os04g0445700|mRNA|AK071888|CDS+3'UTR	GGTTCCCGTTGTGTATGTTATGGTGTGACAGATCTGAAATAGTGTAAAGACATCAGTGAT	Os04g0445700	AK071888	Similar to 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplast precursor (EC 2.3.1.41) (Beta-ketoacyl-ACP synthase I) (KAS I).
5667	67	57	Os02g0779200|mRNA|AK106527|CDS+3'UTR	TGTACTGAATAAGATGTAATTCCCTTCATTTCAAATTACTTGTCATTCTAGTTTTACCAT	Os02g0779200	AK106527	Similar to Subtilisin-like protease (Fragment).
5668	67	58	Os03g0276500|mRNA|AK072830|CDS+3'UTR	CCGGTTTTGCTTTACTTGTTAAAGTTTGGATTATTATGGTTTTATTAATATAGTATTGAG	Os03g0276500	AK072830	Similar to Heat shock protein 70.
5669	67	59	Os05g0506000|mRNA|AK062012|CDS+3'UTR	TATAATGTGTTGTAAACATTCTACAGACTACAAGAAATCCAAGTGTACACTTCACTTGGC	Os05g0506000	AK062012	Similar to MS5-like protein (Fragment).
5670	67	60	Os02g0139300|mRNA|AK101322|CDS+3'UTR	TGCCATTGTGATGAGGATCATGCCTTGAACCATTGATTGACAATCAGAGATGTTGGGCGA	Os02g0139300	AK101322	Glycoside hydrolase, family 17 protein.
5671	67	61	Os05g0283000|mRNA|AK064150|CDS+3'UTR	GTTCCGAGTTGTGTCAAACACCTTGGCGAATTTTTGTTTGGTGTCGGTTTCGAGATCTGT	Os05g0283000	AK064150	Conserved hypothetical protein.
5672	67	62	Os04g0457800|mRNA|AK061767|CDS+3'UTR	TATTGTACGTACAACTCTCTCTTTTGACGGTGCTAAACATCCTAGGCAATCTTTTTTGGT	Os04g0457800	AK061767	Similar to SERK1 (Fragment).
5673	67	63	Os03g0783700|mRNA|AF443602|CDS+3'UTR	AAGGTGCCAGGATTAAGAATGAACATGATGTAACTACACTGTATCCGCTATTTTGAACCG	Os03g0783700	AF443602	Similar to Clathrin assembly small subunit protein AP19 (Clathrin assembly protein AP19, small subunit).
5674	67	64	Os03g0410000|mRNA|D88619|CDS+3'UTR	GACGTAGTCAGATGACCATTTCCTTATATATTGTACAGATTATAATGGAGCAGATTAAAT	Os03g0410000	D88619	Homeodomain-related containing protein.
5675	67	65	Os01g0224000|COMBINER_EST|Os01g0224000|8	TAGCTATGGCAATATCAGAGCAATTGTACCCACGACTGTATCCTGTATGTTTCACATCAT	Os01g0224000		Curculin-like (mannose-binding) lectin domain containing protein.
5676	67	66	Os07g0596300|mRNA|AK120222|CDS+3'UTR	TTTTGTAGTGAATGTACCAAGGTTTTCATAATTAGTGAATGCAGCAGCTTTTCCATGATC	Os07g0596300	AK120222	Actin-binding FH2 domain containing protein.
5677	67	67	Os05g0226000|COMBINER_EST|CI350891|0	TTATTTTGCTGAAGGTCGGAGCACTAGGAAATGGCCATTGGCCATTTCTGGAATAAATAA	Os05g0226000	CI350891	Conserved hypothetical protein.
5678	67	68	Os10g0437700|mRNA|AK062774|CDS+3'UTR	CAAATCCTTGTGCAGTACTATCATCTGACTTTAAGTGGCTAACATGTGGGCCTTATACCC	Os10g0437700	AK062774	HSP20-like chaperone domain containing protein.
5679	67	69	Os02g0775400|mRNA|AY224575|CDS	ACTGAAAAAGTCTCAAGGCCATGATCTTGAGGATTTTGACACCAAATATATTGGCTCGTA	Os02g0775400	AY224575	Similar to Kinesin heavy chain-like protein (Fragment).
5680	67	70	Os03g0565300|mRNA|AK072093|CDS+3'UTR	CTTTAGCATCCACTTCTGAATTTTATATGTGAATGGATGCAGAACTCTGCTTTAGCTAAC	Os03g0565300	AK072093	Protein of unknown function DUF1723 domain containing protein.
5681	67	71	Os01g0681900|mRNA|AB008845|CDS+3'UTR	TTTTGGTGTGTTCTGCTTGTTACTTTTCCAGTAAAATGATTTGCATGGTGAAATGCCGTT	Os01g0681900	AB008845	NADH dependent Glutamate Synthase precursor (EC 1.4.1.14).
5682	67	72	Os01g0702300|COMBINER_EST|Os01g0702300|8	CGGACCCGGACCGGAAGCATCGCGTGCGGAGCCCCATCGTTGCCAAGACGACCTGCGGGT	Os01g0702300		Peptidase S8 and S53, subtilisin, kexin, sedolisin domain containing protein.
5683	67	73	Os03g0645100|mRNA|AK103256|CDS+3'UTR	CCACAGGATATATTCGTGCACTGTATCATGCTGAATTCTAGGATTTAAACATGTTTTTAC	Os03g0645100	AK103256	Similar to Pyruvate dehydrogenase E1 beta subunit (Fragment).
5684	67	74	Os02g0803700|mRNA|AK067051|CDS+3'UTR	CGAAACATGTCTTGCGCTGTTCCTTCTCTGCTTGATATATACTGATAGAAGTTGACTCGT	Os02g0803700	AK067051	Similar to 26S protease regulatory subunit 6A homolog (TAT-binding protein homolog 1) (TBP-1).
5685	67	75	Os03g0793700|mRNA|AK121667|CDS+3'UTR	CGTATTAGCTGAGGTATGTATCGATGGAACTGTATGAACCCAAGTACGGAGTGCTATATT	Os03g0793700	AK121667	Cupin 1 domain containing protein.
5686	67	76	Os03g0718100|mRNA|AK100267|CDS+3'UTR	AGGGTACCAGAAAAAATACGTGTTCTGGTTGTTTTTGAGTTGCGATTATTCTATGAAATG	Os03g0718100	AK100267	Actin 1.
5687	67	77	Os02g0203500|COMBINER_EST|Os02g0203500|8	CATTCCCCCACCCTGCTGTTGGTCTCATCCAATTTTCCTCCAGCCAGATCTGGGAGGAGT	Os02g0203500		Disease resistance protein family protein.
5688	67	78	Os01g0665200|mRNA|AK072082|CDS+3'UTR	CGTCTGAGCACAAATGCTTGCGAGACAATTCCCTTGTAGAACAGGAGTACATTTTGGTGT	Os01g0665200	AK072082	Similar to Blast and wounding induced mitogen-activated protein kinase.
5689	67	79	Os01g0772200|mRNA|AK103491|CDS+3'UTR	GGGACTCGATATATTCGTGTCCATCAGAGTTTAGAAACAAGGATGTTGAAATTTGTGTGT	Os01g0772200	AK103491	Transcription initiation factor IIF, beta subunit family protein.
5690	67	80	Os08g0215300|mRNA|AK121156|CDS+3'UTR	AATTGTTACTCATGAATTTGTTATTGCTGAAACTGTGGTATGGAACCCTACAATGCAATG	Os08g0215300	AK121156	Conserved hypothetical protein.
5691	67	81	Os03g0747900|mRNA|AY374515|CDS+3'UTR	TGTTAATGCAAAGTTGAAAACATAATTAAACAGGTTCCGCTATTTTGTGAAGTTCCTCGG	Os03g0747900	AY374515	Similar to Myosin heavy chain class XI E1 protein.
5692	67	82	Os10g0459500|COMBINER|CI271143|6	TCCGTTGTTACAATTGCCAGGAGTATGGTCACTACTCTTGGGAGAAGAAGTGCCATGAAA	Os10g0459500	CI271143	(No Hit)
5693	67	83	Os09g0545000|mRNA|AK069882|CDS+3'UTR	GAAGACTAGATCAAATTTTGTATTCAGTAAAATTCGGGGAAAAAGAAACGACGAAATAGT	Os09g0545000	AK069882	Sodium/hydrogen exchanger family protein.
5694	67	84	POsControl0037|art		
5695	67	85	Os04g0420600|COMBINER_EST|Os04g0420600|8	CAATGAGTGAAGTTGTTCAATATCTCGAAGGTCTTCTTGAAGTTGGCATACCCCCAGTGC	Os04g0420600		Curculin-like (mannose-binding) lectin domain containing protein.
5696	68	1	Os06g0218200|mRNA|AK120566|CDS+3'UTR	GTGGCCTACAATGAACCTATGAATTGTATGGTTGATGAATTAAGATATTTGGATGGGACG	Os06g0218200	AK120566	Zinc finger, SWIM-type domain containing protein.
5697	68	2	Os10g0569200|mRNA|AK067998|CDS+3'UTR	TTACGGACCAATGTATTCGAAGATGAAAATTTGCGGTTGGCATACTAATTTTAATGTGTC	Os10g0569200	AK067998	Translation initiation factor eIF-3b family protein.
5698	68	3	Os10g0578600|mRNA|AK119822|CDS+3'UTR	CTTCTCACACTCCTTGTAAATACTTTTAGTGCCACTATAAACAGTGAAATTGACATTGTC	Os10g0578600	AK119822	Conserved hypothetical protein.
5699	68	4	Os03g0823700|mRNA|AK061336|CDS+3'UTR	TTTGCCTTTTTGGTGGTATTATCCATTCCAACTTATGAACTGAACAGCTAATATATCTCC	Os03g0823700	AK061336	Similar to Ras-related protein Rab11C.
5700	68	5	Os07g0682800|mRNA|AK066262|CDS+3'UTR	TTTTTTGTACCATTGAAAGTAAGACGAGCCTGTCATTCTTTTCTTGATCTATACTACTCC	Os07g0682800	AK066262	Similar to Apyrase-like protein.
5701	68	6	Os03g0655100|COMBINER|CI460225|x	TCTCAAAGTCTTGATCTCATAGATTTTCCGTAGGGAGGGCGGTAATTAGTGCTGTCTCGA	Os03g0655100	CI460225	Protein of unknown function DUF1637 family protein.
5702	68	7	Os11g0514400|COMBINER_EST|Os11g0514400|8	AGATCTCAGGCTGAGGCCAAGATCGGGACTTATTTTCTCACGCATGCTGGAAAATGGGAG	Os11g0514400		Similar to Somatic embryogenesis receptor kinase 1.
5703	68	8	Os03g0129400|mRNA|AK063857|CDS+3'UTR	CATTATTTGGTCAATTGTTCAGATCGGGGATTAGATGCGAAAGAACTACAGAGCGTGGAA	Os03g0129400	AK063857	Hypothetical protein.
5704	68	9	Os07g0591300|COMBINER_EST|Os07g0591300|8	CTCCAAACCCGCTTGGCCCCGTTGTTGCTCATGTCCCTGCCAAGTTCGGCGATCCAGACA	Os07g0591300		Galactose oxidase, central domain containing protein.
5705	68	10	Os10g0563200|mRNA|AK072816|CDS+3'UTR	TGGTGCCAGACTAGGCTGCTCCACCTGCGCTGTAACTTTGTAAATGTACTGATTACTATA	Os10g0563200	AK072816	Armadillo-like helical domain containing protein.
5706	68	11	(+)E1A_r60_a22		
5707	68	12	Os03g0673400|COMBINER|CI552706|x	AACCTGTGAACGGTGATGTATTTTCGTTTTCGATCAGTTGGGAGTAATATTATTTGTATG	Os03g0673400	CI552706	(No Hit)
5708	68	13	Os06g0701100|mRNA|AK099927|CDS+3'UTR	GGTGAGGAGGGAGGAGTCTTTTACTTTTATTATATCTATTGTTAAAACTATGTATGACCG	Os06g0701100	AK099927	Eukaryotic initiation factor 4A (eIF4A) (eIF-4A).
5709	68	14	Os03g0372500|mRNA|AK122180|CDS+3'UTR	AGACACTTCCCTATTTCTAAGGGAGCTTAAAAGCTTGATCATGAATGAATGATCCATGTT	Os03g0372500	AK122180	Similar to TA11 protein (Fragment).
5710	68	15	Os06g0148700|mRNA|AK064526|CDS+3'UTR	TTACATGTAGATAGGCTGATGGATGATGCTTAAATAATGTTAGTACTCCCTCCGTATTTT	Os06g0148700	AK064526	Cyclin-like F-box domain containing protein.
5711	68	16	Os02g0462000|mRNA|AK062950|CDS+3'UTR	TGTTTGCTAGCACTTATTTTCTTGTTATCAGAAAGGAAACAAATGGCATTCCATAATTCC	Os02g0462000	AK062950	Conserved hypothetical protein.
5712	68	17	osa-miR399c|Os05|5'seq	CGGCGAATTACAGGGCGGTTTCTCCTTTGGCACGTACGGAGGCAAGGCATGCGGTGAAAA			miRNA
5713	68	18	Os06g0203600|mRNA|AK121461|CDS+3'UTR	ATACACAGGAGTGACAGGTTGTATAGTACATGAGAAATTCAGATGCCTCTTCCATGAGTA	Os06g0203600	AK121461	Conserved hypothetical protein.
5714	68	19	Os03g0822200|mRNA|AK069405|CDS+3'UTR	CATCGTTTCCTGAAAACTCCTATTGAAATCAGTGAATTGTTCAGACAAGACACAAATTGA	Os03g0822200	AK069405	NAD-dependent epimerase/dehydratase family protein.
5715	68	20	osa-miR164f|Os05|5'seq	TGAGGATGGCGAGGCGCGCGAGGTGGAGAAGCAGGGCACGTGCATTCCTAGAGCTTCCGT			miRNA
5716	68	21	Os04g0579200|mRNA|AK100603|CDS+3'UTR	AAGAACAGGAGGCGCCTTCAACTGTACATAGGCAAAAATGAGTAAAGCAAACCCCCCAAA	Os04g0579200	AK100603	Zinc finger, RING-type domain containing protein.
5717	68	22	PZmControl0003|mRNA|X12539|3'UTR		
5718	68	23	Os03g0297400|mRNA|AK101597|CDS+3'UTR	TATTTACAGCCTGCTGTTCAGATTTAACCAAGATATGAACGTGTGAATGTGTGATAACTC	Os03g0297400	AK101597	Malonyl CoA-acyl carrier protein transacylase family protein.
5719	68	24	osa-miR439c|Os07|Mature	TGTCGAACCGCGGTTGTTCGATGTCGAACCGCGGTTGTTCGATGTCGAACCGCGGTTGTT			miRNA
5720	68	25	Os01g0133100|mRNA|AK109801|5'UTR+CDS	AATATCAGCATGCTGCTGCAATGTCAACTGTTAAATTTATGGTTTTTGCCATTTGCCTTT	Os01g0133100	AK109801	Conserved hypothetical protein.
5721	68	26	Os08g0328600|COMBINER|CI427330|3	GGAAGATGTTGAAACTCTGTTTGATTATGCTATTTTGCTACGTTGAGACAATTTATGCTG	Os08g0328600	CI427330	Cyclin-like F-box domain containing protein.
5722	68	27	Os08g0449400|COMBINER_EST|CB680897|7	AACTAAGGTGGTCTACGTAAAGAGAAGTTCTGATGATAAGGTATTGTTCTTTTCTGATTC	Os08g0449400	CB680897	Conserved hypothetical protein.
5723	68	28	Os05g0540300|mRNA|AK070127|CDS+3'UTR	ATTGATACTGTGAAAGCTGCAATATTTTACTATGCATTTTGGCAATAATTTTGCCTGCGC	Os05g0540300	AK070127	Similar to Chaperonin CPN60-2, mitochondrial precursor (HSP60-2).
5724	68	29	Os07g0573400|mRNA|AK121705|CDS+3'UTR	ACTGCACTTGTTAAGTTGAATTCAATTAATTAAGCTGTTGGTGCATGTGTGTGGCCTTTG	Os07g0573400	AK121705	Protein of unknown function DUF239, plant domain containing protein.
5725	68	30	Os03g0108500|mRNA|AK108704|CDS+3'UTR	ATCCTACAATTAAAGATGGAAATTCCACATGAGTATGACCCATGACTGGGGCATGTAGCC	Os03g0108500	AK108704	Similar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment).
5726	68	31	Os06g0724600|mRNA|AK073850|CDS+3'UTR	TGTTGGATTGGATGATGGAACCGAATGGATCATGTGAGTTAATCTACTAGTACAGTATTA	Os06g0724600	AK073850	Similar to Transformer-SR ribonucleoprotein (Fragment).
5727	68	32	Os07g0558200|mRNA|AK064484|CDS+3'UTR	TCCATTGACACGTCCTCCAGCTACGAATTTCAGTAGATGGCCTGTAGTTGGATTCTTGTT	Os07g0558200	AK064484	Inositol monophosphatase family protein.
5728	68	33	Os07g0463100|mRNA|AK121807|CDS+3'UTR	TTGCGCTGTACTTTGGAACTATAATTGTCTGGTTTCATGGACTTTTTCAGATTATTGTGA	Os07g0463100	AK121807	DNA-directed RNA polymerase, 14 to 18 kDa subunit family protein.
5729	68	34	Os03g0337700|mRNA|AK065183|CDS+3'UTR	AGTGAACAGTAGTGATAGGACTACATAGTATTCAAGTAGGAGTATGCAGAAAGCATCGCA	Os03g0337700	AK065183	Protein of unknown function, ATP binding family protein.
5730	68	35	Os07g0193600|mRNA|AK070547|CDS+3'UTR	AACCTGATTAGATTGGTACATCTGTGTGCAGTTGATGACCTGATACTACTGAGCTAGTAG	Os07g0193600	AK070547	Conserved hypothetical protein.
5731	68	36	Os01g0227200|mRNA|AK103247|CDS+3'UTR	AGAGTTCTCGGTAGCTGCAATTCACTGCTTCTTTTCACTGAATTTTTCCTGTGCACCTTT	Os01g0227200	AK103247	Similar to Somatic embryogenesis receptor kinase-like protein.
5732	68	37	Os03g0703000|mRNA|AK105026|CDS+3'UTR	GTCTAGTGAACTTGTAGAAGTGTACTCTTGATGTGTGATCGATCTTGAGTAATCAATGTT	Os03g0703000	AK105026	Similar to Beta-glucosidase.
5733	68	38	Os01g0229700|COMBINER_EST|Os01g0229700|8	ATCAGTCAAGATATGGAGCAGCTCGAACTACAGCCTGGTCGGGACGATACCGTCGTCGGT	Os01g0229700		U box domain containing protein.
5734	68	39	Os01g0682200|COMBINER_EST|Os01g0682200|8	TCTATCCAAGGGATCATGGACAGTAGACATTGTTGGTGATTTCTGGCTGTGGATGGAGTT	Os01g0682200		Similar to GPI transamidase component GAA1.
5735	68	40	Os05g0188900|COMBINER_EST|Os05g0188900|8	GAAGGGGATTAATAAGATTGGGAAGATACGCAAAACGATAGCCCAGCCGTACGACAATAG	Os05g0188900		Similar to Acid phosphatase.
5736	68	41	Os05g0134000|mRNA|AK058276|CDS+3'UTR	TGCAAGGAAGGATGTTGCACACTTTGTATGGCAATGTTCGTTCGGTCCAAATATTTGGAC	Os05g0134000	AK058276	Similar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1).
5737	68	42	Os10g0112600|mRNA|AK099727|CDS+3'UTR	TTTGTAAGAATTCAGAGGAGCAACCTCTTGAATATTATAGCCTGAAAGCTTGATCCGAAA	Os10g0112600	AK099727	Nonaspanin (TM9SF) family protein.
5738	68	43	Os05g0305100|mRNA|AK099553|CDS+3'UTR	AGCGACCTATACTTGCAAGTTGTATATTAAAACAGGCCTCGAAGAAAAAGGAAAATTTTG	Os05g0305100	AK099553	Similar to Transcription factor IIIB 90 kDa subunit (TFIIIB90) (hTFIIIB90) (B- related factor 1) (BRF-1) (hBRF) (TATA box-binding protein-associated factor, RNA polymerase III, subunit 2) (TAF3B2). Splice isoform 2.
5739	68	44	Os09g0453000|mRNA|AK120561|CDS+3'UTR	TGTCCATTTGTGCATAACTGATTACTTTCTGAAATGATCCTTAACATTGGTACGTGTTTG	Os09g0453000	AK120561	Protein of unknown function UPF0220 family protein.
5740	68	45	Os04g0631000|COMBINER_EST|Os04g0631000|8	GAGAAGGCAGCATGCAAATTAGCGGAGGAGAACAACATCAGCCTCATCACCGTGTTCCCG	Os04g0631000		NAD-dependent epimerase/dehydratase family protein.
5741	68	46	Os04g0503600|mRNA|AK068552|CDS+3'UTR	ATTATGGCTTTTGGGATGCTATGTTGTATTCGTGTGCTGTAACCAGATCTTAAGGCAATG	Os04g0503600	AK068552	Protein kinase domain containing protein.
5742	68	47	Os02g0157400|COMBINER|CI327621|6	CTCTTCAAGGCATATTAATTTTCCAACTCTATGAACAGAGTTGAAGACAAGAATCTAGCT	Os02g0157400	CI327621	(No Hit)
5743	68	48	Os08g0127900|mRNA|AF051153|5'UTR+CDS	CGCGACGAGCGGGAGCGCGAGGCTGCAGGTGGTGAGCAGCGAGGGGCGGCGGGTGTTCGA	Os08g0127900	AF051153	Similar to Globulin 1 (Fragment).
5744	68	49	Os09g0451000|mRNA|AK104933|CDS+3'UTR	TGCGGCGTGCTGTACCGTGTACGGTTTATTATCTACTCCAGTTCTATATCGTGGTGATTT	Os09g0451000	AK104933	Similar to 1-aminocyclopropane-1-carboxylate oxidase 1 (EC 1.14.17.4) (ACC oxidase 1) (Ethylene-forming enzyme) (EFE).
5745	68	50	Os07g0510800|mRNA|AK058358|CDS+3'UTR	GAGGGCTAAGAGAGAAGAGGGTGTCGAAAGTGTAAACACAAAACACAAAACTATTCCCCA	Os07g0510800	AK058358	RNA-directed DNA polymerase (Reverse transcriptase) domain containing protein.
5746	68	51	Os09g0544900|mRNA|AK071684|CDS+3'UTR	CTACCGCAAGTGGTGGGTTGCCATTGTAATGATAACAAGTGCTCTGCACCTATCTTCAAA	Os09g0544900	AK071684	Glucose/ribitol dehydrogenase family protein.
5747	68	52	Os04g0466100|mRNA|AK064543|CDS+3'UTR	TCAGCTTCATGTTAATATTTGAGAACGCATGCTTAATTATTTAGACGATGATGACAACGG	Os04g0466100	AK064543	Similar to Cell division protein FtsH-like protein.
5748	68	53	Os02g0625000|mRNA|AB103094|CDS+3'UTR	GTTTATTTTTGCTTTTTGTGACACATTCTGTAACTAGCTGAGAACTGAGCTGACACGGTT	Os02g0625000	AB103094	Similar to Deoxyribodipyrimidine photo-lyase (EC 4.1.99.3) (DNA photolyase) (Photoreactivating enzyme).
5749	68	54	Os08g0105000|mRNA|AK102260|5'UTR+CDS	TAAGTGGTACTGTACATTTTGCAAGATCCGCAGGGCAGCGGAAGGAATGCATAAGTATGA	Os08g0105000	AK102260	Zinc finger, PHD-type domain containing protein.
5750	68	55	Os02g0182800|mRNA|AB007627|CDS+3'UTR	AGATTCGGATTGGATATGTTCTCTGTTTTGATGCACGATGCAGTGTTGAGGTGTAACATG	Os02g0182800	AB007627	Similar to NTH23 protein.
5751	68	56	Os07g0598200|mRNA|AK066942|CDS+3'UTR	GTGGTGTTTATTTAGCTTAATTGGACTGTCAAAAATATAAAACTGGTGCTCATCACATGC	Os07g0598200	AK066942	Conserved hypothetical protein.
5752	68	57	Os11g0491900|COMBINER|CI069346|6	TCTGTAAAGTGTTATGCTAATAGAATAAATGAGGAAGGGGTGAGCTGAGAAGGCTAACCC	Os11g0491900	CI069346	(No Hit)
5753	68	58	Os05g0349400|mRNA|AK107832|CDS+3'UTR	ATGCATGTGAGGTTCTACGCATGCTTTAATAAACTCTTTAGTTGTCGATAAATGATCTTG	Os05g0349400	AK107832	Conserved hypothetical protein.
5754	68	59	Os05g0371100|COMBINER_EST|Os05g0371100|8	CATAATGTCAAGGGGCTGCTGCAACTGATCCGTCATTCATTGGAGTGTATCAACCATGAA	Os05g0371100		Zinc finger, CW-type domain containing protein.
5755	68	60	Os03g0186900|mRNA|AK062232|CDS+3'UTR	AAAGATCTTCATCATTTGCATCGCTAGAAAAACTTCATATGAGAATACCAAATCAAGGGC	Os03g0186900	AK062232	Radc1.
5756	68	61	Os03g0201500|COMBINER|CI562391|x	TTGGACGGCCGATCCTTTTCCCATGGCCATTAGCGTATGATTGTTTTTCTATCGAGATGA	Os03g0201500	CI562391	(No Hit)
5757	68	62	Os08g0367400|mRNA|AK103789|CDS+3'UTR	TCGCATTGCCCACCGTTAATTCTTATTCTTCTCCAATTAACCCGCTTGGACACTGAATAT	Os08g0367400	AK103789	Conserved hypothetical protein.
5758	68	63	Os04g0520900|mRNA|AK068793|CDS+3'UTR	ATGACGTGTCTACCAGGGAGGATTTACATAATTAGAGTCGGGGACTTTTTTGGGGCCTTT	Os04g0520900	AK068793	Protein prenyltransferase domain containing protein.
5759	68	64	Os11g0198200|mRNA|AK103223|CDS+3'UTR	TTTCTCCTTTGGTTTGTAACTTGTTTCAGTGTGACATACTGATCAATAAAGCATCTGAAG	Os11g0198200	AK103223	Conserved hypothetical protein.
5760	68	65	Os04g0616100|COMBINER_EST|Os04g0616100|8	CATCTTGTGAACAGAAGTTCAGGTTTCAGGATTTGAAACCTGGCTGGCAAATCCCCAAGT	Os04g0616100		Tetratricopeptide-like helical domain containing protein.
5761	68	66	Os07g0122000|mRNA|AK102508|CDS+3'UTR	GATGTTCTTGCCCTAGAAGTCTAATGTACCAGCCTTGCTCATTCGATGTGTCTGGTTTCA	Os07g0122000	AK102508	Protein of unknown function DUF1719, Oryza sativa family protein.
5762	68	67	Os07g0515100|mRNA|X81394|CDS+3'UTR	TCCTCCCTTTTGTAAGTTGTTTCTGCAAGTACACACAATAAAAGAGCATTTTTGCACCTC	Os07g0515100	X81394	Calcium-dependent protein kinase, isoform 2 (EC 2.7.1.-) (CDPK 2).
5763	68	68	Os06g0295500|mRNA|AK073219|UTR	ACATAAGCAGTAGTCGTTCTTAATCTATCTTATGTAGTATGAAAACCTGAACTTTGGTCC	Os06g0295500	AK073219	Conserved hypothetical protein.
5764	68	69	Os05g0155300|mRNA|AK069217|CDS+3'UTR	ATCACTGCTTTTATCTAATCCTTGTATATGCCGAGCCTTTCTTATCTAAGCAGAGCTGAT	Os05g0155300	AK069217	Similar to HIRA interacting protein 5.
5765	68	70	Os07g0568800|mRNA|AK111260|CDS+3'UTR	CCCTCTGTCCTCTAATACAAGAGATTTTAATATTTTACATGTACTGTTTAATTACTTATC	Os07g0568800	AK111260	Conserved hypothetical protein.
5766	68	71	Os08g0363200|mRNA|AK064067|CDS+3'UTR	ATGAACAATAATCATCTTGATTTTCCTCCATCAATGTTCATGTTACTTGCTGTTGGTATT	Os08g0363200	AK064067	Conserved hypothetical protein.
5767	68	72	Os10g0515200|mRNA|AK105678|CDS+3'UTR	AGATGCATGATTAGTGGTGAAATGTAAAAATAGCCGGTGTAATTAAGGTGTTCCTATTGA	Os10g0515200	AK105678	Cytochrome P450 family protein.
5768	68	73	Os03g0777500|mRNA|AK062835|CDS+3'UTR	GGGAATATTGGTTGTTGTGTATGATGATGGTAATAAAGGAATTGTAGTCCAAGTGCATCT	Os03g0777500	AK062835	Protein of unknown function DUF1068 family protein.
5769	68	74	Os07g0176900|mRNA|AK067117|CDS+3'UTR	AAGCAGGCAATAAGATGCTTCACTAATAATAATTGAATATATTTCCCCACTCTTTCATTG	Os07g0176900	AK067117	Similar to Ribose-5-phosphate isomerase precursor (EC 5.3.1.6).
5770	68	75	Os01g0729100|mRNA|AK068733|CDS+3'UTR	TTTGTGGATGTAGTTATCTGTGTCAATCCTTCTGGTATATCCATAGTTCGGTTTCTTGTA	Os01g0729100	AK068733	Protein of unknown function DUF92, transmembrane family protein.
5771	68	76	Os03g0795500|mRNA|AK101877|CDS+3'UTR	TAGCTTGTGTTTGTTTGCCTGTCTTAGTTAACTGGGAACCAAACTTGTGGTCATTCGGTC	Os03g0795500	AK101877	Protein of unknown function DUF1000 family protein.
5772	68	77	Os01g0513700|mRNA|AK068877|CDS+3'UTR	CATCTGTTGAACTGCACAAAGTTGTTGATGTTGAGTGTTCGTTTTGAAAATTGAGATCTA	Os01g0513700	AK068877	Sybindin-like protein family protein.
5773	68	78	Os03g0684000|mRNA|AK105025|CDS+3'UTR	CGCCTGTAAAGTTGTACCAACTGATCCTTGTACAGTTTGTATTAATGTGTCGTCTCTGTC	Os03g0684000	AK105025	Similar to GATA transcription factor 1 (AtGATA-1).
5774	68	79	Os03g0610800|mRNA|AK107194|CDS+3'UTR	CATGATGTATGTGAGGTTTGTGTAATGGCTGAGTTAATAAATGAGATGAGACTCGCTGGT	Os03g0610800	AK107194	Similar to Protein zx.
5775	68	80	Os01g0267100|mRNA|AK065023|CDS+3'UTR	CAGGATGGTTCAGCTTCCAGAAATTTGGCAACGCTCCATTTCAAAGAAAATCATTCAGTA	Os01g0267100	AK065023	MT-A70 family protein.
5776	68	81	Os04g0492400|mRNA|AK072530|CDS+3'UTR	GCTAAGTAAAGAAATCAAATTGTAATGAACCTTCTGCATACCGAAATTATACGGTGATGG	Os04g0492400	AK072530	Conserved hypothetical protein.
5777	68	82	Os12g0170800|mRNA|AK059809|CDS+3'UTR	CGTGGAGTACTATGCACATGCCTATATGTATGGTTGTGTATGTCAATTTTGTTTCATCTA	Os12g0170800	AK059809	Similar to Citrate binding protein precursor.
5778	68	83	Os03g0587000|mRNA|AK071149|CDS+3'UTR	GCATCGAAGATTCGAAGTAGCTTAATCAGAATTTTGAACCGAATGTTCAGATGGATTGTG	Os03g0587000	AK071149	Similar to L-galactose-1-phosphate phosphatase.
5779	68	84	Os09g0133200|mRNA|AK109426|CDS+3'UTR	CTATATGTACAAGGACCGATGTTAAACTGCTTAAATCGTGACCGGAACTTTTTTCGTTGC	Os09g0133200	AK109426	Similar to Dehydrogenase/reductase SDR family member 4 (EC 1.1.1.184) (NADPH- dependent carbonyl reductase/NADP-retinol dehydrogenase) (CR) (PHCR) (Peroxisomal short-chain alcohol dehydrogenase) (NADPH-dependent retinol dehydrogenase/reductase) (NDRD) (SCAD-SRL) (humNRDR) (PSCD). Splice isoform 2.
5780	68	85	Os04g0430700|mRNA|AK105112|CDS+3'UTR	CTCACCAGGATACTGATATTGCACGTGTATTTTTGTACTCTCTGCTTCTGAATTCTAGTT	Os04g0430700	AK105112	Proteinase inhibitor, propeptide domain containing protein.
5781	69	1	Os02g0189900|mRNA|AK063528|CDS+3'UTR	TCGCGTTCTGATGAAATGGAGATCAACACTTCAATTTTCAAAGGCAAATCCAATTCGATC	Os02g0189900	AK063528	Hepatocellular carcinoma-associated antigen 59 family protein.
5782	69	2	Os05g0426400|mRNA|AK061637|CDS+3'UTR	CACTATACATGCATAGAAACAGCTTGTGTAGGTTGCCATGCTTAGGCCTTTCCAACACAC	Os05g0426400	AK061637	Conserved hypothetical protein.
5783	69	3	Os05g0102000|mRNA|AK064690|CDS+3'UTR	TGTTTGTGTTGTAATTAACATATATAAATCTGTTGTGACTGGAATGGATTTTAAACCTCT	Os05g0102000	AK064690	SAM dependent carboxyl methyltransferase family protein.
5784	69	4	Os08g0234400|COMBINER|CI441328|x	GCGCCAGTAGATGTCTAGCTAGCACTGTGGTTCTTCAGTATTTTGTAACCCATGTTGTCA	Os08g0234400	CI441328	Conserved hypothetical protein.
5785	69	5	Os01g0606200|COMBINER_EST|Os01g0606200|8	GCCCTTCCGAACCATCGACGAGTGCAATAGCAACTGCCCGGTTCCTCCGGCCAACGCTTA	Os01g0606200		Conserved hypothetical protein.
5786	69	6	Os09g0437100|COMBINER|CI213992|6	AATAAGATTTTAGGGATCAATGTATCCATGTACTCTCCACCATTGTATAAACTTCATGAT	Os09g0437100	CI213992	Auxin responsive SAUR protein family protein.
5787	69	7	Os10g0130200|COMBINER_EST|Os10g0130200|8	GCCGTCTTCCCGGTTCCGATGGAAGCACCGGGTGCAGGCAAGCATGTATAGGCATAAATA	Os10g0130200		Cyclin-like F-box domain containing protein.
5788	69	8	Os09g0406000|COMBINER_EST|CI343198|1	GCCCCAGCTGACAAGTTTAAGTTGATGGATGAATCCTTCAAAGTGGCTGTTATGCAGGTA	Os09g0406000	CI343198	Conserved hypothetical protein.
5789	69	9	Os04g0629600|mRNA|AK070709|CDS+3'UTR	TCGAAATACTGTAAGGCAGGTATATCCATCATCTTTGTCATCTACAACTGCCTTAGCTAT	Os04g0629600	AK070709	Similar to Transposase of Tn10 [Oryza sativa (japonica cultivar-group)].
5790	69	10	Os01g0963000|mRNA|AK104277|CDS+3'UTR	TATGTACACTTGCGTGTATTTTGTAGCTTATTTTTTATTTGCAAATAAAGTTGAATATAT	Os01g0963000	AK104277	Similar to Peroxidase BP 1 precursor.
5791	69	11	Os03g0410900|COMBINER_EST|CI415959|0	GTTGATGTTCTTGTTGTACCTTGTCCTTAACTGATGTGTGGAATATTGACTTCGTTTCTT	Os03g0410900	CI415959	Like-Sm ribonucleoprotein, core family protein.
5792	69	12	Os02g0473200|mRNA|AK101185|CDS+3'UTR	CAAACAGGGTTGGACTAACACGAGCTTTGAAAAGCATACATTTAGAAGTAAATTCAATGT	Os02g0473200	AK101185	Peptidase A1, pepsin family protein.
5793	69	13	Os10g0327800|mRNA|AK100836|CDS+3'UTR	GAAGAGATAACCTGCTTCATCCCGTTAATGCATCTCCATCAATGGTGGATGTTTGAAATG	Os10g0327800	AK100836	Conserved hypothetical protein.
5794	69	14	Os07g0684900|mRNA|AK063503|CDS+3'UTR	TAATGCATGTGTACTTCTGTGGCCATACATATATATATAGAGAGAGAGGGGATTAATTAC	Os07g0684900	AK063503	Homeodomain-like containing protein.
5795	69	15	Os04g0552200|mRNA|AF261273|CDS+3'UTR	AGAGCTGCTTCTAGTGACGTCTCTTGCTTGGTTATAACTTAACCGAATTCTGCGTTGCGA	Os04g0552200	AF261273	Beta-expansin 5.
5796	69	16	Os04g0175500|COMBINER_EST|Os04g0175500|8	GGCGGTGGCATGAACGGGAAACGCGTCAAGCAGCTGGCCGGCGTGCTGTTCGGGTACAGC	Os04g0175500		Transferase family protein.
5797	69	17	POsControl0038|art		
5798	69	18	Os01g0936200|mRNA|AK101890|CDS+3'UTR	CAAAATTGTTCATGCGTCAGAAGAGGATTGGGAGATGCTTGCTGTAAATGTGGTTTGGTA	Os01g0936200	AK101890	Lipase, class 3 family protein.
5799	69	19	Os10g0514500|COMBINER_EST|Os10g0514500|8	TTCACCACCGTCATGGCAAAGCCACTTCGCGCTCAGCTCGTGCGCAGGAGGATGAATTAA	Os10g0514500		Cytochrome P450 family protein.
5800	69	20	Os11g0582400|mRNA|U25969|CDS+3'UTR	AGTACACTTGTGCTTGGAAGAGGTGTATGTATGAGATAAATAAAGTGGCGTTCGCGAAAA	Os11g0582400	U25969	Conserved hypothetical protein.
5801	69	21	Os05g0453900|COMBINER_EST|CI261991|6	GACAGAGCCTATGTGAAAATCAAAGAACATATGCTGTCTCAGCTGTGAAGGTATGATGCA	Os05g0453900	CI261991	"GINS complex, PSF1 component family protein."
5802	69	22	Os11g0149300|mRNA|AK062442|CDS+3'UTR	TGGACTCTTTGGTACTGAGGCAGCTGATTGTATCACTTACATTTAATATCTGAGAATGGA	Os11g0149300	AK062442	Hypothetical protein.
5803	69	23	Os01g0874700|mRNA|AK105447|CDS+3'UTR	CTGTACATTGCATCTCTGGATTCTCATGGACATGTTAAATTTAGAAGTACTTGTCATCAT	Os01g0874700	AK105447	emp24/gp25L/p24 family protein.
5804	69	24	Os02g0448400|mRNA|AK064509|CDS+3'UTR	TCCCCCAGATTCTCACTGGTTGGTATATATGATTATGAACAGAAACCAGGAAGCCTGAAC	Os02g0448400	AK064509	Similar to Synaptotagmin C.
5805	69	25	Os12g0178000|COMBINER_EST|CI443684|6	GAAGAGAACATTTCAGTGCAGTTGTGGGTATAAAATAAATATGTATAGTAGGATTGGCAG	Os12g0178000	CI443684	Aldehyde dehydrogenase (EC 1.2.1.3).
5806	69	26	Os04g0403200|mRNA|AK120702|CDS+3'UTR	TAAAGAAAACCCCCGATTGTATTCTCGATGAAATACATGCATGCACCAGGTCTAGCCTTA	Os04g0403200	AK120702	Zinc finger, RING-type domain containing protein.
5807	69	27	Os08g0366000|mRNA|AY187619|CDS+3'UTR	AGGGAATTGCTGCTGGAATGCAGAACACCGGCTAAGCGAACTATCAACTATGAAGTGCCT	Os08g0366000	AY187619	Phosphoenolpyruvate carboxylase.
5808	69	28	Os06g0299300|mRNA|AK067625|CDS+3'UTR	ATGTGATGCTAAAGAATTGCCAACAAATAAATAATGTGTCTTCGAAAAGTGCAATTGCCG	Os06g0299300	AK067625	Glucose/ribitol dehydrogenase family protein.
5809	69	29	Os11g0656500|mRNA|AK072370|CDS+3'UTR	CTCTCTTCTAAGTACAAAGTTCAGTTAAGCTATAGGTTTCCATGGTAACTAGCATGGAGG	Os11g0656500	AK072370	Reverse transcriptase, RNA-dependent DNA polymerase family protein.
5810	69	30	Os10g0567400|mRNA|AK062219|CDS+3'UTR	GCATGTCACGCTATGATGCATATATATGATCATACTATTGATTATTGAGCCATGAAGAAC	Os10g0567400	AK062219	Rieske [2Fe-2S] region domain containing protein.
5811	69	31	Os01g0360200|mRNA|AK065117|CDS+3'UTR	TCATGTGAATTATATGGTTTCTAATATATATAAAGTTGGACAAAATAAATGAAATGATGG	Os01g0360200	AK065117	Similar to Respiratory burst oxidase homolog.
5812	69	32	RC1		
5813	69	33	Os10g0108100|COMBINER|CI180458|6	TCCCACCTCTATAAATAGTTAGGTACCCCTTCTTGGGTTTCTTGGGTTTTGATAGATTAA	Os10g0108100	CI180458	(No Hit)
5814	69	34	Os08g0558900|mRNA|AK060402|CDS+3'UTR	TTCATCTGCTCTGGTTTCCGGTGCTTGTTCATGATTGAATGAGGCTCTATTGTGTTGGAC	Os08g0558900	AK060402	Similar to F1F0-ATPase inhibitor protein.
5815	69	35	Os01g0936100|mRNA|AK101371|CDS+3'UTR	AACCAAATCTGATTGGTGTGGCAGTGCTCTTCGCATTGTTGCTATCTGCAGAAGCTATCT	Os01g0936100	AK101371	Similar to Protein kinase.
5816	69	36	Os01g0977600|mRNA|AK060263|CDS+3'UTR	TATTATGTTTTGTCTTACAAATTTAATGAAGGTTAGATAAAAATATGTAGTTCATGTGTC	Os01g0977600	AK060263	Armadillo-like helical domain containing protein.
5817	69	37	Os01g0971400|mRNA|AK106011|CDS+3'UTR	AAGATTGTTTGTCTCTCATTATTTTTCATCGGTGAAAATTAAAGATGGTGATGGATAGAT	Os01g0971400	AK106011	Similar to Cysteine proteinase.
5818	69	38	Os03g0843300|mRNA|AK060923|CDS+3'UTR	ATACTGGTTGTGAGGGCGAATGCTGTTCAGGAACCTGTTCCAATGGTAAACTGAAGAATG	Os03g0843300	AK060923	Late embryogenesis abundant protein 2 family protein.
5819	69	39	Os07g0693700|mRNA|AK111591|CDS+3'UTR	CCAGGCATGACATTTACATGTACTGATTGCTGATTGCCATTGATTCATATTCATTGTGTG	Os07g0693700	AK111591	WD40-like domain containing protein.
5820	69	40	Os11g0615700|mRNA|AB026561|CDS+3'UTR	TGCTTGTTTTCAGCAGTGTTGAGACCATGTACTATCAAAAAGAGAACGACAATCCTTTCC	Os11g0615700	AB026561	Proteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5).
5821	69	41	Os01g0516600|mRNA|AK063717|CDS+3'UTR	TTAGTTACCCAAATTTGAACTTTCATGCTGAATAAATTTGCCCTATATATTACCTTTCGA	Os01g0516600	AK063717	Similar to Stable protein 1.
5822	69	42	Os11g0701400|mRNA|AK106319|CDS+3'UTR	AAGTATTGAATAGGGCTTAATTTCTAGCTATATGGAATAATGTAATCCCATGTCGCAATT	Os11g0701400	AK106319	Chitinase (EC 3.2.1.14) III C10150-rice (EC 3.2.1.14).
5823	69	43	Os09g0454500|mRNA|AK111065|CDS+3'UTR	GGAAGTGCTAGCTAGCACGGTAGCACCCATGTCCCCACAAATGCAAAATACGTTCCCACG	Os09g0454500	AK111065	Carbonic anhydrase, eukaryotic family protein.
5824	69	44	Os03g0826700|mRNA|AK104387|CDS+3'UTR	CTTTCCTGTACACATTCTTATATGTGGAGAAATGGTGAAACACTGAAATGCTATACATCG	Os03g0826700	AK104387	SAM (and some other nucleotide) binding motif domain containing protein.
5825	69	45	Os10g0335200|mRNA|AK073900|CDS+3'UTR	CCTGCACGCTGCAGTTAATTGCTCTGTGACATTTGCCATTCCTATGTTCCTGGAAAATCA	Os10g0335200	AK073900	HNH nuclease domain containing protein.
5826	69	46	Os01g0378100|COMBINER_EST|CI013682|6	CGCTGCGCGCACAACCATTATTAGTTGTTGTATCCTAATTATTGTTATGCGTCGAATACA	Os01g0378100	CI013682	Haem peroxidase, plant/fungal/bacterial family protein.
5827	69	47	Os10g0459400|COMBINER_EST|CI271143|6	TCCGTTGTTACAATTGCCAGGAGTATGGTCACTACTCTTGGGAGAAGAAGTGCCATGAAA	Os10g0459400	CI271143	Conserved hypothetical protein.
5828	69	48	Os05g0593300|mRNA|AK106591|CDS+3'UTR	AATCAGGAGGATAAAGTGTAACCCTGTAATTGCTTCAACTACAACTTGGTGAATGCAAAA	Os05g0593300	AK106591	Conserved hypothetical protein.
5829	69	49	Os10g0392700|mRNA|AK109292|CDS+3'UTR	TATTTCTTTTCTACATGTGAAATGTCTAGTCTGTCACTACCAATACCATGCACTGACTGT	Os10g0392700	AK109292	Initiation factor 2B related family protein.
5830	69	50	Os07g0562700|mRNA|AK068972|CDS+3'UTR	GGGGTTTGCAACTTATGTGTCAGCTGCTGCTTTAAGCTTAGTTAACTCTTTTGATGTTTT	Os07g0562700	AK068972	Similar to Type III chlorophyll a/b-binding protein (Fragment).
5831	69	51	Os03g0775500|mRNA|AK121695|CDS+3'UTR	ATGCTGCTTGAGTGCTTGATGTACCATTCGTATATAAAGAGAGAGAAAAAGGAGAATTAT	Os03g0775500	AK121695	Protein of unknown function DUF59 domain containing protein.
5832	69	52	Os05g0169100|mRNA|AK066128|CDS+3'UTR	GAAGCTATCTTGTGTTGAACATCTTTATCTGAAATATATATCAGATGACTTTCGTGTCGC	Os05g0169100	AK066128	Similar to 60S ribosomal protein L10 (QM protein homolog).
5833	69	53	Os08g0198700|mRNA|AK060371|CDS+3'UTR	GACCAACCATATGTACATTAGAAAGTACGAACAAGATGTGCACATTATCCTTATCGTCGC	Os08g0198700	AK060371	Similar to Glycolate oxidase (EC 1.1.3.15) (Fragment).
5834	69	54	Os11g0582400|mRNA|AK073083|CDS+3'UTR	AGTACACTTGTGCTTGGAAGAGGTGTATGTATGAGATAAATAAAGTGGCGTTCGCGAAAA	Os11g0582400	AK073083	Conserved hypothetical protein.
5835	69	55	Os07g0480900|mRNA|AK063422|CDS+3'UTR	TAGTTGGGTTGTATGTCGATCTACTACTAGTGAATACAGAATAACAAAAAGTTATGGACG	Os07g0480900	AK063422	Similar to Cysteine protease (Fragment).
5836	69	56	Os07g0685000|mRNA|AK065816|CDS+3'UTR	TTCTGCTGATCCTTCAGCTCTGTGATCAATGGCCCATATATTTACCTGACAAGTTTCAGA	Os07g0685000	AK065816	Similar to Dof3 gene (Fragment).
5837	69	57	Os03g0293900|mRNA|AK072637|CDS+3'UTR	ACTTGTCAAGAAGCAGCGATAGATTCAATGGAGGCATTAGCACTTGGATGGTCTTACAAG	Os03g0293900	AK072637	Similar to RuBisCO subunit binding-protein alpha subunit, chloroplast precursor (60 kDa chaperonin alpha subunit) (CPN-60 alpha).
5838	69	58	Os03g0808000|COMBINER_EST|Os03g0808000|8	TGCCACAGGAAGTACTTGCCAGAATGCAAAATGGAGGAAATCTGGAACAGTTGTTCCACA	Os03g0808000		Similar to Polygalacturonase B (Fragment).
5839	69	59	Os12g0591100|COMBINER_EST|Os12g0591100|8	CCTCCCTCTTCACTGAGTTTAAAACCAGTCTGAACGTCCGCTGCACCGATGCTCAGACTG	Os12g0591100		Conserved hypothetical protein.
5840	69	60	Os02g0148100|mRNA|D21288|CDS	GCCATTGATCTTTTACAGAAGATGCTCATATTTGATCCTACCAAAAGAATCAGTGTCACC	Os02g0148100	D21288	MAP kinase MAPK2 (MAP kinase 3).
5841	69	61	osa-miR395l|Os08|Mature	GTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAACTCGTGAAGTGTTTGGGGGAA			miRNA
5842	69	62	Os05g0169800|COMBINER_EST|Os05g0169800|8	CCGCCAGTTCGACATCACCCTCCTCATTTGGAAGGACCCGAAGCAGGGTCACTGGTGGCT	Os05g0169800		Protein of unknown function DUF239, plant domain containing protein.
5843	69	63	Os12g0150200|mRNA|AK064287|CDS+3'UTR	TTAAATAGGCATGTACATAGAACAAAAAAGGGAGAAATCAATATACCAAATTTTTCATCT	Os12g0150200	AK064287	Cytochrome P450 family protein.
5844	69	64	Os10g0454300|mRNA|AK073080|CDS+3'UTR	GTAACATGTAACAAATTAGGAGAGATATTGCATAACTGTGGTGAAAATTATATTATTTAA	Os10g0454300	AK073080	Eggshell protein family protein.
5845	69	65	Os02g0702800|mRNA|AK071767|CDS+3'UTR	CATCAACGCCCTCACACTTCAGTGGCTTGGGTTTCATACGTGGAATAAATATGGATTGTG	Os02g0702800	AK071767	Similar to Syntaxin 22 (AtSYP22) (AtVAM3).
5846	69	66	Os03g0188900|mRNA|AY554032|CDS	GACGCCCTCGCCGCCGAGATTCGGGAGCTGAGGGAGAAGCTGCCCACCAAGCCGGCGGAC	Os03g0188900	AY554032	Similar to HAHB-7 (Fragment).
5847	69	67	Os03g0823500|mRNA|AK099193|CDS+3'UTR	AAATTGTAAGGATTATGTCGTTCGTCCATGTATATGCTTAATCTGCTTGTGATTGCCATC	Os03g0823500	AK099193	TGF-beta receptor, type I/II extracellular region family protein.
5848	69	68	Os01g0316900|mRNA|AK070437|CDS+3'UTR	GGTTTAGCCATACCTTTTTCTTTTGGGCTGCCAGACTAAATAGTACAGTTATCTTGTGCT	Os01g0316900	AK070437	Conserved hypothetical protein.
5849	69	69	PGmControl0001|mRNA|AF035253|3'UTR		
5850	69	70	Os06g0609700|mRNA|AK067228|CDS+3'UTR	ACCGCTCTCATTACTGTGCCCACAGTGTAAAAGTGTGAAATGAGCATGTCAGTTGCATGA	Os06g0609700	AK067228	Esterase/lipase/thioesterase domain containing protein.
5851	69	71	Os01g0208000|mRNA|AK108020|CDS+3'UTR	ACCAGCAACCGTGGCAGCGGAGTGGATTTTAAACTCCGTTCTCTTGTTTTTGCATATCAC	Os01g0208000	AK108020	Protein of unknown function DUF6, transmembrane domain containing protein.
5852	69	72	Os02g0286900|COMBINER_EST|AU096746|6	CTAGGAAGAGAAGAAAAGCCCGTCCACATAAGCAGGCATATGTTTCTCAAACTTTTTATT	Os02g0286900	AU096746	Uncharacterized Cys-rich domain containing protein.
5853	69	73	Os03g0659900|mRNA|AK067560|CDS+3'UTR	CTCCTGTGTGTTCTACAAAAGAATTGTGTAGCTTGTCAATGCAATTTTGTGCTGACAAAT	Os03g0659900	AK067560	Similar to S3 self-incompatibility locus-linked pollen 3.15 protein.
5854	69	74	Os01g0743300|mRNA|AK069026|CDS+3'UTR	GAGCAAAGCTTTGGAAAGTAAACTGTATCAAAATAGGACTCGAGGGAATAAAGGGTACAT	Os01g0743300	AK069026	Protease-associated PA domain containing protein.
5855	69	75	Os02g0158100|mRNA|AK058991|CDS+3'UTR	TGATGAAGGAATATGTTGTCAAGGCGAGACATGGACGGTTTTCTACTTTACCTGCCCATC	Os02g0158100	AK058991	Dynamin family protein.
5856	69	76	Os01g0179500|mRNA|AK105394|CDS+3'UTR	GGTGCAGCCCGGCATTTTCTGCATAACGATGATATATCCATGTCTTCTCATTGTTGTGAC	Os01g0179500	AK105394	Conserved hypothetical protein.
5857	69	77	Os03g0291500|COMBINER_EST|CI197925|6	AACTCATCCTTGAAACGATACACCGTAATTAATATATCTCCTCATTTTTCGCTGTCAAAA	Os03g0291500	CI197925	Asparagine synthase domain containing protein.
5858	69	78	Os12g0485000|mRNA|AK099965|CDS+3'UTR	CCTGAAATTCAAAATGCTTTGTATACTTCAAACAGAGGCTGTGTTTAGTTCTACACCAAA	Os12g0485000	AK099965	Peptidase M22, glycoprotease domain containing protein.
5859	69	79	Os04g0644400|mRNA|AK105778|CDS+3'UTR	TTGTACATGTAGTGGCTCCGGAAATTGTCATCAATTGTACTGTATGCATGTATTGTAAAA	Os04g0644400	AK105778	Similar to Proline-rich-like protein.
5860	69	80	Os06g0186300|COMBINER_EST|Os06g0186300|8	CAAGGCTCGGTCGGATACATCGCGCCTGGTACGTGCACGTCGCATGCATCCATGCATCCA	Os06g0186300		Protein kinase-like domain containing protein.
5861	69	81	Os06g0282000|COMBINER|CI563293|x	GTCTACTTTGAGTCTCCAATTGGATTCGTATCATTTAACCATAATACAATATATTTTTAT	Os06g0282000	CI563293	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
5862	69	82	Os03g0210400|mRNA|AK065966|CDS+3'UTR	AGCACATGATTTGTATAGCACCTCGTGACATTTTCCTGCTAGCATAATGGTCCATTGTTT	Os03g0210400	AK065966	Protein prenyltransferase domain containing protein.
5863	69	83	Os10g0530900|mRNA|AF309376|CDS+3'UTR	AGCTATATATTTAATATATAGCGCCATGTTCTTCATAATAAAAGGGCTATTTTAAGCTGT	Os10g0530900	AF309376	Similar to Glutathione S-transferase GST 30 (EC 2.5.1.18).
5864	69	84	Os01g0924600|mRNA|AK060620|CDS+3'UTR	GTGCCCTCAGGTTTTTACAGGAGAGATTGTACAGGACAGTGCAAAATGGTCAGCATGTTT	Os01g0924600	AK060620	Hypothetical protein.
5865	69	85	Os01g0747400|mRNA|AK102467|CDS+3'UTR	TGTTTCGTCTGTTACACTGTTTGATACAAGTGACAGAAATGTCTCTATGCAATTCCTTGA	Os01g0747400	AK102467	Protein kinase-like domain containing protein.
5866	70	1	Os04g0492400|mRNA|AK099916|CDS+3'UTR	ACGGTGATGGCATTAGTCAGAGCACGATACCAGAAATATTTACGAACTGTTACTACTTGC	Os04g0492400	AK099916	Conserved hypothetical protein.
5867	70	2	Os05g0312500|mRNA|AK069307|CDS+3'UTR	GAGGTATTCTGAATGCTGAAGACCATACTAATTAGCAGATTAATTCATTTTGGTCCTTTC	Os05g0312500	AK069307	Reticulon family protein.
5868	70	3	Os05g0412500|mRNA|AK106959|CDS+3'UTR	TGATGTGCTTGTGTACTTCGGTTCTCGGATGTTGAGCGATGAATGTTCGATTGTGACGTG	Os05g0412500	AK106959	Conserved hypothetical protein.
5869	70	4	Os02g0127500|mRNA|AK120793|CDS+3'UTR	AGCTGGTGTACTCTCTCAGCGATTTGTAATTCTTGTGTGATAATTAAGTGAATTTGTTCC	Os02g0127500	AK120793	Conserved hypothetical protein.
5870	70	5	Os03g0792800|COMBINER_EST|CI533188|0	GCGCCGCCGTGCTAGCGCTGCTGGCTTTGTTCCGTTTGTTCTTGCTGCATTAGCATTGAT	Os03g0792800	CI533188	Glycoside hydrolase, family 17 protein.
5871	70	6	Os01g0183800|mRNA|AK106385|CDS+3'UTR	CTGTCGCTAATTTCATAAAAGTATTGGGCATATCTATAGCACTTCTGTAGATAAATCAAC	Os01g0183800	AK106385	Protein of unknown function DUF295 family protein.
5872	70	7	Os11g0655300|mRNA|AK074002|CDS+3'UTR	AGGACACCATAATAATCCAGTTTTCAGACACGAGCAATGGAATGATCTTCACTGAAGCTT	Os11g0655300	AK074002	Disease resistance protein family protein.
5873	70	8	Os08g0110200|mRNA|AK068841|CDS+3'UTR	GATGGGAGATTTCTCTCTCTCTCTCTCTAGCATGAGTTTTTCAGAAGCTCTTTTGCTTGC	Os08g0110200	AK068841	Similar to Fertility restorer.
5874	70	9	Os08g0229200|mRNA|AK121274|UTR	TGGTGAAACATTTTCGTAGTAGCGCTGAAAGAGCGCCCAATTTTTTATTTTTTGATGTTT	Os08g0229200	AK121274	Non-protein coding transcript, unclassifiable transcript.
5875	70	10	Os10g0580300|mRNA|AK066824|CDS+3'UTR	TTGCTCCTAGTCGTACAGTGAGAATTGTATCTGTTCTGTTGTAATTGAACGCCATCACAA	Os10g0580300	AK066824	Protein kinase-like domain containing protein.
5876	70	11	Os08g0276400|mRNA|AK102100|CDS+3'UTR	CCTGCTCCTTACTAACAATGTTACTACTACCATTGAGTCATGACACATGGAAGATAGCTC	Os08g0276400	AK102100	Protein kinase-like domain containing protein.
5877	70	12	Os12g0235800|mRNA|AK071066|CDS+3'UTR	GATTTTGACTTGGTTGTCTAAATTGCAATAAGATTGTCTCATGTGGTGCCGTCGTTGTGT	Os12g0235800	AK071066	Similar to Argininosuccinate synthase (Fragment).
5878	70	13	Os12g0571800|COMBINER|CI245770|6	CCAAACAGGCCATTTGTATTAAGAGTGGTGCACACATAATAAAAATAAATTAGGTACAGC	Os12g0571800	CI245770	Conserved hypothetical protein.
5879	70	14	Os05g0578500|mRNA|AK062591|CDS+3'UTR	TAAACCTAGCTAGATAGAACTTGTACAGTACAAAACATGAATATGGATAGAAATTAGAAG	Os05g0578500	AK062591	NAD-dependent epimerase/dehydratase family protein.
5880	70	15	osa-miR156k|Os09|5'seq	TTGAGAGTGATGACAGAAGAGAGAGAGCACAACCCGGCAGCAGCGACGACGGCGGTCGCT			miRNA
5881	70	16	Os06g0562300|COMBINER_EST|CI125137|6	ACCAAGACTGAATAGTTTCATGCAGATAGTTCCAGTCCAAAGGCAGGGATCTGCCTCATT	Os06g0562300	CI125137	POX domain containing protein.
5882	70	17	Os05g0506900|mRNA|AK106697|CDS+3'UTR	CTCTAGTTTTTGCCTTTGTAATGAATTCCACAACAATATTGAGCATGCTGGACTTAACAT	Os05g0506900	AK106697	Brix domain containing protein.
5883	70	18	Os05g0305200|COMBINER|CI435307|0	CATGACAATGATGGTAAACTGGCTAAATCTCGGGATGTAAGATCTCTTACTAATGTTGTA	Os05g0305200	CI435307	TRAF-like domain containing protein.
5884	70	19	Os01g0912700|mRNA|AK068528|CDS+3'UTR	GATTCTCCAGGTCAAGCTTTTGTGTATCAGTGTATGCATATATGTGTGTGTATCTATTTC	Os01g0912700	AK068528	Conserved hypothetical protein.
5885	70	20	Os01g0886600|mRNA|AK070098|CDS+3'UTR	CTAGTACATGATATGGTGCCATTTTCCTGACATGATAAGCCATCAACTGGGACAGCAAGT	Os01g0886600	AK070098	Similar to CLP protease regulatory subunit CLPX precursor.
5886	70	21	Os07g0604400|COMBINER_EST|CI481328|1	TGGTAAAGAAATTCTGTAAGTGGAGGGGATATGAGCATAATTTTGGGAACATATTTGTAC	Os07g0604400	CI481328	Similar to BRITTLE CULM1.
5887	70	22	Os06g0264600|COMBINER_EST|CI142641|6	TGTGAATTGTGAATTGTGGGCTATGCCAATATCAAATCTTCTCTGGAATTGGCACACCAG	Os06g0264600	CI142641	Similar to Acylphosphatase (EC 3.6.1.7).
5888	70	23	Os05g0324000|mRNA|AK103719|CDS+3'UTR	TTTGATGTACTTAAAACCATTGATTAGCTTGCAGCTAAGTTATGCTGTACATGTGTCTTG	Os05g0324000	AK103719	Conserved hypothetical protein.
5889	70	24	Os04g0518400|mRNA|AK067801|CDS+3'UTR	CTGCTGTTGATGTAAGTTAAAGGGTGTAATTTGTGATACTTTTCCATGGTCAATTCGTGA	Os04g0518400	AK067801	Similar to Phenylalanine ammonia-lyase (Fragment).
5890	70	25	Os02g0116900|mRNA|AK121401|CDS+3'UTR	TCTGTTATGTATGATCTCTGGGAGTGATGTTTCCATTTTACTATCAGTTATTCATGTGTG	Os02g0116900	AK121401	Similar to 15.9 kDa subunit of RNA polymerase II.
5891	70	26	Os01g0362100|mRNA|AK065319|CDS+3'UTR	ACCCCCAAATAGGCCATTATACAAGTGTATAGTAAAGTAGAACAGATATATCTGAACAGT	Os01g0362100	AK065319	Esterase/lipase/thioesterase domain containing protein.
5892	70	27	Os02g0617500|mRNA|AK106578|5'UTR+CDS	AGGGAAGGCTTTGGTTCCATGTTGTTGGTGCAAATGGGAAAAGGAAGAAGCGTATTCAAA	Os02g0617500	AK106578	DEAD/DEAH box helicase, N-terminal domain containing protein.
5893	70	28	Os06g0291000|COMBINER_EST|Os06g0291000|8	CACGTGCTGTTCATCTCATCCGTGACCATGCACTGGTGGAGAAACCATCTTTCGTCGGTC	Os06g0291000		Hypothetical protein.
5894	70	29	Os09g0551600|mRNA|AK066658|CDS+3'UTR	GATGTTGCTGCCTTTAGCTTTTAGTCTTAGAGGTCTCCTCCTGTAGCTTAGCTCTCATGT	Os09g0551600	AK066658	Similar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101).
5895	70	30	Os03g0839400|mRNA|AK111413|CDS+3'UTR	ATATCAAAACCATAAAAGTTGTAATGGCATGTATCCAATTAACCATTAAAAATATATTTT	Os03g0839400	AK111413	Conserved hypothetical protein.
5896	70	31	Os01g0300600|mRNA|AK058273|CDS+3'UTR	TTTATGCTACTATGTTGTAGATAAACACGTTGGCATTTGCTTCGGGCATAGTTACTGCCT	Os01g0300600	AK058273	Borrelia outer surface lipoprotein family protein.
5897	70	32	Os04g0636400|mRNA|AK099573|CDS+3'UTR	AATCAACAGGACATAGCAAACCAATTCCATTCTTTTCTGATCATAAAGAGATGTACATCC	Os04g0636400	AK099573	Similar to Senescence-associated protein 6.
5898	70	33	Os06g0660700|mRNA|AK121998|CDS+3'UTR	CGGCGTTTGGGTTAAACAGAGAAGAATGTGTGTTGTGACTGTTGGTGTACCATACTGTCT	Os06g0660700	AK121998	Similar to Ubiquitin-conjugating enzyme E2S (EC 6.3.2.19) (Ubiquitin-conjugating enzyme E2-24 kDa) (Ubiquitin-protein ligase) (Ubiquitin carrier protein) (E2-EPF5).
5899	70	34	Os08g0170800|mRNA|AK106559|CDS+3'UTR	ATGAAGTGAGGAAATCTCTGATGATGTCAATGATAATTTGCTAGAAAGTTGTTCAAGGTC	Os08g0170800	AK106559	Conserved hypothetical protein.
5900	70	35	Os01g0152000|mRNA|AK103666|CDS+3'UTR	TGAAAATTCAAATCATACCTGTAATCACACATGAAAATCAGATTATGAGATTGCGCCACG	Os01g0152000	AK103666	Protein kinase-like domain containing protein.
5901	70	36	Os03g0858100|mRNA|AK100745|CDS+3'UTR	GTTTATAGATCGGCCGCATTCTGTATTGTGGACAAGATTCAGGATAGAAACTTATATTCG	Os03g0858100	AK100745	Similar to CRM1 protein (Fragment).
5902	70	37	Os01g0769700|mRNA|AK101775|CDS+3'UTR	TACTTATTGGCTTTGTATTGTACTCTACCGCTGGTATTAACCACCAGTTGATCTCTATTA	Os01g0769700	AK101775	Similar to Resistance protein candidate (Fragment).
5903	70	38	Os07g0147900|mRNA|AK061177|CDS+3'UTR	AGCTTCTGCTTGACATGGTGAATAAAATGAAGCATATGCTAATTTTGACTTAGTATTGTG	Os07g0147900	AK061177	Similar to Ferredoxin-NADP reductase precursor (Fragment).
5904	70	39	Os07g0501100|mRNA|AK110924|CDS+3'UTR	TGGAAGTGACCTTGAACCCAAAAGTGTGGAGTAGCTATAATCATGGTCATGCATGCCATT	Os07g0501100	AK110924	Similar to Chalcone synthase 2 (EC 2.3.1.74) (Naringenin-chalcone synthase 2).
5905	70	40	osa-miR399g|Os02|3'seq	TGATGCTTCCATTTGATCCCATCCCTATCTGCCAAAGGAGATTTGCCCAGCGATTCACTC			miRNA
5906	70	41	Os03g0349800|COMBINER_EST|CB658589|7	ACTTCGTTCCACTTTTATATCTAGAAGAAGAGAATTGACCCAGTTTATAAGGATAACCGG	Os03g0349800	CB658589	Conserved hypothetical protein.
5907	70	42	Os01g0875300|COMBINER_EST|Os01g0875300|8	AGTTCGTCGAGCAATGCATCAACCAGGCTGAGTGCCTGACGTTGGCAGTGAGGAAGCAGA	Os01g0875300		UspA domain containing protein.
5908	70	43	Os05g0185900|COMBINER|CI071175|6	GGAAAATCTGCGGCAGCGGGCTTGTCATGGGTTAAGTGATAACAGATGTCTGGAAATATA	Os05g0185900	CI071175	(No Hit)
5909	70	44	Os11g0701600|mRNA|AB027426|5'UTR+CDS	TCGTGTCCTGCCTCGCCGCGCCGGCGACGGCCGACTGGTACGGCCCGCTCGCCGTCTACT	Os11g0701600	AB027426	Glycoside hydrolase, family 18 protein.
5910	70	45	Os04g0211800|COMBINER|CI250750|6	GCATGTGGAATTTTCTTGGATTCTACATGTCAAAATATGCTAACAGGATTTTTAGTGGAA	Os04g0211800	CI250750	(No Hit)
5911	70	46	Os08g0191700|mRNA|AK104866|CDS+3'UTR	TGCATTGCTACCTGTATCAGCATGACTGTTGGAGTGTTGTTGATAACAAGGACCAGTTTG	Os08g0191700	AK104866	Similar to Lactoylglutathione lyase (EC 4.4.1.5) (Methylglyoxalase) (Aldoketomutase) (Glyoxalase I) (Glx I) (Ketone-aldehyde mutase) (S-D- lactoylglutathione methylglyoxal lyase).
5912	70	47	Os03g0273800|mRNA|AK067356|CDS+3'UTR	TCCTGTAGTATATATATGTATCGGTCAGATCTTTGCATGTAAATTAGTACTCCTAGAAGC	Os03g0273800	AK067356	Pyrimidine 5-nucleotidase family protein.
5913	70	48	Os04g0265300|COMBINER|CI281545|6	AGTCGAAAAGATAATCTTCTCTCGAACCAGATTACTCCAAAGCCGAGTGCTTCAATCAAA	Os04g0265300	CI281545	(No Hit)
5914	70	49	Os09g0436300|mRNA|AK103151|CDS+3'UTR	TTCAAGGGGATTCTTGATCCATTTCAGGCATGTGTTGACATGAAAAGGCCTCTTCACTCC	Os09g0436300	AK103151	Peptidase, trypsin-like serine and cysteine domain containing protein.
5915	70	50	Os02g0828500|mRNA|AK105163|CDS+3'UTR	TGTATGGTATTGGTATGTACTCTAATGAAGTATGGAATAAATGTTAAATGGGCCGGAAAG	Os02g0828500	AK105163	Tetratricopeptide-like helical domain containing protein.
5916	70	51	Os10g0167700|mRNA|AK121180|CDS+3'UTR	AACCAACCTGACTCGTATGCGATATTGTTTTCTTGCGTGAACCTGGTAAACCTGGACTCT	Os10g0167700	AK121180	Conserved hypothetical protein.
5917	70	52	Os02g0204700|COMBINER|CI195072|6	ACCAAAGCTCTGTTTTCGGTGATCCAATTTGTGCAGGCATACCTGGCCTACAACAACTTA	Os02g0204700	CI195072	Cytochrome P450 family protein.
5918	70	53	Os01g0235300|mRNA|AK102961|CDS+3'UTR	CTCGAGTGCTCGATTCAGACTGATCTTGCATGTCATTGTGTGGCTAATGTGATGTTTCCA	Os01g0235300	AK102961	SOUL heme-binding protein family protein.
5919	70	54	Os09g0538400|mRNA|AK104408|CDS+3'UTR	TGTCTCTGTTGTAATTACCATATATTGACTAATCATGACAAATAATACTTGATGCTAAGT	Os09g0538400	AK104408	Similar to P-type R2R3 Myb protein (Fragment).
5920	70	55	Os12g0117500|mRNA|AK109861|CDS+3'UTR	ACTTAGAAGAACAAATTGTATATTGACGACTTGACGTGCAATATTTTTACGTGTTAGCGG	Os12g0117500	AK109861	Similar to RPT2-like protein.
5921	70	56	Os02g0317400|mRNA|AK061254|CDS+3'UTR	ATACTTGTACTCAGATTTATCTCATCAAGTGCTAATGATAGTTTCCATGATTGCTTCTGC	Os02g0317400	AK061254	Clathrin adaptor complex, small chain family protein.
5922	70	57	Os12g0160000|mRNA|AK064766|CDS+3'UTR	GACGACGTTGATCTCCACTTCCTCTCCTCCATTGCTTCCGCTTGATTTTGAGATTTCCGC	Os12g0160000	AK064766	Hypothetical protein.
5923	70	58	Os04g0380200|mRNA|AK067334|CDS+3'UTR	AATGCTTCAGCTGGAAACGACAAAAAGAAGTTTTGAAGTGGCCGCTTATTGTGCTGTAAA	Os04g0380200	AK067334	Conserved hypothetical protein.
5924	70	59	Os06g0196300|mRNA|AK068635|CDS+3'UTR	ATCTCTCATGTATGATCCATCACAGTATACCGAGAAATTAATCCATCTGTTAATCTCTTC	Os06g0196300	AK068635	Similar to Peroxiredoxin Q (Fragment).
5925	70	60	Os01g0607800|mRNA|AK058392|CDS+3'UTR	ATATTCCTCCTGTAAAGTGTCAACTCATTGTACATATCTTTCTGAACAACTATACACAGC	Os01g0607800	AK058392	Protein prenyltransferase domain containing protein.
5926	70	61	Os09g0267500|mRNA|AK073706|CDS+3'UTR	TCCTACAATGTAGAGCCAGAATTTAACTATTTGTATGTAGCGATACACAGAATGCAATCA	Os09g0267500	AK073706	WD-40 repeat containing protein.
5927	70	62	Os10g0159800|mRNA|AK065882|CDS+3'UTR	GTGAGTGTGGGTGTGCAGTCGCGAGAATTGAGCACACGATTGGTTACATACATGCTCGAG	Os10g0159800	AK065882	Alcohol dehydrogenase superfamily, zinc-containing protein.
5928	70	63	Os01g0966500|mRNA|AK071603|CDS+3'UTR	CTATGTGCACTTTTCATGTGAATACTCCTCACATGATCTATGGGCAACCTGTCAGCCATC	Os01g0966500	AK071603	Vacuolar protein sorting 55 family protein.
5929	70	64	Os11g0414000|mRNA|AK071277|CDS+3'UTR	CTGATCCTAATAGTCTACTGAATGTTAAAATCCCATGCAAGAAGTTATTCCAGGATTTGC	Os11g0414000	AK071277	eIF4-gamma/eIF5/eIF2-epsilon domain containing protein.
5930	70	65	Os06g0700500|mRNA|AK104088|CDS+3'UTR	AAGATGTTGCATGGTTTGCAGTTGAAAGAGCAGTCAAATTTGTTCCTCACTGCGCTGTTC	Os06g0700500	AK104088	Protein of unknown function DUF266, plant family protein.
5931	70	66	osa-miR438|Os06|Mature	TTCCCACGCGTTATAGTGAAATTCCCACGCGTTATAGTGAAATTCCCACGCGTTATAGTG			miRNA
5932	70	67	Os01g0702400|mRNA|AK121315|CDS+3'UTR	CATAATGTAACAACCCGTGTAACATGTGACATCTGTAACTCTTGGCAATAAAGCGGGCAA	Os01g0702400	AK121315	WD40-like domain containing protein.
5933	70	68	(+)eQC-41		
5934	70	69	Os01g0261000|mRNA|AK062597|UTR	TGAGAAAAGAAAAAAATAATAATATAAGTAGCACTACTACTCCCCTCGCTTCGCTTCGCT	Os01g0261000	AK062597	Non-protein coding transcript, unclassifiable transcript.
5935	70	70	Os01g0337700|mRNA|AK106939|CDS+3'UTR	ACTCGTCTATTATTATGCACTCATGAAATTTGGTTTGCTGGGGTGTAACCTCTGATCTCT	Os01g0337700	AK106939	Conserved hypothetical protein.
5936	70	71	Os04g0394200|mRNA|AK121002|CDS+3'UTR	TCCATTTTGGGATGTAGTTCCCTAAACAATTTGCTTTTAGTTTCAATGCAAGAGCAATAG	Os04g0394200	AK121002	Similar to 2-oxoglutarate dehydrogenase E2 subunit.
5937	70	72	Os09g0535000|mRNA|AK058712|CDS+3'UTR	TGTGGAAGGCAAGGAATGTTGTGGTGTTGAGCATAATAATCGATGTTGCCGTAGGATCGT	Os09g0535000	AK058712	Similar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase).
5938	70	73	Os11g0559200|COMBINER|CI416245|x	ATCTAATGTGAAGGGTGAGTGTGTGACTGCTTGGTTGTAAGCTATTTCCTGATCTGCCCA	Os11g0559200	CI416245	Protein kinase-like domain containing protein.
5939	70	74	Os01g0168000|mRNA|AK120808|CDS+3'UTR	GGCACTCCGGCGGACGGCGGCGCAGAGGCGATGCCCTTGTGACGGAAAGAGAGACTTACA	Os01g0168000	AK120808	Conserved hypothetical protein.
5940	70	75	Os09g0109800|mRNA|AK058682|CDS+3'UTR	GAAAAGAGGAGCTGCACCTTGTGTAAAATTTGAAGATCCTGAAATCATATCATCACTGGG	Os09g0109800	AK058682	Citrate transporter family protein.
5941	70	76	(+)E1A_r60_a135		
5942	70	77	Os02g0704600|COMBINER_EST|CI435912|1	TACAGGACTGGCTCCATTCCCTCACAGTAAATCCCTCTTTGCATAGTTGGTTGTGCAAAA	Os02g0704600	CI435912	Conserved hypothetical protein.
5943	70	78	Os05g0437300|mRNA|AK102760|CDS+3'UTR	GATATTGTGCTGTTCTAAGAGAGAGTTCTGCCCTGCCATGAACAAATCGTGCCTGTTGAT	Os05g0437300	AK102760	HnRNP-L/PTB/hephaestus splicing factor family protein.
5944	70	79	Os03g0207900|mRNA|AK111888|5'UTR+CDS	ACAAATGCCTTGGAAGTTCATCGAAGTTGGAGGACAGCAATCATTCTGATTCCCCATCCT	Os03g0207900	AK111888	WD-40 repeat containing protein.
5945	70	80	Os01g0524500|mRNA|AY151042|CDS+3'UTR	CGCCGATCGATGATCTTGCAGGGGTTGCAATTAGGGATTGATTTCCATTTTGCTGATGTA	Os01g0524500	AY151042	Similar to Transcription factor MYBS3.
5946	70	81	Os07g0108000|COMBINER_EST|CI444154|3	TGGGTGAGAGGTACTGGGAGCTATGTTCAGCATCATGTATGTGTTGAACCGCTTGTATTT	Os07g0108000	CI444154	Conserved hypothetical protein.
5947	70	82	Os11g0140100|mRNA|AK064682|CDS+3'UTR	ATCTCAAAATAATAATTTAGGGGATTGATTTGGGTGGCTGTTGGCCATGCTCTTAAGCAT	Os11g0140100	AK064682	Mitochondrial glycoprotein family protein.
5948	70	83	Os03g0234200|mRNA|AK059011|CDS+3'UTR	GCTTCAGCTTCTTGTTTTGACGGTCGTGGTATATGGTAATTGGCAGCAAACTATATTGGT	Os03g0234200	AK059011	Ubiquitin.
5949	70	84	Os07g0132500|mRNA|AK060877|CDS+3'UTR	TTATTTGTGCGTGTAACTACTTTTATACCGAGCAGGACACAATATGCTAGCCAGTCCGAA	Os07g0132500	AK060877	Similar to Resistance protein candidate (Fragment).
5950	70	85	Os08g0361400|COMBINER|CI332244|6	TGTATGTAACTTTCAAAAATCTCTCCGTAACATGTTATTTCGGTAAAATGAAGGTCGTGG	Os08g0361400	CI332244	(No Hit)
5951	71	1	Os02g0640800|mRNA|AK061368|CDS+3'UTR	AGCTTGTTTCTCATATCTAGGGGTGGGCATTCGGTCTAATCGAGAAATTCGGTTCGGTTC	Os02g0640800	AK061368	Similar to (-)-isopiperitenone reductase.
5952	71	2	POsControl0038|art		
5953	71	3	Os04g0105700|mRNA|AK104546|CDS+3'UTR	ATATACTTGTACCACCAACATATACTTGAACCAGTTTCCTGGTTGGACAGCTAGTTTTAC	Os04g0105700	AK104546	Conserved hypothetical protein.
5954	71	4	Os10g0484800|mRNA|AB110182|CDS+3'UTR	TCTTGACAGCATCTGTGCACTACATAGTTATTGTTTTACTGTAATCTATGTTTTATGTAT	Os10g0484800	AB110182	Type III polyketide synthase family protein.
5955	71	5	Os02g0698000|mRNA|AK066164|CDS+3'UTR	AGGGTGCTCCTACATCTCTTCTTGACACATTTCAATGTACATCTTCTATATTTCAATGTA	Os02g0698000	AK066164	Similar to Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (PRKase) (PRK).
5956	71	6	Os04g0383700|mRNA|AK063211|CDS+3'UTR	TATCTGTGGCATATGGGGGGCGCCTGAAATTTTTTGTGGTTCTTTGTTTTTTCTTTCTGA	Os04g0383700	AK063211	Conserved hypothetical protein.
5957	71	7	Os03g0747200|mRNA|AK102631|CDS+3'UTR	CCGTGAAACTCGCGGTAATCCGTGGACATGCCTTTAGGAACCTTCGCTCTCCCTAATACC	Os03g0747200	AK102631	Conserved hypothetical protein.
5958	71	8	Os01g0553600|mRNA|AK121792|CDS+3'UTR	CGTATTGCGTATGTGATCAGATAGTTGTTCTAATATAAAATCTTGTCCAAACATTTCCCG	Os01g0553600	AK121792	Conserved hypothetical protein.
5959	71	9	Os07g0479400|mRNA|AK111095|CDS+3'UTR	TCGAACCTGGTAGGGGAATGTGGACACTGCTTAGATTGTAATTGTTCGCTAAAACTTTTG	Os07g0479400	AK111095	Similar to Neuroendocrine differentiation factor.
5960	71	10	Os02g0768600|mRNA|AK104659|CDS+3'UTR	TGAGCAGCGATTGTGTTTGGAACAAGCTTTACAAAGTGAACAATCAGTTTAGAAGTTGAA	Os02g0768600	AK104659	Similar to Chloroplast inorganic pyrophosphatase (EC 3.6.1.1).
5961	71	11	Os01g0717000|mRNA|AK105151|CDS+3'UTR	GATTTTTAGGGGATTTTGGTGGTACCTTTTGTGCTTTGGACGAATAAATCTTTGTTGATT	Os01g0717000	AK105151	Similar to GmCK1p (EC 2.7.1.32).
5962	71	12	Os11g0657300|mRNA|AK062752|CDS+3'UTR	TGTGTGAGAGATCATATTTCGTGAGATAATATACCATTTGCCTGTCGAGATGGATGACGA	Os11g0657300	AK062752	Similar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF).
5963	71	13	Os01g0813900|mRNA|AJ575232|5'UTR+CDS	TAACATGCCTTATATTTCCTCTGGGCCACAGGGAGGGTTATCATACATGGCAACACAAGT	Os01g0813900	AJ575232	Similar to ZIGA1 protein (Fragment).
5964	71	14	Os05g0506000|mRNA|AK122090|CDS+3'UTR	TGTAAACATTCTACAGACTACAAGAAATCCAAGTGTACACTTCACTTGGCTTGTTGGAAT	Os05g0506000	AK122090	Similar to MS5-like protein (Fragment).
5965	71	15	Os02g0102400|mRNA|AK059054|CDS+3'UTR	GGATTGGCAAACCGGCCACAATATGCTGATTTAGAGATAATAAAGTCCTTGAACATGTGT	Os02g0102400	AK059054	Ribosomal protein S5 family protein.
5966	71	16	Os03g0822700|mRNA|AK101448|CDS+3'UTR	GTTTTTGGATATCTGTAATCTGTGATGCTATTAAAATACGAAGATGAAAGATACTTATCT	Os03g0822700	AK101448	Armadillo-like helical domain containing protein.
5967	71	17	ETG05_66023		
5968	71	18	Os10g0450400|mRNA|AK119329|CDS+3'UTR	TGTTGCTTGCATGTACTAAGGTGTGGTCTCTTGCCGTACTATGTACTTTAAACAGCTGCA	Os10g0450400	AK119329	Protein of unknown function DUF594 family protein.
5969	71	19	RC3		
5970	71	20	Os01g0830500|mRNA|AK061475|CDS+3'UTR	TTTGAGCACGAGTGAATCATTCATCGTGTGAAAAAAATATACGAACTGAACCAGGAAATG	Os01g0830500	AK061475	2OG-Fe(II) oxygenase domain containing protein.
5971	71	21	Os12g0597500|mRNA|AK103799|CDS+3'UTR	CTGATGGCATCATCATGAATCTGAATGTATCCTGTGTTCTTGCTTGAATTTTTCTTTTTG	Os12g0597500	AK103799	Amidase, hydantoinase/carbamoylase family protein.
5972	71	22	Os11g0602200|mRNA|AK102379|CDS+3'UTR	ATGCCAGTCGTGCACTCGCCGTATGTTTTTCTGTAATATTAATGGCTACATAATGCATCC	Os11g0602200	AK102379	Similar to SET domain protein SDG111.
5973	71	23	Os02g0510100|mRNA|AK058487|CDS+3'UTR	TCTCTAAAGAAATACTGCCTTACAATATCGTAGTTGCTACATGGAAAGAGATGTTTTCTG	Os02g0510100	AK058487	Similar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
5974	71	24	Os12g0161900|COMBINER_EST|CI081695|6	TGTAGCTATTGGTTTTTGTGATCATCTTGATCTCATGTTGTTCATTGCTATACAATGCTG	Os12g0161900	CI081695	Hypothetical protein.
5975	71	25	Os05g0569400|mRNA|AK100553|CDS+3'UTR	CGGTTCGTTTTAAGCTTATGCCAGAGTCATCTTGTTTGTTTTGGTTTCTGTGATACCAAT	Os05g0569400	AK100553	Aldose 1-epimerase family protein.
5976	71	26	Os06g0491800|mRNA|AK064475|CDS+3'UTR	TGTTTTGTGATGAACTATGTATTTATAGTGTGATGTGTTTTGTGATTGAACTAAGTACTG	Os06g0491800	AK064475	Similar to Transposable element Ac.
5977	71	27	Os06g0493600|mRNA|AK067110|CDS+3'UTR	GAGTTGAAGCGAATTCACTTGTGGAAAAATCCAATCAATCACAATTGTTCTTTTGGCCAC	Os06g0493600	AK067110	Similar to PHO1-like protein.
5978	71	28	Os06g0681300|mRNA|AK110977|CDS+3'UTR	GCGTCTAGATTAGGGACATGTGTAATGTGTCCATGACTGAACAAACTATGCATTGTACTG	Os06g0681300	AK110977	PAK-box/P21-Rho-binding domain containing protein.
5979	71	29	Os04g0616700|mRNA|AK111673|CDS+3'UTR	TATACTCTTATATTTATACTCAAAATTGATAATATAAAGTTGTCACGCACTCATGCCACC	Os04g0616700	AK111673	Protein kinase-like domain containing protein.
5980	71	30	Os03g0583700|COMBINER_EST|Os03g0583700|8	CCAACGGCAAAGAAGCTGGCCTGACTGATGGCATGGAGGTCAACACAGTGATGACAGGGA	Os03g0583700		Proteasome maturation factor UMP1 family protein.
5981	71	31	Os10g0518100|mRNA|AK099843|CDS+3'UTR	CGGCTTGTTGTATTACTTTACACATTTTCATCCTTACGTCATATTTCATCTCTTTTTCAC	Os10g0518100	AK099843	RabGAP/TBC domain containing protein.
5982	71	32	Os01g0718000|mRNA|AK111476|CDS+3'UTR	CTGATCTATGTATGGAGATATGATATATGTAGAGATTGGAAATTGATGATTCTGTGTGGC	Os01g0718000	AK111476	Zinc finger, A20-type domain containing protein.
5983	71	33	Os08g0351300|mRNA|AK068382|CDS+3'UTR	GCCAACAGGTAAAAGAAATACTTAAAACATCCTACCGCTGGGAATCCCAGCTTTGAGATA	Os08g0351300	AK068382	Hypothetical protein.
5984	71	34	Os12g0541500|mRNA|AK062059|CDS+3'UTR	TTTGAGCACTCCTTTGTAGATGACAAGAGAGATCAATATTGTCAATATAAACATTACGGC	Os12g0541500	AK062059	Similar to Chloroplast polyprotein of elongation factor Ts.
5985	71	35	osa-miR171e|Os03|5'seq	TGGTAGCTATGATGTTGGCTCGGCTCACTCAGACGGCATTGGCGTGATGCAAAGCATGCA			miRNA
5986	71	36	Os01g0893400|mRNA|AK061917|CDS+3'UTR	ACTGTGAACATTTGTTGTACTGAAGATTAAAAGGTGTCTCAATTCTAACATGACAATCTG	Os01g0893400	AK061917	BTB domain containing protein.
5987	71	37	Os05g0329200|COMBINER|CI466368|0	AGTGGTTCGGAAGTTAAAAATAAGCTCAGATATCATCATATGTGACATGTGAAACTTTGG	Os05g0329200	CI466368	Similar to Prolamin.
5988	71	38	Os07g0598900|mRNA|AK106521|CDS+3'UTR	ATGTTTGTAAGTTTGCCACTCTCTTGCAAAATGCAAAACGCAGCTACGTGCTGCCAAGGT	Os07g0598900	AK106521	Cobalamin (vitamin B12) biosynthesis P47K domain containing protein.
5989	71	39	Os04g0310500|mRNA|AK121577|CDS+3'UTR	GGCAGCGATTCTATGGTCTATTTTTTCTGTAACTGGTAAAGACATCAGAAAGAAAAACAT	Os04g0310500	AK121577	Mitochondrial ribosome domain containing protein.
5990	71	40	Os04g0105200|mRNA|AK058807|CDS+3'UTR	GTGCACGTGGCTTCGGCTTCCTTTGTTAAGTTTCTTAATTAATTTACAAGATTTGGTAGT	Os04g0105200	AK058807	Conserved hypothetical protein.
5991	71	41	Os01g0851700|mRNA|AK105410|CDS+3'UTR	ACTTGTGAGATGTACTGGATGGAATCTTCCGTCACAAAATAAAACGATTCAAATTTTTGG	Os01g0851700	AK105410	Similar to Cytosolic starch phosphorylase (Fragment).
5992	71	42	Os05g0399700|mRNA|AB012855|CDS+3'UTR	TCTGTGAAAGCCCATATGTATGCATGGTCATGGCATGAATAAAGTAGTACTGATCTTCTC	Os05g0399700	AB012855	Chitinase (EC 3.2.1.14).
5993	71	43	Os01g0777700|COMBINER_EST|Os01g0777700|8	AATGAGTATGGAATAAATGCGAAGCAGAAACTCAAAATTGGTTCAAAGATTGCACGCCGT	Os01g0777700		Conserved hypothetical protein.
5994	71	44	Os09g0293600|COMBINER|CI172118|6	ACTTGTGTTTTTTGTGTGTGATTTGTTCATATGAGATGTGTTCATGTGATGTGTTCTTGT	Os09g0293600	CI172118	(No Hit)
5995	71	45	Os01g0546400|mRNA|AK058673|CDS+3'UTR	TTGTTCAAAGGATCATGGGCTGGATTCTAGTTAGCTATATTTAGTTCTACAATATTTCGC	Os01g0546400	AK058673	Protein of unknown function DUF6, transmembrane domain containing protein.
5996	71	46	Os07g0179400|mRNA|AK073022|CDS+3'UTR	ACCTTTTTGAGGAATTATGTTTGAAACTTGTCCCAGCTTCCAGGGCCCTGTAAAAGTATT	Os07g0179400	AK073022	Cytidyltransferase-related domain containing protein.
5997	71	47	Os01g0673600|mRNA|AK122067|CDS+3'UTR	CAGTATCTGTGGTAGAACTTGGTGCTCCTCCAATATATTTATTACTTTATGTTGGAAAAC	Os01g0673600	AK122067	Similar to Ubiquitin-conjugating enzyme E2.
5998	71	48	Os03g0359100|mRNA|AK073091|CDS+3'UTR	TACTCTGTTTTTCTTAGACTCAGTAGGGGTTTTCGCCAAAATTGCAGATTTCATTTGTGG	Os03g0359100	AK073091	Conserved hypothetical protein.
5999	71	49	Os12g0111600|mRNA|AK120264|CDS+3'UTR	GGACCCTGCTGTTCCGATGCCTTGATTACAATTGATGTCAGTGCAGTGGTATGCTTATTT	Os12g0111600	AK120264	Hypoxia induced protein conserved region family protein.
6000	71	50	Os01g0761400|mRNA|AK105550|CDS+3'UTR	GTGACAATGTGGAACCTTTCCTATGGTTATGCTAATATGAAGCCTATGGTTTGGTTGCCC	Os01g0761400	AK105550	TGF-beta receptor, type I/II extracellular region family protein.
6001	71	51	Os05g0520900|COMBINER_EST|Os05g0520900|8	TGGGCACCGGCGACGGCGGCTCCATCAGCTGCTCCTTTTCTTTTAGACAAGAGTTGTTTG	Os05g0520900		BTB/POZ domain containing protein.
6002	71	52	Os06g0556300|mRNA|AK063985|CDS+3'UTR	TGAAACTGCAGCCTGAACTGAAACACTGCTGAAACTTGTGTGTCCAACAGAGCTCTATGT	Os06g0556300	AK063985	Cyclin-like F-box domain containing protein.
6003	71	53	Os10g0323900|mRNA|AK100089|CDS+3'UTR	GGCTGCCGTTTGAGTTGTGAATCTGGAACAACATATATGTGATTGCCATTGTTTCATTGC	Os10g0323900	AK100089	Profilin A [Oryza sativa (japonica cultivar-group)].
6004	71	54	Os07g0535000|COMBINER|CI139190|6	GGCACGTTAGGGCGCAGGGTAGGAGGGACAGGGGTAAGAGGCCTCGTCAGTAGTGTTCTA	Os07g0535000	CI139190	(No Hit)
6005	71	55	Os04g0589200|mRNA|AK068571|CDS+3'UTR	TTAGTTTATCGCAATGCTCGTGTTATGGAATCCGGACTGCTCGCAATGACGGTCATCAAC	Os04g0589200	AK068571	Conserved hypothetical protein.
6006	71	56	Os12g0223300|mRNA|AK073017|CDS+3'UTR	ACTCTTACATGTAAATGGCGATGGCTGCATCAGTAAAATGTATGGATGGGGCATTTTCCC	Os12g0223300	AK073017	Similar to Outer membrane cytochrome b(5) (Fragment).
6007	71	57	Os05g0108800|mRNA|AK064821|CDS+3'UTR	TGGTCCTGGGATGTCCACTTCGGTAAAGATCGATAAGATTCAAAGTACTCGTTAATCGTT	Os05g0108800	AK064821	Cytochrome b5.
6008	71	58	Os01g0134700|mRNA|AK111442|CDS+3'UTR	TTGTCTTTTCAAGTTCGCGTCTGTATAACTGTGTTCAAGTGACACGAAGGTTAAGGGTAG	Os01g0134700	AK111442	Calmodulin binding protein-like family protein.
6009	71	59	Os01g0872500|mRNA|AK066692|CDS+3'UTR	TGATTTTCTTTTTTCAGGGGTGGTTGTACAATTTGTGGACTGTGAAAGTTATGGCAGTTA	Os01g0872500	AK066692	TGF-beta receptor, type I/II extracellular region family protein.
6010	71	60	Os11g0286400|mRNA|AK070927|CDS+3'UTR	CAGCAGCAATGACAAGGCCATCTGTAACCATGTAGCCAGCATTTGTTTCCTTCCTCATAT	Os11g0286400	AK070927	Hypothetical protein.
6011	71	61	Os02g0550000|COMBINER_EST|CI049918|3	TCTCAAAGAAAATGCTGTATCGGTCTTAGTTTAGCGTTGGTACTCAGGTTGTTGGGGGTG	Os02g0550000	CI049918	Conserved hypothetical protein.
6012	71	62	Os06g0691400|mRNA|AK107208|CDS+3'UTR	CACGTGGCGTTGACGTGGCATTGATGTAAGATTAGATTTAAAAATATATATGTGGGATCA	Os06g0691400	AK107208	Similar to IAA-amino acid conjugate hydrolase-like protein (Fragment).
6013	71	63	Os10g0495600|COMBINER_EST|CI537868|3	GTTTTGTTTCATGAAAAGGCAGAGTCTGTTGTATCAAAACATCAATGATTATACCAATTT	Os10g0495600	CI537868	Similar to DNA-directed RNA polymerase I polypeptide 2 (EC 2.7.7.6) (RNA polymerase I subunit 2).
6014	71	64	Os08g0143800|COMBINER_EST|Os08g0143800|8	CTTGAAAATCAGATGCAATCCAGATTTAGAGACCTCGTCATCTCCACAAGGTGTGAAAGA	Os08g0143800		FAR1 domain containing protein.
6015	71	65	Os07g0251500|COMBINER_EST|Os07g0251500|8	GACCCCGAAAGCCGGCCTGAGGAAGCTCTGAGTCCCTGCGGTGGATCTCTACAAGGTGAA	Os07g0251500		Conserved hypothetical protein.
6016	71	66	Os03g0111600|mRNA|AK101020|CDS+3'UTR	ATTAATCGTTTGAATTTTTGAGATTGAAAGTTTCATTAAATTTGAGATTGAATATATTTT	Os03g0111600	AK101020	Protein of unknown function DUF1618 domain containing protein.
6017	71	67	Os02g0313700|mRNA|AK072366|5'UTR+CDS	ATCTGCTGAATATGAGCCAGTAGACATTGAAGGACTGGAAAAGGTTGATGTTTGGGTCCA	Os02g0313700	AK072366	Similar to Synaptotagmin C (Synaptic vesicle protein O-p65-C).
6018	71	68	Os01g0348900|mRNA|AK105034|CDS+3'UTR	ATTGTCTGTGTACGTGTTGCACCGATCCGTAGTACAATAAAGTTGGCGATATATATGTTG	Os01g0348900	AK105034	SalT gene product (Salt-induced protein).
6019	71	69	Os12g0193800|mRNA|AK111754|CDS+3'UTR	GTCTTCTTAGATGGTTTTGAACTTATGAACTCTTTTAAGGTCTAATCAGGGGACGTTGCT	Os12g0193800	AK111754	Conserved hypothetical protein.
6020	71	70	Os05g0570300|COMBINER|CI447443|x	GTCCTTGTCACATTTCTGATAATTCCTGATAATTCAGTAGCTCTCTAAATGTCAGTGGAT	Os05g0570300	CI447443	Protein of unknown function DUF295 family protein.
6021	71	71	Os08g0191900|mRNA|AK067587|CDS+3'UTR	CATTTCCTATACAAAGGTATCCATGCTGTTTGTGAAATGTCAAATATAGCTATTTTTATG	Os08g0191900	AK067587	Protein prenyltransferase domain containing protein.
6022	71	72	Os05g0323100|mRNA|AK109472|CDS+3'UTR	TCTTATGAGTTGCAGCAGTTTCATGAATAATTATGCGCTGAGCTAAAGAGGCACCGAGAT	Os05g0323100	AK109472	Rhodanese-like domain containing protein.
6023	71	73	Os03g0356400|COMBINER|CI036524|0	CAATGTAAATAGTTGGGTTTGGTATATTCAGAATACGTTCATGTCTCCTACTAGTTTGTC	Os03g0356400	CI036524	Glutaredoxin domain containing protein.
6024	71	74	Os01g0177400|mRNA|AB056518|CDS	TGTCACGTGGCCGGAGTACATGGCCGTCCGCAAGAAGGCCTTCGCCACCGGCGGCTCCGC	Os01g0177400	AB056518	GA 3beta-hydroxylase.
6025	71	75	Os01g0818600|mRNA|AK070254|CDS+3'UTR	GTTGTAATTAACCCATAGATGAATCATGAATCATGAATGCTTGCAACCAACGTTTAGATC	Os01g0818600	AK070254	Leucine rich repeat, N-terminal domain containing protein.
6026	71	76	Os02g0192300|COMBINER|CI468424|6	TATGTGTGTTACGTTTATCTGCTCTGTTTGACTGTTGATGCATTTGGATCTTAGTCCTGT	Os02g0192300	CI468424	Zinc finger, FYVE/PHD-type domain containing protein.
6027	71	77	Os01g0730800|mRNA|AK059617|UTR	CTACCTGTCAACCACTATGAGCAAGTGAAACCTCTAGTATACCTTCAGGGCATGTACAAG	Os01g0730800	AK059617	Mpv17/PMP22 family protein.
6028	71	78	Os05g0589400|mRNA|AK068595|CDS+3'UTR	CTGCAATGCTACCATGCTTAGTATTCTCTGCTGCATCAATAGAATTTTTTGTTGCAGCGA	Os05g0589400	AK068595	Similar to I-box binding factor (Fragment).
6029	71	79	Os01g0846400|mRNA|AK119400|CDS+3'UTR	AAATACTGTATTACCATTGGCCTTTAGTCACTGGCGGTGCTGTCAGCCACCAGCAAAATT	Os01g0846400	AK119400	Conserved hypothetical protein.
6030	71	80	Os02g0273000|mRNA|AK071021|CDS+3'UTR	GCAAATTCCTTTATGTTTTTTCTTATGTCTTCTCCAGCTTTTTAGTCAGGAAGATGCTGT	Os02g0273000	AK071021	Similar to Uridine kinase-like protein.
6031	71	81	Os06g0304700|mRNA|AK106561|CDS+3'UTR	TAAGAAACCATAGGATGTTTATACCGATCTTGAGCGGTCATCGGCCTCGTTGGACTGTTA	Os06g0304700	AK106561	Hypothetical protein.
6032	71	82	Os02g0332200|mRNA|AK067672|CDS+3'UTR	AACTGTTTGCATGGCAAAGTATGTACATGGCGCTTCAAATAAAGAAAGCTTAATAAAGAG	Os02g0332200	AK067672	Similar to T-complex protein 1 delta subunit.
6033	71	83	Os02g0257200|mRNA|AK103494|CDS+3'UTR	CACGTACTGTAGACTGTCTGAAACTTAGATGTGTGCCTGTGAATTTATGGTCGATATATT	Os02g0257200	AK103494	Conserved hypothetical protein.
6034	71	84	Os04g0645900|COMBINER_EST|CI274834|6	CATACCTTTTTGACATGTGGCTTCGATTGTTGGAATGATCAGATGAACGATGAGATTAGC	Os04g0645900	CI274834	Conserved hypothetical protein.
6035	71	85	Os08g0298600|COMBINER_EST|Os08g0298600|8	GCATGGTGATGGGTTCGAAAGTTTCGTGGAAGAAAAGCCTATGTCGCTGGAGAACAAGAG	Os08g0298600		Male sterility C-terminal domain containing protein.
6036	72	1	osa-miR399d|Os06|5'seq	AAGACAGTAGTAGGCAGCTCTCCTCTGGCAGGTGCATTCTAGGTGATTTTGTAATTGTAT			miRNA
6037	72	2	Os12g0488700|COMBINER_EST|Os12g0488700|8	CTGCTGCTCGACAAGGCTCCCAGGCCAGGGCACGGCCACCAGAAGATGCCCAAGAAAATT	Os12g0488700		Protein of unknown function DUF593 family protein.
6038	72	3	Os04g0666800|mRNA|AK107902|CDS+3'UTR	CTGACACACTCATGTAAAAATAAACTCGGTGTTATAATTGCTCAGGGCAAAGCATCCTTA	Os04g0666800	AK107902	Conserved hypothetical protein.
6039	72	4	Os12g0512100|mRNA|AK121039|CDS+3'UTR	AGCAGGATGGGTAAATGTTAATTTGTTGGTGTGTAATATAATTTTTATGGCAAGGTCACC	Os12g0512100	AK121039	Sugar transporter family protein.
6040	72	5	Os02g0156500|mRNA|AK059616|CDS+3'UTR	TAGTGTGCAAGTGCAAAACAGCAAAAGAATAAAGTTCTTGAGCAAATATATTGCCGAATC	Os02g0156500	AK059616	Conserved hypothetical protein.
6041	72	6	Os04g0635800|mRNA|AK104741|CDS+3'UTR	TTTTTTGGCACATCTGGGCATATGTACTTGGCTACATTCTGTAGCACGCATAAAGTCATT	Os04g0635800	AK104741	GCN5-related N-acetyltransferase domain containing protein.
6042	72	7	Os12g0136200|mRNA|AK068700|CDS+3'UTR	TATTTTACCTGTATCGCAGAGTGCTGAATCTGATGGTGCACTGGTACAGTATAAGCCAGT	Os12g0136200	AK068700	WD40-like domain containing protein.
6043	72	8	Os01g0713200|mRNA|AK104472|CDS+3'UTR	TGGTGTCCATGCATCTTTCCCAATTTGTGAAATATATACTCCCAGTGAATTTTAAGCGAT	Os01g0713200	AK104472	Similar to Beta-glucanase.
6044	72	9	Os03g0781300|mRNA|AK120661|CDS+3'UTR	ATTATGGATCAGAACATCGGCCAACTTCATATGTATGTACTTCAAGTACTGTTGCTCTTT	Os03g0781300	AK120661	Conserved hypothetical protein.
6045	72	10	Os01g0332500|mRNA|AK101382|CDS+3'UTR	ATCCAGCCTGAAGCTCTTGGTAACTTTTGTTGGTAAAGCATCTCAAGTCTCAAGCAATTA	Os01g0332500	AK101382	Similar to Serine carboxypeptidase II-like protein.
6046	72	11	Os02g0558600|mRNA|AK063457|CDS+3'UTR	ACAACATCCATAATTCAATTATGATTTATAAGTAAGAAGAAGGGGGCGGCTTATTGCACT	Os02g0558600	AK063457	Conserved hypothetical protein.
6047	72	12	Os04g0688400|COMBINER_EST|Os04g0688400|8	CGTGCTGTCGTGCCGCCGCGTTCGTGCCCCCGTGCCGCCGTCCCAGTGTGCCGCACCGTG	Os04g0688400		Hypothetical protein.
6048	72	13	Os06g0105300|mRNA|AK106868|CDS+3'UTR	CGAAGGATGAAAATAGTTTCCCTACTACTACTTCTATATTTTAATGTACGACACCGTTGA	Os06g0105300	AK106868	Conserved hypothetical protein.
6049	72	14	osa-miR395d|Os04|3'seq	TCACGTGGCACTATCTCAATGCCTACTATGTGAAGTGTTTGGGGGAACTCTCGATATCAC			miRNA
6050	72	15	Os11g0242700|mRNA|AK064219|CDS+3'UTR	GGCTGCTTGTTATTACTCTGTTAATGGTTGTGCTCATCTCAGGCTGTGCTTTCTTGGATG	Os11g0242700	AK064219	Conserved hypothetical protein.
6051	72	16	Os12g0161100|COMBINER_EST|Os12g0161100|8	GCGTGAAGGAGGCGGCGAGGGCGGTGCTGAGGATGCACTCCGGCGTGTGGAGCGGATCGC	Os12g0161100		U box domain containing protein.
6052	72	17	Os10g0508000|COMBINER_EST|CI358539|1	CACCAGGATCAACTCTGGTTACTCCAATTCTTTTTGGTAGTGTAACTCTGTTTGATCGTC	Os10g0508000	CI358539	Similar to Monocopper oxidase-like protein SKS1 precursor.
6053	72	18	Os06g0188600|COMBINER|CI531842|x	AGGGCTCTCAGCCAATTTGTTTAGAAAAAATAAAAGCCAATGGAAAATAGTGGTATCAAC	Os06g0188600	CI531842	Conserved hypothetical protein.
6054	72	19	Os07g0598000|mRNA|AK106089|CDS+3'UTR	TTTGCTAGTTTTGAAAAATACCATTATAATTTATATAATTGAAACCATATCATTGCAGTT	Os07g0598000	AK106089	Similar to NADPH HC toxin reductase (Fragment).
6055	72	20	Os02g0661300|mRNA|AK106503|CDS+3'UTR	ATGGATATCCATGTAAAATCTTTTAGAGATAATGCTACAAGTGAATGAAACAATATCGTC	Os02g0661300	AK106503	Conserved hypothetical protein.
6056	72	21	Os07g0632800|COMBINER_EST|AU055786|7	TGCTCTTTTTATGTTTCTTGAGAATCAGTACAGTGGATACAGGAAGTAAATGTGCCATGT	Os07g0632800	AU055786	Protein kinase domain containing protein.
6057	72	22	Os02g0127900|mRNA|AK102783|CDS+3'UTR	CCTAGGAGGAATTCACCTTTAATTTTACTGTTGTATGACCCACATATGGAAATGGTTGAA	Os02g0127900	AK102783	Hypothetical protein.
6058	72	23	Os02g0591800|mRNA|AK102534|CDS+3'UTR	ATTTCTTGTATGACACCATGAGTCTATTATTTACATGAATAAGATTTTAGTGTCCTATCC	Os02g0591800	AK102534	Brix domain containing protein.
6059	72	24	Os02g0771500|mRNA|AK062335|CDS+3'UTR	GCTTGACTAACAAATCACTGAGTCTGAGAAATAAGAGTGGAAGTGTAGCTAGTTCGCCGC	Os02g0771500	AK062335	Similar to Pap1p; poly A polymerase (Eukaryotic type).
6060	72	25	Os01g0152500|COMBINER_EST|Os01g0152500|8	CCACAAATCCGGAGAACACATCGAAGAACAAAGTGATCAAGGTGTGCACGAAATGCAAGT	Os01g0152500		Zinc finger, SWIM-type domain containing protein.
6061	72	26	Os07g0177200|mRNA|AK070925|CDS+3'UTR	ATGTATTAGCCATGAATTTGAGGTAAATATGAACCATTACAGTAATAATAATAATGTACG	Os07g0177200	AK070925	Protein of unknown function UPF0005 family protein.
6062	72	27	Os10g0466300|mRNA|AK064778|CDS+3'UTR	GCTGAAGTGCTCGACTTGCGGACATGCCAATGAAATCTAGAATGTGTTTAAATTTGTGGT	Os10g0466300	AK064778	Similar to Yarrowia lipolytica chromosome C of strain CLIB99 of Yarrowia lipolytica.
6063	72	28	Os09g0520000|mRNA|AK063405|CDS+3'UTR	ATTTCATATGTAGTGCTTCCTGAATCGTTTGTATAATTGTATTTCCATAGAGCTAGACCC	Os09g0520000	AK063405	Hypothetical protein.
6064	72	29	Os04g0614900|COMBINER|CI155889|6	TCTTGTGGTGCCTTTTTCCTGCTTTTCAGCTTTCTAGGACAGCATCTCTACTTTCAGTTT	Os04g0614900	CI155889	(No Hit)
6065	72	30	Os05g0319800|mRNA|AK099106|CDS+3'UTR	AGAGGTTGTAGGTTTGTTGGTACGTTTGATTGGTCGAAGACCAGAATAAAATGAGGGCTA	Os05g0319800	AK099106	Similar to Plasma membrane H+ ATPase (EC 3.6.3.6).
6066	72	31	Os12g0117400|mRNA|AK060741|CDS+3'UTR	CAATGACTGTATATTGATTGATTGGTTATTCGCAAGAAACATGACTGTTCTTGTGTAGTC	Os12g0117400	AK060741	Similar to RPT2-like protein.
6067	72	32	Os03g0810300|mRNA|AK106765|CDS+3'UTR	CACTGCTCCAGATTACGGAGCTGCATACGCTATGTATTAACTTGACCACACCTGAAATCA	Os03g0810300	AK106765	Conserved hypothetical protein.
6068	72	33	Os11g0514600|COMBINER_EST|Os11g0514600|8	TCCAAGAAAGGGAGAAACATATCCATGTAGAGGAAAACATGGATATACGGTGTAAACCCC	Os11g0514600		Similar to Somatic embryogenesis receptor kinase 1.
6069	72	34	Os10g0139300|mRNA|AK107379|CDS+3'UTR	GATGAGACCTTAATTAATTATAGTAAGATGCACTTTTCTGTAATTAACATGTGTGCTTCG	Os10g0139300	AK107379	Cyclin-like F-box domain containing protein.
6070	72	35	Os07g0109700|mRNA|AK121072|CDS+3'UTR	ACGAGTCAGATAGTGTGATACTGAGCTGAGTTACTAGCAACATTTGTACATCGGAGTCGA	Os07g0109700	AK121072	Conserved hypothetical protein.
6071	72	36	Os05g0138300|mRNA|AB027607|CDS+3'UTR	CTCTTCCTCTAATGTTTGATGATATGTAGAATCTCTTGCTGTTAATCTGTTGCTTTCGTG	Os05g0138300	AB027607	Hydrophobic protein LTI6B (Low temperature-induced protein 6B).
6072	72	37	Os04g0459500|mRNA|AK104690|CDS+3'UTR	TCGCAATGCTGTGTAATGTTCATGTGTAATACCGTATATACTACCGGACACCGGTTGCCA	Os04g0459500	AK104690	Similar to GADPH (383 AA) (Fragment).
6073	72	38	Os11g0262600|mRNA|AB053296|CDS+3'UTR	GATGTTCTGGAACTCTTGTAATCATCTGCGTTTTATTTAATGAAAACGGGGGAGATACCC	Os11g0262600	AB053296	Conserved hypothetical protein.
6074	72	39	Os08g0390500|COMBINER|CI242583|6	TACTGGGCTCCTGCCCCAAATCGATCTGCCTAGTGTGAGGCGGCGCAGACTCCCATCGAT	Os08g0390500	CI242583	(No Hit)
6075	72	40	Os06g0207500|mRNA|AK073911|CDS+3'UTR	GCTTTTGAGGATTGAAGATTGTAAAAGATGTTCTTACAACTGTTTGTTAGTCTTACTGCC	Os06g0207500	AK073911	Protein of unknown function DUF231, plant domain containing protein.
6076	72	41	Os11g0605800|mRNA|AK106619|UTR	GAACATGCGGATTCCCAAAACATTGTCAGTTTCCAATGTATTGTATGACTCGGTTTTCCT	Os11g0605800	AK106619	Non-protein coding transcript, putative npRNA.
6077	72	42	Os07g0159500|mRNA|AK065419|CDS+3'UTR	AAGTGGAATAAGAGTGCTGCAGTTCTGCAGTTAAGCTTGCCAGTTCTGCAGTTCATGCAT	Os07g0159500	AK065419	Conserved hypothetical protein.
6078	72	43	Os02g0519100|mRNA|AK119325|CDS+3'UTR	CTCAGTAGTCAGTTCTGCTCCATTCTTGGAGTAGGAGTTGTACCAAATATCCCTTTAGTC	Os02g0519100	AK119325	Similar to Potassium transporter 1 (OsHAK1). Splice isoform 2.
6079	72	44	Os12g0484900|COMBINER|CI439534|x	TGTGGTATTGTACTATCTCAGTTTCTTGTGGAATTTGTTCTATGTTGCTGACTGAATTGC	Os12g0484900	CI439534	Similar to Growth-regulating factor 7.
6080	72	45	Os10g0479000|COMBINER_EST|Os10g0479000|8	GACTCCGATCCTCTCACGTACTACACGGCGCAATACACAGCCCTGCAAACAACAATTAAA	Os10g0479000		Hypothetical protein.
6081	72	46	Os06g0209300|mRNA|AK062037|CDS+3'UTR	TTACCTGTTGCGTTGATGTATGGCTACATTTGTTGTGACTTGTAATGAATCCATGCCAGA	Os06g0209300	AK062037	Zinc finger, FYVE/PHD-type domain containing protein.
6082	72	47	Os08g0124900|COMBINER_EST|Os08g0124900|8	AGTGGGCTTGGGATCTGTATGGCAAGGGAGATGTTCTCAAGGTTGTCGACGTGCGTCTCA	Os08g0124900		Concanavalin A-like lectin/glucanase domain containing protein.
6083	72	48	Os10g0150800|mRNA|AK062795|CDS+3'UTR	GCACAGGAGTGTAATTTGTACTTGATTATCGGGCATCAGCAGGGATGTTTGTACTATTTG	Os10g0150800	AK062795	Protein of unknown function DUF1210 family protein.
6084	72	49	Os11g0569500|mRNA|AK102251|CDS+3'UTR	TTGCTAGGAAAAGCATTTTTCCAGTCATGTACTTTGTCCAGACATAATAAATTACTACGC	Os11g0569500	AK102251	Similar to Receptor kinase-like protein.
6085	72	50	Os05g0362600|COMBINER_EST|AU165664|6	AAATTGTGCACGTTGTACCAGTATACTAACACCCAATTTCATGCATTTTGCATGGCTTAG	Os05g0362600	AU165664	Late embryogenesis abundant protein 3 family protein.
6086	72	51	PTaControl0001|mRNA|D86327|3'UTR		
6087	72	52	Os10g0467800|mRNA|AK072259|CDS+3'UTR	TAAAATTTGTAAGAACTGAGGTGGAGATTATACTCGAATTTAAGAACAATTGTTTTTGAA	Os10g0467800	AK072259	Similar to Cellulose synthase (Fragment).
6088	72	53	Os07g0574800|mRNA|AK104900|CDS+3'UTR	CTTTTTGTACTGTGCTAAACTGTTGTTAGCCCCTCGTTGGCCATGATTGTTCATATCTTC	Os07g0574800	AK104900	Tubulin alpha-1 chain.
6089	72	54	Os05g0452600|mRNA|AK121541|CDS+3'UTR	GGATTCACCATACTGAATTTGACTGTATGTATTCCTTTAAACATGTTTGTCAATACCTGG	Os05g0452600	AK121541	Similar to Ribosomal protein L33.
6090	72	55	POsControl0031|random		
6091	72	56	Os04g0111300|COMBINER_EST|Os04g0111300|8	CGCAAGGTGTTCGACCGACGGGACGAATGGCGTGGCGTGGCGTGGGCGCGCGGAACGGAG	Os04g0111300		Hypothetical protein.
6092	72	57	Os05g0565000|mRNA|D21301|CDS+3'UTR	GGCCGAACTTGTTCATGTGATCTACCAGTGTGTACCCATGTTCTGCAATTTAGCCCAAGA	Os05g0565000	D21301	Similar to 60S ribosomal protein L18a-1.
6093	72	58	Os04g0685300|mRNA|AF039532|CDS+3'UTR	GCTTACTTACTGCTGTTCAGATCATATATGACTGTATGTTGGTTGATACATTCAGAGATT	Os04g0685300	AF039532	Harpin-induced 1 domain containing protein.
6094	72	59	Os06g0272500|COMBINER|CI485616|x	ATACTTGTGAGAGTTGTATTCAAGCTTGTTGTTACTAATTGGGAGAAGAGGGTTCCTAAA	Os06g0272500	CI485616	(No Hit)
6095	72	60	Os06g0112100|mRNA|AK103951|CDS+3'UTR	CTTGTAAGCATGCATGTGCGATCATTTTATTGCAAATGGAATAGCAGATGATGTTGCTTT	Os06g0112100	AK103951	Conserved hypothetical protein.
6096	72	61	Os04g0217600|mRNA|AK103331|UTR	TTGAGATCCTGGTTGCGGAACTGAGATGTACTATTGACTTGAGTCATATTTAGTTTTTTG	Os04g0217600	AK103331	Non-protein coding transcript, putative npRNA.
6097	72	62	Os03g0712200|mRNA|AK073205|CDS+3'UTR	AGAACTTCAGTATTGTACTTCTGCTATGATCTGTCTTGGCAAATAATATACTATGATTTT	Os03g0712200	AK073205	Zinc finger, RanBP2-type domain containing protein.
6098	72	63	Os01g0803200|mRNA|S49967|CDS+3'UTR	GAATGATTGCAAGGTGTATTAACTACAAATATTGCAATAAAAGTCCCTGTTACTACAACT	Os01g0803200	S49967	Cysteine proteinase inhibitor-I (Oryzacystatin-I).
6099	72	64	Os02g0465900|mRNA|AK104223|CDS+3'UTR	AGACTGGTGTGCTGCTGTTTCCTTTGACACACTAAATAATAAAGGGATTCCATGAGCTTT	Os02g0465900	AK104223	ChaC-like protein family protein.
6100	72	65	Os03g0780400|mRNA|AK073162|CDS+3'UTR	AACACCCTCTCCCAAACTCTTATATTGTGGTATTAATATGGATTACTGGGTGTGGATTGT	Os03g0780400	AK073162	Similar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6).
6101	72	66	Os02g0788500|mRNA|AK104526|CDS+3'UTR	CTATTTTGAGGAGTATTAGTAGTAGGTACAGACAACCAGAACCCTGATGGAATTGTAACT	Os02g0788500	AK104526	Conserved hypothetical protein.
6102	72	67	Os04g0647800|mRNA|AK104069|CDS+3'UTR	AAGGTGCTTAGCACTTGTTATGTCCATGAATAAGTTGGTCAATGGAACATCCTTCAAAAG	Os04g0647800	AK104069	Similar to Glycerol kinase 2 (EC 2.7.1.30).
6103	72	68	Os06g0187900|mRNA|AK071765|CDS+3'UTR	TTTGCTTAGCATTTGTTCGTCAAATTAATGTGGTGAATGGTTATTTCTTAGGGATCTACG	Os06g0187900	AK071765	RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
6104	72	69	Os04g0431200|mRNA|AK064823|CDS+3'UTR	TACATGGTGTTGCCTTGTAAATAGATCATGGTGCAACTGATGAAACAATACATTTGTGGT	Os04g0431200	AK064823	Cyclin-like F-box domain containing protein.
6105	72	70	Os02g0308400|mRNA|AK061421|CDS+3'UTR	GAGTATTTATATATGTTGATGATGATTCACTCAGTGAAATTTACTGGCTTCTTTTGGTCT	Os02g0308400	AK061421	Beta-Ig-H3/fasciclin domain containing protein.
6106	72	71	Os10g0397200|mRNA|AK102029|CDS+3'UTR	CGGTCAGCTTTGTAAAACATAAATCAATTCAAGAGCTTGAGATGGCATACCTTCGCCTGT	Os10g0397200	AK102029	Winged helix repressor DNA-binding domain containing protein.
6107	72	72	Os08g0207800|mRNA|AK106835|CDS+3'UTR	TCACGGCTGTCTTAGTTTACTATTGATGACTGCTGAAATGGACCTGCTACTTCGTTGAGT	Os08g0207800	AK106835	Peptidase A1, pepsin family protein.
6108	72	73	Os08g0113100|mRNA|AF429947|CDS+3'UTR	TTTTAGGTCGATTTAATTTAGTTGCTGCTTCGTTTTAGACAAGGAAGAGGAGGGGCTTGG	Os08g0113100	AF429947	Similar to Fructokinase (Fragment).
6109	72	74	Os04g0651500|COMBINER_EST|Os04g0651500|8	CCAACTTAATCATCAGATTGCAAGACATTATTGTGGTCTTCTTTTCCGAGGAACTCCAAT	Os04g0651500		Growth factor, receptor domain containing protein.
6110	72	75	Os03g0851000|mRNA|AK102202|CDS+3'UTR	TTTTTACCTGGTTTTGATGTTCACATTTCTGGTTGGTTCAGAATATACTAGCATCAGGGT	Os03g0851000	AK102202	Similar to Transcription factor homolog BTF3-like protein.
6111	72	76	Os03g0654900|mRNA|AK066712|CDS+3'UTR	ACCATATTATGGGATCCAATTTTTAGTTCTCTCTTTGAGGTGGTAAAGATTTTAGAGTCT	Os03g0654900	AK066712	Similar to Ornithine decarboxylase (EC 4.1.1.17).
6112	72	77	Os05g0556400|mRNA|AK058980|CDS+3'UTR	TGCTGTCAAGTGAAACTGTGAAAAAGTGTAAGCGTGAGCAGGTGCAATTGCACTATGCCA	Os05g0556400	AK058980	DOMON related domain containing protein.
6113	72	78	Os04g0430600|mRNA|AK106337|CDS+3'UTR	TTTGTCGCGAACATTTTGAGATATCGAATTTTGGGTGGATAATAATAATTAATCACGCCG	Os04g0430600	AK106337	Conserved hypothetical protein.
6114	72	79	Os05g0534500|mRNA|AK107145|CDS+3'UTR	GGTGAAGGTTTCTGCAGAATTTTACGAGATTTTCTGTGCTCCAAATAGGCTTGTAAACAT	Os05g0534500	AK107145	Phosphatidylinositol-specific phospholipase C, X region domain containing protein.
6115	72	80	Os05g0129300|mRNA|AK065180|CDS+3'UTR	TGTGTGCTGGTTTGTGATGTGATGAACTGATGATTGTAATATTTTGACATTGAACCTATG	Os05g0129300	AK065180	Basic/leucine zipper protein.
6116	72	81	Os02g0121300|mRNA|D29701|CDS+3'UTR	CTTTCGCCAGTATCAGTCGTCTTGAGTCGTCGAGTCCCTAAATAAGGAGGAGGTGGTGGT	Os02g0121300	D29701	Cyclophilin 2.
6117	72	82	Os04g0474500|mRNA|AK073031|CDS+3'UTR	ATATTCTGCATTTCTTTTTCAATCTCCAAGGTGATCCCACCAGGGTTAAAATCTCCCTGT	Os04g0474500	AK073031	Similar to Cyanogenic beta-glucosidase precursor (EC 3.2.1.21) (Linamarase) (Fragment).
6118	72	83	Os07g0258700|mRNA|AK069407|CDS+3'UTR	GAACAAAAAACTAAGTGTAAACTATTTGCAACGTTGAACGGTTAAATTGATTACCAGGGC	Os07g0258700	AK069407	BTB domain containing protein.
6119	72	84	Os06g0142700|mRNA|AK071423|CDS+3'UTR	ACCTGGACCATTTATTTTGGTGTATGATCTGTTATCTGAACATTTCACAAACCTTGGTCC	Os06g0142700	AK071423	Cytochrome c oxidase, subunit Vb family protein.
6120	72	85	Os08g0318600|COMBINER_EST|Os08g0318600|8	GCTTCTAGGCTAAAGGAGTTAATTGAAAGGTTGGTAGGCGCTGATCCTTTCCCATTCCTT	Os08g0318600		Hypothetical protein.
6121	73	1	Os02g0667600|mRNA|AK109816|CDS+3'UTR	CCTAGTGATTTTTAGGGGGTATACTGCTAATATTGGATGTATATGTAAATAAAAATAATC	Os02g0667600	AK109816	Harpin-induced 1 domain containing protein.
6122	73	2	Os03g0216900|mRNA|AK073615|CDS+3'UTR	TGATACGTATGTAGGCGGATGCTTCTTTTTTGCTGATATATGCAGTTTTGTTCCTGCTTC	Os03g0216900	AK073615	Prefoldin domain containing protein.
6123	73	3	Os02g0551900|mRNA|AK103760|CDS+3'UTR	TACCCCCCTTCCTTCTGAATTATGCAGGTTGGTAATGTTGGGCTGCTCCCATTAATCAAA	Os02g0551900	AK103760	Zinc finger, C2H2-type domain containing protein.
6124	73	4	Os12g0555500|mRNA|AK071613|CDS+3'UTR	AGTTATCATTTTGCTTCATCAATGGGTGAATAAAGAGAGGCAAGTCTGAATGTGTTCTGC	Os12g0555500	AK071613	Probenazole-inducible protein PBZ1.
6125	73	5	Os01g0596000|COMBINER_EST|Os01g0596000|8	CGCGTTCAGCTACATGAGAGCATCTGATCTTTCTCTGAGTGACCCATTCTTTGTTTCGAA	Os01g0596000		Cyclin-like F-box domain containing protein.
6126	73	6	Os07g0607300|mRNA|AK069102|CDS+3'UTR	AGCAGTCTGATTGATCATTGCTTCTCTTATGTTTTCCTCCGGAGTCTGGACTATAGTTTC	Os07g0607300	AK069102	Bromo adjacent region domain containing protein.
6127	73	7	Os01g0889400|mRNA|AK071407|CDS+3'UTR	TTGTCCCTGATTTTAGCACTTGGACGGCTACCTTAATTAATACTACTATATTGATACTGC	Os01g0889400	AK071407	Similar to LOB domain protein 6 (ASYMMETRIC LEAVES2).
6128	73	8	Os05g0392100|mRNA|AK099734|CDS+3'UTR	CACCGAGGCACCAATGATGTAACTCTCTACCAGATACCAGTACCAAGGGAAATGATATGA	Os05g0392100	AK099734	Conserved hypothetical protein.
6129	73	9	Os03g0750400|mRNA|AK109888|CDS+3'UTR	TCAAACCGCAATTTTCTGTTACTACTAGTACATTTAATTTATTTAATTTAAGGGAATTTG	Os03g0750400	AK109888	Conserved hypothetical protein.
6130	73	10	Os10g0454000|mRNA|AK106252|CDS+3'UTR	CATTCTTGTAAAAAAATTTGTTCTAACGGTGTGGACTAACGGTGTGATGGCATTTCTGGG	Os10g0454000	AK106252	Conserved hypothetical protein.
6131	73	11	Os05g0534000|COMBINER_EST|CI041398|6	CAGTAACTCTGGTTGAGTCTTTTGTAACTGCAATTATTGCATACGAATAAAATGACGGCC	Os05g0534000	CI041398	Protein prenyltransferase domain containing protein.
6132	73	12	Os09g0372800|mRNA|AK099105|CDS+3'UTR	CCTAACTGTTGTTAATTCTGGTATTCAGTTTTCTTGTAAAATATTCGGTGAATACCACAA	Os09g0372800	AK099105	Protein kinase-like domain containing protein.
6133	73	13	Os05g0144400|mRNA|D21292|CDS	GAAAAGAAAATAATTTGCATGCATGGTGGCATTGGAAGGTCAATAAACACTATCGAGCAA	Os05g0144400	D21292	Serine/threonine protein phosphatase, BSU1 family protein.
6134	73	14	Os08g0506700|mRNA|AK100106|CDS+3'UTR	CTTGTAACTTTTGCCATATATACCCCTGCATGCCCCATGTCCAGTGCATTTTCGATAGAA	Os08g0506700	AK100106	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
6135	73	15	Os06g0679200|mRNA|AK107197|CDS+3'UTR	ACTTATGAACATGAAAAACCAACAAGAGCATGAGCGGAACAGAGATAAACGGAAGCACGC	Os06g0679200	AK107197	Non-protein coding transcript, unclassifiable transcript.
6136	73	16	Os07g0150500|mRNA|AK073749|CDS+3'UTR	TAGAACTTTGAACAACCTTGTCCTTTTTCGTCAAAGACCTAACTGTGCAAATGTGCAACA	Os07g0150500	AK073749	Zinc finger, C3HC-like domain containing protein.
6137	73	17	Os04g0650700|mRNA|AK121820|CDS+3'UTR	AGGTGGGCTTGAATAATGACGATGATGGCGATAATTCGTCTGGAAATAATAATGTGAAAA	Os04g0650700	AK121820	Similar to L-asparaginase (L-asparagine amidohydrolase).
6138	73	18	Os07g0618000|mRNA|AK105179|CDS+3'UTR	GTCCCGGTTGCTCCTGTTCGCCACGTCTGTAATTTTCAGAATTTATAGAGGTAAAAAAAA	Os07g0618000	AK105179	Conserved hypothetical protein.
6139	73	19	Os03g0226200|mRNA|AK121522|CDS+3'UTR	TAAATCAACTGCTGTTTTGTTCTATGTAAGATACATAACTCATAAATAAAGATGGTTTTC	Os03g0226200	AK121522	Non-symbiotic hemoglobin 2 (rHb2) (ORYsa GLB1b).
6140	73	20	Os01g0553000|mRNA|AK107790|CDS+3'UTR	CTCTCCCTCTCTCTCGGCTCCTAACTGAAGAGGAGAAGATGACGGGAGGAAGAAGAAGAG	Os01g0553000	AK107790	Conserved hypothetical protein.
6141	73	21	Os06g0143900|mRNA|AK103948|CDS+3'UTR	GAACAATGAAGGAACTTCGTCAGCCTAAAAGAATTGTTTGTGCTAACTGAACATGAGTAA	Os06g0143900	AK103948	Similar to Coatomer protein complex, beta prime; beta'-COP protein.
6142	73	22	Os01g0235200|mRNA|AK103537|CDS+3'UTR	AAACAATCTTGATGTTACTGGCATACCATATGTTGCTAAGTTAGTCTGTCATTTTGCTAG	Os01g0235200	AK103537	Conserved hypothetical protein.
6143	73	23	Os03g0432800|COMBINER|CI189128|6	TGTTCGCTTCTGTGTTTGTGTTTCTTCCTCGCTGCCTCGTTCAGAAAGTGTAGCTTGTAT	Os03g0432800	CI189128	(No Hit)
6144	73	24	Os06g0331900|mRNA|AK120017|CDS+3'UTR	GTGATGTTTCGCACAGATGTAAACTTGCTGTTGATGATAATAATGAACATGACAAACTAC	Os06g0331900	AK120017	Protein of unknown function UPF0005 family protein.
6145	73	25	Os01g0126100|mRNA|AK106990|CDS+3'UTR	GTCATAGTTGTCCTTCCTTTTTCACTCTGTTCTTCATGTATTCTTGACTCTGCTAAATGC	Os01g0126100	AK106990	Cupredoxin domain containing protein.
6146	73	26	Os05g0466800|COMBINER_EST|CI075250|0	TCTGTGAGTTCCTGAAGGCTTGTAAATTTTGATCAAGGTTCTACAGCGATGATTCAGTGG	Os05g0466800	CI075250	Conserved hypothetical protein.
6147	73	27	Os03g0257500|mRNA|AK058775|CDS+3'UTR	CTGTGTGTGCACTCCAAGATTACCAAGCTGTGAATATACATGTGGATGTCCACCCGTTTT	Os03g0257500	AK058775	Protein of unknown function DUF292, eukaryotic domain containing protein.
6148	73	28	Os11g0135900|mRNA|AK072447|CDS+3'UTR	AAACCCTTTCTGGCCGTGCCACAGCAGCATGATACAAATTAGACTGTTCAGGTATACTAC	Os11g0135900	AK072447	Major facilitator superfamily protein.
6149	73	29	Os10g0322300|mRNA|AK109422|CDS+3'UTR	TGCAAGGCACGTCATCACGTCGATACCTATTGAATGGAATCAAATTAGAAGGAGACTGCT	Os10g0322300	AK109422	Conserved hypothetical protein.
6150	73	30	Os03g0713100|COMBINER_EST|CI340173|0	ATCTTGGCCTTTTTGTATGATGTTGATGATGATGAGCTGGTCCTCCGGGATCACACTGAT	Os03g0713100	CI340173	Similar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1).
6151	73	31	Os05g0124700|mRNA|AK063257|CDS+3'UTR	ATCCCAAAACAATTGTTCCTTGTATGGTGGATGCTTGCTATTAAGTTGGAAGAAGTGGGT	Os05g0124700	AK063257	Deoxynucleoside kinase family protein.
6152	73	32	Os06g0245700|COMBINER_EST|CI312205|1	AATTATGACTGTAAACATTTTCTGAAGATCTCTCGAAGGCAGGCCTTGGTTATTTCTGGG	Os06g0245700	CI312205	Similar to Glycosyl hydrolase.
6153	73	33	Os03g0622500|mRNA|AK100879|CDS+3'UTR	CCAACTTCCCTGATTTCTCTTGATAATCTATGTTAGTCAAAACTGTTCAGACTAATCATG	Os03g0622500	AK100879	Hypothetical protein.
6154	73	34	Os01g0632000|COMBINER|CI276435|6	TCCCAGCATCCTGGAAATGTTTCTTTTCTTTGTTTGCTTTTTGGCGTGTCTGTGCCCACT	Os01g0632000	CI276435	Conserved hypothetical protein.
6155	73	35	Os05g0339200|mRNA|AK111022|CDS+3'UTR	GACCAGATTGTTTACGCCCTTAATATGGAATTATGGATGCCTCATTCTTCTGTCATTCAG	Os05g0339200	AK111022	Conserved hypothetical protein.
6156	73	36	Os05g0587500|COMBINER_EST|CI260116|6	CGCGTGCACGAAGTACGCGTCGAATGGTCCGAAAAATTGGCTCCTCACCCTTGCGCAAAA	Os05g0587500	CI260116	Peptidase aspartic family protein.
6157	73	37	Os12g0276100|mRNA|AK062912|CDS+3'UTR	CTCAACAGAAAATTGTAGGCACAAATTGCCTGGTGTATCAGTAATTCGACATTTGCTGGG	Os12g0276100	AK062912	Hypothetical protein.
6158	73	38	Os04g0679200|mRNA|AK104911|CDS+3'UTR	TAGTAGGTTGATCCTGACTTGTTTACGTCAGAGCAATTCAAGATCGCTGCTTGTTGGACA	Os04g0679200	AK104911	Similar to Receptor-like serine/threonine kinase.
6159	73	39	Os10g0337400|COMBINER_EST|Os10g0337400|8	ATGTGTGGTATGATTAACACGGCATCACTGTACATTACATGGCAGCAAGAAAGGAAAGAC	Os10g0337400		Protein kinase-like domain containing protein.
6160	73	40	Os03g0576700|mRNA|AJ272394|CDS+3'UTR	GATATCTGGTACTGATTTGCATGCTCTGCTATCGAATGAAATTCCATCCATGTGTTGTGT	Os03g0576700	AJ272394	Similar to 60S ribosomal protein L13 (BBC1 protein homolog).
6161	73	41	Os10g0154300|COMBINER|CI278091|6	CCTCTCTTCGGTTAGTCTGTCAGTGTAGAGTGTTGGTTTCAGATTGTCAGTCTGCATGTA	Os10g0154300	CI278091	(No Hit)
6162	73	42	Os05g0277000|COMBINER_EST|Os05g0277000|8	AGGTCACGGTGTGGAACATCGCGCCCTCCAACTGGAACTTCGGCACCACCTACACGTCCA	Os05g0277000		Similar to Expansin Os-EXPA3.
6163	73	43	Os11g0619700|COMBINER|CI462742|6	TCTATGTAAGTGAGTGTTTGGCACCCAGTCCATGTGTTTTCTCTATTCGTATAATATTTA	Os11g0619700	CI462742	(No Hit)
6164	73	44	Os08g0423500|COMBINER_EST|Os08g0423500|8	GACCCCTTCAGGGCGTGAACAACAGGGAGATTGACCTGTTCCTTCCTCTCCCTCTCATCA	Os08g0423500		Carbonic anhydrase, eukaryotic family protein.
6165	73	45	Os03g0110800|mRNA|AK065147|CDS+3'UTR	TTGATTGATATTGCTGAACCTGATGTGATGTTATTGCACTCAAACAGGAGTGTTTTTTCC	Os03g0110800	AK065147	Similar to DNA methyltransferase.
6166	73	46	Os09g0354300|COMBINER_EST|Os09g0354300|8	CGGAGTATTACAAGGGCCAGTTAAAAGCATTGCGTCGCCAAGGGGAAAAGTTCGTCGACA	Os09g0354300		2OG-Fe(II) oxygenase domain containing protein.
6167	73	47	Os09g0513900|mRNA|AK107699|CDS+3'UTR	TGAACGAATCGGCAAACTGCCAATTTCATTGAATAAAGAATGAAGAAAACTTTACAAGTA	Os09g0513900	AK107699	Conserved hypothetical protein.
6168	73	48	Os04g0639100|mRNA|AK063036|CDS+3'UTR	TTGTCATCATGCATGGTTCATGATTACCAGTAGTAATTTGATGAACCTCTTCTTCATGCT	Os04g0639100	AK063036	Conserved hypothetical protein.
6169	73	49	Os08g0439900|mRNA|AK110628|CDS+3'UTR	TTCAGGACGAATTGGTTCACTAGTTTATCAAATGGTTTATACTCTACTGTGCTTCTCATC	Os08g0439900	AK110628	Mitochondrial glycoprotein family protein.
6170	73	50	Os02g0221600|COMBINER_EST|CI445446|0	GCATTCTGCTTATAGTTCATCTTCATAGCTGATTAGCTGTCATTTTAGTACTATCTCATC	Os02g0221600	CI445446	Conserved hypothetical protein.
6171	73	51	Os10g0556100|mRNA|AK101357|CDS+3'UTR	CTTTTATAATTTATCATTTTCAAATGGTGATGATATGATGATTAATCAAAAGGATTATAT	Os10g0556100	AK101357	beta-expansin EXPB4 [Oryza sativa (japonica cultivar-group)].
6172	73	52	Os08g0532700|mRNA|AK073978|CDS+3'UTR	TGGATACATTGAGGATTCTCTATTGAAATGATTAACAAGATGGATAGGGCTAATAAAAAG	Os08g0532700	AK073978	Similar to Peroxidase 55 precursor (EC 1.11.1.7) (Atperox P55) (ATP20a).
6173	73	53	Os07g0516100|COMBINER_EST|Os07g0516100|8	TTTCATGTTCACAGTTCACACGTCCATTACTTTGAAATTCCTCCATTCAAAGAGGTCTGA	Os07g0516100		Protein phosphatase 2C-like domain containing protein.
6174	73	54	Os03g0837100|mRNA|AK100877|CDS+3'UTR	TGATTTAGCCCATCCGGTGTTGTAATTTGTAAAGGTGCCCCTTTGTTCAATACTTCAATT	Os03g0837100	AK100877	Similar to Cellulose synthase-6.
6175	73	55	Os05g0433400|COMBINER_EST|Os05g0433400|8	GGCAGCTGCCCGACGACGACGACGACGCACCGGCGGGCGCGGTCGCGTCCTGGAGGCAGC	Os05g0433400		Protein of unknown function DUF1218 family protein.
6176	73	56	POsControl0038|art		
6177	73	57	Os06g0275500|mRNA|AK111743|CDS+3'UTR	TCCCTGAATTCTGTAACTGCTGCACCTGTCGCCAGTTCAACTTCAAAAGATTTTTCTGAT	Os06g0275500	AK111743	Similar to Polycomb protein EZ1 (Enhancer of zeste protein 1).
6178	73	58	Os03g0705800|COMBINER_EST|CI247822|6	CCTCTGCAGCGGCTGCCTTTGTGCGCGTCGAGTGTGCACCTCGTGTTGTAAACTGTTTAT	Os03g0705800	CI247822	Conserved hypothetical protein.
6179	73	59	PZmControl0003|mRNA|X12539|3'UTR		
6180	73	60	Os09g0428500|mRNA|AK120077|CDS+3'UTR	TACTGAATTGGTCAGTACAATTACTGTATTCTAACGACTTGTATTAATCCTTGACTCGTC	Os09g0428500	AK120077	Conserved hypothetical protein.
6181	73	61	Os04g0661300|mRNA|AK070723|CDS+3'UTR	ACCATCAGGCCGTACATCTTGTAAGAGCAAAACAATTGGTTTAGGAAAAATGCTGATTCC	Os04g0661300	AK070723	Conserved hypothetical protein.
6182	73	62	Os06g0641100|COMBINER_EST|Os06g0641100|8	AGTTCCCGGTCGACATGCTCGCCATCAAACAAGTCATCTTTGTAAGTAACTATCAGCAGT	Os06g0641100		Cytochrome P450 family protein.
6183	73	63	Os01g0646700|mRNA|AK073060|CDS+3'UTR	GCTTCGGATTCAGATTAGGTCAGGGATTAATATGTTTTGCTCAACTGGCTATTTTATTTA	Os01g0646700	AK073060	Conserved hypothetical protein.
6184	73	64	Os03g0792600|mRNA|AB109201|CDS+3'UTR	GTTCGATCAACGCAACGGGATCAAGTTTGTAGCAGGTTTATGTGAGTGACATTGAGCTGG	Os03g0792600	AB109201	AAA ATPase domain containing protein.
6185	73	65	Os08g0274700|mRNA|AK120575|CDS+3'UTR	ATTCTAATCTGGTGGCTGGCCAACCAACACAGCCTCTTGAACAAAGGGCAGTTAGTTATT	Os08g0274700	AK120575	GINS complex, Psf3 component family protein.
6186	73	66	Os07g0189700|mRNA|AK099833|CDS+3'UTR	TGATGACCTGCTCAATCCACTCTGTTTCTTCCTGAATCCTGTTGTCATGTGTAAACAAAC	Os07g0189700	AK099833	Conserved hypothetical protein.
6187	73	67	Os03g0180000|COMBINER_EST|CI411260|0	TGATATGCATAAAATTGCCTATCCATGCCTGTCTTTATACAAATGAAATGGAATCACACG	Os03g0180000	CI411260	Antihaemostatic protein domain containing protein.
6188	73	68	Os02g0193900|mRNA|AK104014|CDS+3'UTR	TGCTAAATGCTGCCTACCTTGCTTTGGAGACTGGTAAATGAACACTGATCATTGCTTGCT	Os02g0193900	AK104014	Conserved hypothetical protein.
6189	73	69	Os03g0241600|mRNA|AK120688|CDS+3'UTR	CAAAAAGAACCAAGAGAAATGTGAGCGCTTTGTACAGAAATAAAAGTTGCCCGTTGCTAA	Os03g0241600	AK120688	Protein kinase domain containing protein.
6190	73	70	Os06g0477600|mRNA|AK105562|UTR	TCTAGGGATGATATGTGTAATTTTTGTGGCAATCCCTACGTGTGGGTAGAGATTGAACTG	Os06g0477600	AK105562	Non-protein coding transcript, putative npRNA.
6191	73	71	Os11g0280600|COMBINER_EST|CI357917|3	TTCGTTGTGGATTGATTTTGGGGGTGAAGAGGGATGGATGCGCTAGGTGCATCGAGCCCT	Os11g0280600	CI357917	Hypothetical protein.
6192	73	72	Os03g0202300|mRNA|AK071317|CDS+3'UTR	CGCAACAAACCCTGTTATTGTAGATGGGGTAATGTTATCTCAGCAACCCATCCTTGCAAT	Os03g0202300	AK071317	Conserved hypothetical protein 48 family protein.
6193	73	73	Os07g0139400|mRNA|AK099183|CDS+3'UTR	ATTTTAGAAGATTGTAATATTGTTGATGTATTCAGTATACAATAAAAATCCAACAAGCTA	Os07g0139400	AK099183	UDP-glucose 4-epimerase family protein.
6194	73	74	(+)E1A_r60_n9		
6195	73	75	Os02g0117800|mRNA|AK063557|CDS+3'UTR	ATTCTTTGTACAGATGCTGAAATCTTAATACGTTTTGACGTGCTGATCAATTGGTGTAAG	Os02g0117800	AK063557	Similar to APG5 (Autophagy 5) like protein.
6196	73	76	Os04g0565400|COMBINER_EST|CI483497|0	TATGGTGGTGTAAACTTGGGGATATCAGATATCCAACTATTTCCATTGAGTAATTTTATC	Os04g0565400	CI483497	Similar to Cis-zeatin O-glucosyltransferase 1 (EC 2.4.1.215) (cisZOG1).
6197	73	77	Os01g0591000|mRNA|AK105638|CDS+3'UTR	TGGTTAGTTGATTGCTTGTATCAAATATCAATTTGTCGGAATAAAGACAGTATATTTCAG	Os01g0591000	AK105638	NAD-dependent aldehyde dehydrogenase family protein.
6198	73	78	Os11g0683500|mRNA|AK119461|CDS+3'UTR	ATAAAAGCTGTAGGGTCCTCTGGCTGAGAGTACTTTTGCAGTGATGCAAAAATATCATCC	Os11g0683500	AK119461	Glycoside hydrolase, family 1 protein.
6199	73	79	Os06g0105900|mRNA|AK062140|CDS+3'UTR	CTGTCTGCCTGCCTATCTGTTGTTTTCAGTTTCTGTATAAATACTATTCTGCAAAAGAAA	Os06g0105900	AK062140	Conserved hypothetical protein.
6200	73	80	Os03g0219800|mRNA|AK100742|CDS+3'UTR	TACTTAACTCTGTCAGGTTGTGTGACCCATCAGTTTCTCTCCGTACTAGTCTCTTGAAGA	Os03g0219800	AK100742	Conserved hypothetical protein.
6201	73	81	Os02g0803900|mRNA|AK106930|CDS+3'UTR	TCACTGAACGTTCGATTGTAAACTTGTAAAGCTTTGAGAATAAGATGACATTATTCTGGC	Os02g0803900	AK106930	Similar to UDP-glycosyltransferase 91D1.
6202	73	82	Os05g0556100|mRNA|AK065908|CDS+3'UTR	TGTATTACGACCAAGTTCATATATCGTGTTTAATTTTTGTCACAGCCCATTCTTTCGTTC	Os05g0556100	AK065908	Similar to SDL5A.
6203	73	83	Os09g0402100|mRNA|AK068506|CDS+3'UTR	GGTGGCTGCATTTAGTGTTATCAAATGATGTTGAATTGTTCTATGCCATGCCGGACAAAA	Os09g0402100	AK068506	PF1 protein.
6204	73	84	Os04g0501600|mRNA|AK068612|CDS+3'UTR	TTCTGCTGGAGCTATTTGAGACGTCAATTTTGCAGCAAGCATGAATGGAGAGAAATGTCG	Os04g0501600	AK068612	HMG-I and HMG-Y, DNA-binding domain containing protein.
6205	73	85	Os12g0182700|mRNA|AK072557|CDS+3'UTR	CTTGCATCTTTCTACTCCAGTTAGTGTCCAGTGGAACCTGTCGAGCTATCAGCATTTTGT	Os12g0182700	AK072557	Histone deacetylase superfamily protein.
6206	74	1	Os02g0447000|COMBINER_EST|Os02g0447000|8	CGCTGCGGATGTTCACAAAAATCATCTTCCCAAGACCTGCGGTCAAGCAGAAATATTGAA	Os02g0447000		Pol (Fragment).
6207	74	2	Os02g0601300|mRNA|AF546879|5'UTR+CDS	TTTGATGCCAAGGCTGGCATTGCTTTGAGCGACACGTTCGTGAAGCTTGTGTCCTGGTAC	Os02g0601300	AF546879	Similar to Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 3 (EC 1.2.1.12).
6208	74	3	Os01g0900800|mRNA|AK121411|CDS+3'UTR	CCTACATCAAGGAGCTTCAGGGCCAAGTTGAGGTATGCTAGCTCCACTTCAGAAATCTCT	Os01g0900800	AK121411	Basic helix-loop-helix dimerisation region bHLH domain containing protein.
6209	74	4	Os12g0118200|mRNA|AK066991|CDS+3'UTR	ATGCAAGGGTGGAGGTTGCTCTTTTTTAATCCTTTTGAGATGCTCGGTGAGAGTTTCGGT	Os12g0118200	AK066991	Conserved hypothetical protein.
6210	74	5	Os01g0757400|mRNA|AK058626|CDS+3'UTR	TTACAAACGGATGTTGCTGCTGCAGCAGTTATGAAATAAATAGCATCATGAATATCGAAC	Os01g0757400	AK058626	Similar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
6211	74	6	Os01g0142500|mRNA|AK067964|CDS+3'UTR	TGGATAAACGGAAAATAAGTTTGCTCTGAGTCATTCAGCATTATTACTACTTTCAGTTGC	Os01g0142500	AK067964	Homeodomain-like containing protein.
6212	74	7	Os04g0271700|mRNA|AK070110|CDS+3'UTR	TTTGGGTTTTGTATTGGAAAAGCTAATTTCGCAAGAAGGTTAATACACAACAGCTATAGC	Os04g0271700	AK070110	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
6213	74	8	Os11g0660500|mRNA|D12626|CDS+3'UTR	TGGTGTCGGAAACAACTATCGTTTGCTTGTTATGGATGTTGAGATGAGTCCTTTTAAAAA	Os11g0660500	D12626	Similar to Translationally controlled tumor protein (Fragment).
6214	74	9	Os06g0154800|mRNA|AK072563|UTR	CTGATTTCAGTATGGTGGGGAATTGATGTGGCTGGAATAAGAAAAAACATTCTCACACCC	Os06g0154800	AK072563	Non-protein coding transcript, uncharacterized transcript.
6215	74	10	Os04g0231900|COMBINER|CI396069|6	CTTCATGGTTAATTATACTCTCTGGAACTTTCTCGGATTTTTCGGAGCTCAATTCCTAAT	Os04g0231900	CI396069	(No Hit)
6216	74	11	Os06g0126100|mRNA|AK119346|CDS+3'UTR	GCCCGATTTACGTGCAAAAACTACTTTAAATTAATTTTTCTCTTAAATTACTTATCTAAA	Os06g0126100	AK119346	Conserved hypothetical protein.
6217	74	12	Os07g0133500|mRNA|AK106244|CDS+3'UTR	AATGAATGAACAAGTTATAAAAACTTTTCGTGTCTATTATGTTTTAAATTTCAAATTCGG	Os07g0133500	AK106244	Protein of unknown function DUF1005 family protein.
6218	74	13	Os12g0559200|mRNA|AK072241|CDS+3'UTR	AACTACTGCACTGTAGTAAGTACAGGACACCGTATATACATAACGCCCTGCATTATTTCC	Os12g0559200	AK072241	Lipoxygenase (EC 1.13.11.12).
6219	74	14	Os07g0470700|mRNA|AK120675|CDS+3'UTR	TGCAGATGCTCAATCCTTTTCTCCAATGATACAACATTACACATGTTTTGGTGATAGACC	Os07g0470700	AK120675	PAP fibrillin family protein.
6220	74	15	Os05g0176100|mRNA|AK099281|CDS+3'UTR	TTGAGGGGTCGTTGTTACACATACTATGGGATGTTATTTATACGGATATATTCCAATTAC	Os05g0176100	AK099281	Similar to RSW1-like cellulose synthase catalytic subunit (Fragment).
6221	74	16	Os01g0853800|mRNA|AK105929|CDS+3'UTR	GGCTTGCGTCTTATGACAAATTTGGTGTGTGTTATGAATGTTCTATTATCATATTTAAAA	Os01g0853800	AK105929	C2 calcium/lipid-binding region, CaLB domain containing protein.
6222	74	17	Os06g0720400|mRNA|AK099620|CDS+3'UTR	AGTAGGAGTAGACGTGAATAACATTAATATATGTTGGCTTATTTTTTGAGGGGATGTTGG	Os06g0720400	AK099620	Conserved hypothetical protein.
6224	74	19	Os02g0570500|mRNA|AK107418|CDS+3'UTR	AAACTTTCATGTTGCATGTTATACATGATGTATCATTCCAGTGTGTAATGCTACCACTAC	Os02g0570500	AK107418	Cytochrome P450 family protein.
6225	74	20	Os11g0210500|mRNA|AK070886|CDS+3'UTR	TCACCAGTTTTACCCTGTAAATTAGTACCATTCTGAAATCGTAATAAACTACTAGCAGTG	Os11g0210500	AK070886	Alcohol dehydrogenase 2.
6226	74	21	Os01g0271500|mRNA|AK101384|CDS+3'UTR	GCTGACGTCAGCATGATGTCAGCGTCACGCATATGTGTAAAACCACTTTAAACTATTTTT	Os01g0271500	AK101384	Similar to RUB-activating enzyme (Ubiquitin activating enzyme E1-like protein).
6227	74	22	Os11g0274100|COMBINER_EST|Os11g0274100|8	TCACTGAAGAATTGTTCAAGAAAACAATGGGTAAGGTCGTGGATGAGGAGAAGCTGCCGA	Os11g0274100		Hypothetical protein.
6228	74	23	Os02g0212600|COMBINER_EST|Os02g0212600|8	CACAAAGCAGACTACTAGAGTCACTGAGTCAGCAACCAAGCAGCACATCATCTTAGCTTT	Os02g0212600		Conserved hypothetical protein.
6229	74	24	Os05g0291600|mRNA|AK073226|UTR	ATAGGGTTGCTGCTTGCACCATTTTGTATTGCTATGCTTGTTTCTCTCCCAACACAATAA	Os05g0291600	AK073226	Non-protein coding transcript, unclassifiable transcript.
6230	74	25	osa-miR172c|Os07|3'seq	TATCGGTTTTCAAGTGTAGTCATCGTGCGTGAATCTTGATGATGCTGCACCAGCAAAGAG			miRNA
6231	74	26	Os12g0455100|mRNA|AK062420|CDS+3'UTR	AAATGTATGTGAACTTGTTGAGTTCTTGATGCATGTAGGATTTCAATTAATGTGATTGTT	Os12g0455100	AK062420	Hypothetical protein.
6232	74	27	Os11g0199700|mRNA|AK073816|CDS+3'UTR	TTACTCCATTTGGCAGCAATATTCATAGTTCAGGTTGCAATTTGAAGTTGGTGTAACTTT	Os11g0199700	AK073816	Similar to Seed protein B32E (Fragment).
6233	74	28	Os03g0325500|mRNA|AK063005|CDS+3'UTR	CTTGGCACTCTCCATTATTCTGCCTTACCGTGATTGTAGTTTGTACCATAGAAATATAAC	Os03g0325500	AK063005	Similar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1).
6234	74	29	Os08g0242800|mRNA|AK068874|CDS+3'UTR	CTGCAAGTCTGCAATGCAAAGCAACCCTCATTGTAATTAAGGATAATCATGTACATTTTT	Os08g0242800	AK068874	Similar to Sigma factor SIG6.
6235	74	30	Os10g0485300|COMBINER_EST|Os10g0485300|8	AGAATTGCAGATCCAGGTTTCCAAAACCCTCGTTGGGTTGATGGCGAGCTTTTGATACTA	Os10g0485300		Conserved hypothetical protein.
6236	74	31	Os03g0187500|mRNA|AK059536|CDS+3'UTR	GGGGCATCGGTATATGCAAAATTTTCTACCGCAAGATCATAAGTGCATCAGAGCAGGCTT	Os03g0187500	AK059536	Leucine-rich repeat, cysteine-containing subtype containing protein.
6237	74	32	Os02g0592200|mRNA|AK069742|CDS+3'UTR	ACCCCTCTTACATCATTGAAGTAGGCTCCGTTTGAACATGCATCTGTTTCTGTTTGAACA	Os02g0592200	AK069742	Conserved hypothetical protein.
6238	74	33	Os09g0563700|mRNA|AK103005|CDS+3'UTR	AGATCTGTGTGATCTGTCATGTGGAATTGTAAAGCTTCTGCGTGCAAAGAAATGGATTGA	Os09g0563700	AK103005	Conserved hypothetical protein.
6239	74	34	Os07g0250300|mRNA|AK098969|CDS+3'UTR	ATGTTGGTTTTAGGTCACGGCCACTAATTCAATTGAAAAGTTGCTTGATGATTCTTTTGT	Os07g0250300	AK098969	Conserved hypothetical protein.
6240	74	35	Os08g0313600|COMBINER|CI090429|6	AAATTTTTGTGGTGGACGTGTAAGTTTATGTTCCGCTGTAGTATGGGCAGCGGAATATTA	Os08g0313600	CI090429	(No Hit)
6241	74	36	Os06g0115800|mRNA|AK062240|CDS+3'UTR	GCTACTATATACACGATCATTCTGTTGTTAAGTTTGCCAGTTCTGCAGTTCATGTATCTG	Os06g0115800	AK062240	Conserved hypothetical protein.
6242	74	37	Os10g0372100|mRNA|AK069144|CDS+3'UTR	CTTGAGCTAGACAATGACTCCTGAAACTTTGGTAGGTCTTTTCTGTATAATTATATCCTT	Os10g0372100	AK069144	Hypothetical protein.
6243	74	38	Os08g0412800|mRNA|AK108716|CDS+3'UTR	ATGATTATGTTGTATGCATGCGTGTATAACCTTAGATATTGTTCTTTACTACGGTTAGTT	Os08g0412800	AK108716	Protein of unknown function DUF1262 family protein.
6244	74	39	Os10g0497100|mRNA|AK108318|CDS+3'UTR	ACAGATCCTAAGAACTTATCTTAATTTAGGAGAAGTTGCTCGTTTCATTAAATTAAATTG	Os10g0497100	AK108318	Similar to 1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplast precursor (EC 2.3.1.51) (Lysophosphatidyl acyltransferase 1). Splice isoform 2.
6245	74	40	Os11g0462600|mRNA|AK064471|UTR	GGGAAAGCATCTTTTATAGTACTGTTCCAATATTCCCTCTGGATGTCATCAATTACAATG	Os11g0462600	AK064471	Non-protein coding transcript, uncharacterized transcript.
6246	74	41	Os10g0551200|mRNA|AK106239|CDS+3'UTR	ATCATCCATCCATCCATCCCCCTGTGTTACTACTCGATTCCCCGTGAAAATCAATGGCTA	Os10g0551200	AK106239	Similar to Scl1 protein (Fragment).
6247	74	42	Os07g0159200|mRNA|AK107811|UTR	ATCCAAGTTGTCGGCAGATGGATTCAACTTGCTGAGTGTAAGGGAATGGAATCAGAACAA	Os07g0159200	AK107811	Non-protein coding transcript, uncharacterized transcript.
6248	74	43	Os11g0455800|mRNA|AK105983|CDS+3'UTR	CTCTTGTTTCTAATTTCTAGGAGCTGTGCCTTTTGGAATCATGGAATGTCAAGTATTTGC	Os11g0455800	AK105983	Similar to Hydroxymethyltransferase.
6249	74	44	Os05g0446500|mRNA|AK099953|CDS+3'UTR	TACGGATTGACAGTGATGTATCACATCTAGTATTCCAATCTGTGAATAATTGGTGCTTAT	Os05g0446500	AK099953	Conserved hypothetical protein.
6250	74	45	Os07g0480300|COMBINER|AU082880|6	TGCACAACGATATTAGCCTTTGTATGTGTTAAAAATACATCTAATTTGTCGAAAGAAATT	Os07g0480300	AU082880	(No Hit)
6251	74	46	Os03g0123600|mRNA|AK101248|CDS+3'UTR	TGATCATTCTTGAATACGTTCTTCTCTGAATAAAGGATCGCCATGAAATGTCAACTTAGA	Os03g0123600	AK101248	Protein of unknown function Cys-rich family protein.
6252	74	47	Os04g0554600|COMBINER_EST|Os04g0554600|8	CGACCCCGTCGACGCCCACCCCGACTCCCGCCGCATTCGGCAAGTGCCCACGCGACGCGC	Os04g0554600		Similar to RCc3 protein.
6253	74	48	osa-miR169d|Os09|Mature	TAGCCAAGGATGAATTGCCGGTAGCCAAGGATGAATTGCCGGTAGCCAAGGATGAATTGC			miRNA
6254	74	49	Os04g0600000|mRNA|AK106400|CDS+3'UTR	GCAAAATGAGGGAACATCCAACACAGATGTGTATATTCTATCCAAGTATCCTATAAATTG	Os04g0600000	AK106400	Similar to Transfactor-like protein.
6255	74	50	Os11g0242400|mRNA|AK067025|CDS+3'UTR	ATTTTCCATAATCCCTCATGAAACATCTGAAGGTGTATATATTCTTCCTTCAAAAAGGGT	Os11g0242400	AK067025	Rieske [2Fe-2S] region domain containing protein.
6256	74	51	Os03g0764700|COMBINER_EST|CB664528|7	TTGAAAGCATCTTACTTCCTGAGAAGCCCAGAGATCACCAACAAGTACAATCGAATGGCT	Os03g0764700	CB664528	Hypothetical protein.
6257	74	52	Os06g0612800|mRNA|AK062342|CDS+3'UTR	AATGTACTATTGTATCCGAAGTGTTACATTGCAACCAGTAATAGTAATCAGCAATCGTCC	Os06g0612800	AK062342	Similar to PVPR3 protein.
6258	74	53	Os05g0215700|mRNA|AK119724|CDS+3'UTR	GTTGTAAGAGATCATGCTGATCAAGTTCTACTGATCTTGTAATTCAGGTCTGCCAATTCT	Os05g0215700	AK119724	Conserved hypothetical protein.
6259	74	54	Os04g0563900|COMBINER_EST|CI223070|6	GGGGGGTCAGTAAGGTGCTTTGTCTAAACCTTCTGAAACAAAGAAGTGGAATGTGATGTT	Os04g0563900	CI223070	Protein kinase-like domain containing protein.
6260	74	55	Os06g0495500|mRNA|AK109873|CDS+3'UTR	TCGCTATATTGGACATTTCAAAAGGAGTTTATACTAACAAAAAATATATGGCTCTTGAGT	Os06g0495500	AK109873	Multi antimicrobial extrusion protein MatE family protein.
6261	74	56	Os10g0168900|mRNA|AK068977|CDS+3'UTR	TAACTGGGCTTTCAGTCAGTAAGCATGGTAACAGACTCTTCATTGAGTTAAGTAGTCCAA	Os10g0168900	AK068977	Conserved hypothetical protein.
6262	74	57	Os07g0472900|COMBINER_EST|Os07g0472900|8	CACCGGTGAGGCCTACATGGTGGTGGAGGCGCCGGAAGACGACGACGACCTCGCCCAAGT	Os07g0472900		Conserved hypothetical protein.
6263	74	58	Os09g0530700|mRNA|AK058211|CDS+3'UTR	ACAAACTAATGTTGTACATGCGACAGCCTTCCTGCTTCATTGAAGCAAAAATGGGATCTG	Os09g0530700	AK058211	Conserved hypothetical protein.
6264	74	59	Os05g0511300|mRNA|AK070791|CDS+3'UTR	ACGTGTTCGAACTGTACAATGACACTGAATTAGTAAACGGCAAATCAAAGAGCTCAACTT	Os05g0511300	AK070791	N2227-like domain containing protein.
6265	74	60	Os01g0854800|mRNA|AK109676|CDS+3'UTR	ACGTGTGTGATAGTGTGATCAGGGTGAGGGTGGTGTACTTTTGTTGGGATCTATTATATT	Os01g0854800	AK109676	Similar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase).
6266	74	61	(+)E1A_r60_n11		
6267	74	62	Os08g0559400|mRNA|AK072675|CDS+3'UTR	TCTCACCTGAACGAGTAGTGTTCAGTGATTATCAGTGGAAATAACTTTCGAAATATATGA	Os08g0559400	AK072675	Similar to Cyclophilin-like protein.
6268	74	63	Os10g0494800|mRNA|AK111538|CDS+3'UTR	AACATACAGGTCATCCTTGGCAAATGTACAGCAAATTCTTGTACCATCCGGTTTGCAATC	Os10g0494800	AK111538	Similar to Katanin p80 WD40-containing subunit B1 (Katanin p80 subunit B1) (p80 katanin).
6269	74	64	Os08g0104700|mRNA|AK120989|CDS+3'UTR	CAAATGTTCATTGTTAATTTCACAGTTATTACAGTGAAATTGCAAAATTGATGATTATTC	Os08g0104700	AK120989	Chaperonin Cpn60/TCP-1 family protein.
6270	74	65	Os03g0100200|mRNA|AK072547|CDS+3'UTR	TTTCAAAGCAAAGGCACCGGCAGAATTTGTGCCCAAAACCAAAAAACAAATAAAAAGGGA	Os03g0100200	AK072547	Transcriptional coactivator/pterin dehydratase family protein.
6271	74	66	Os02g0245100|mRNA|AK100203|CDS+3'UTR	TGACATGGGTGTGTGAGTTGTTGAACATAATAGTACAAGATTTGCCAGCTTATCTCAACA	Os02g0245100	AK100203	Similar to Peroxisomal targeting signal type 2 receptor.
6272	74	67	Os02g0255700|mRNA|AK060468|CDS+3'UTR	TGTAAATTGTAAAGAAAGTGGTGCCTATTTGGCCTCTTGCTTGATGTGAATTTTACCCAA	Os02g0255700	AK060468	Conserved hypothetical protein.
6273	74	68	Os01g0620100|mRNA|AK070122|CDS+3'UTR	TATCAATGTTAAAGAATTCTGCAAGATCTCTTTCAATTATACTGTCGTGCACGTGGTTGG	Os01g0620100	AK070122	WD40-like domain containing protein.
6274	74	69	Os02g0157200|COMBINER_EST|Os02g0157200|8	ATCCCACAAGCAATTTGCAACCTCACCAACCTGGAGATGCTAGACTTGTCTAGCAACAAT	Os02g0157200		Leucine rich repeat, N-terminal domain containing protein.
6275	74	70	Os09g0355400|mRNA|AK105685|CDS+3'UTR	AAATCCAACAAGTTGCTCTGAGCCTAAACAACCCAAAGCCCAGATTAGTTCAAACAGAGT	Os09g0355400	AK105685	Protein kinase-like domain containing protein.
6276	74	71	Os04g0467700|mRNA|AK101835|CDS+3'UTR	CAGTTCTTCCCATATACTCTTGTGACCAAACCTTTTCGACCAATACAAATGGTTCACTGC	Os04g0467700	AK101835	Similar to Indole-3-glycerol phosphate synthase, chloroplast precursor (EC 4.1.1.48) (IGPS).
6277	74	72	Os04g0583100|COMBINER|CI409908|0	ATCACAGCCCATTCCACAATAACTGTGCGGACTACAGATTCAAAAGAAACTAGATGGTCT	Os04g0583100	CI409908	(No Hit)
6278	74	73	Os06g0527500|COMBINER_EST|CI125618|6	CTATGAGTGTCATTCAGTTTGTAGGATTGAAGTATAGGAAAACCAAAGGAAAATTTCCTC	Os06g0527500	CI125618	Hypothetical protein.
6279	74	74	Os05g0525000|COMBINER_EST|Os05g0525000|8	CAAGTCATTCAATCTTGAGAATGGCACCCATGTACCAAGCAACAATGCAACCATCGACCA	Os05g0525000		Protein kinase-like domain containing protein.
6280	74	75	Os08g0117700|mRNA|AK067392|CDS+3'UTR	TCCAAGCTCCACCTTCGGTTCCTTTCTCAGGAACTCGATCGTTTGCAAGTTAGCCATTGT	Os08g0117700	AK067392	Protein kinase-like domain containing protein.
6281	74	76	Os07g0573300|mRNA|AK122181|CDS+3'UTR	AATACTGCTGAAATTGAAACATGCTTGGATGTCTCTGGAGAATATCAAAGAAACATTCGT	Os07g0573300	AK122181	Similar to FYVE finger-containing phosphoinositide kinase (EC 2.7.1.68) (1- phosphatidylinositol-4-phosphate 5-kinase) (PIP5K) (PtdIns(4)P-5- kinase) (PIKfyve) (p235).
6282	74	77	Os09g0480800|COMBINER_EST|AU070921|6	TGTGCTTGTGCTGGAATATTGAACTGAAAAAACACAATAGCGCTCCTTTTTGTAAAAAAA	Os09g0480800	AU070921	Conserved hypothetical protein.
6283	74	78	Os08g0201800|COMBINER_EST|Os08g0201800|8	CTAATCGCTTTGCTTTTCTTCGTGGTGAATTGGGCATAATTCATCCTTTTGGCATGGTTT	Os08g0201800		Copia protein.
6284	74	79	Os03g0701500|mRNA|AK063166|CDS+3'UTR	ATCATGATTTCATTGTGTTACCAAACAAGACGTTATTGTGCGATAATCTTGCTTGTCATC	Os03g0701500	AK063166	GNS1/SUR4 membrane protein family protein.
6285	74	80	Os10g0572000|COMBINER_EST|Os10g0572000|8	TATCGAACAGGAAGACTTGGCCGTTATACCTTAGACTGTGCTCCAGATGTTAGGAAGGAA	Os10g0572000		GTP-binding protein, HSR1-related domain containing protein.
6286	74	81	Os01g0757900|mRNA|AK105476|CDS+3'UTR	TTTTTTCGTTCTGTTCCGCCTAAGCTCATAAGTACAGGTAGTGAGTAACAAGGCTATGTA	Os01g0757900	AK105476	Haloacid dehalogenase/epoxide hydrolase family protein.
6287	74	82	Os05g0165800|mRNA|AK065881|UTR	CTCTGTTAGGCATTTCAACAAACGTCATCTGATGTGTTTGTTTCTGCAATATTGATCATC	Os05g0165800	AK065881	Conserved hypothetical protein.
6288	74	83	Os03g0648200|COMBINER_EST|Os03g0648200|8	CTTCCATGGCGCCAATCAAATTGAAGGGCTTCACTCTAGATACGCCAAATGGAACCAATT	Os03g0648200		Plant MuDR transposase domain containing protein.
6289	74	84	Os05g0446800|mRNA|AK099450|CDS+3'UTR	CTCGAGGACCGCAGGCGTTGAAATGAGAAGAATATGTGATTTACAGAGTGTCCAACTGTT	Os05g0446800	AK099450	Similar to Arginyl-tRNA--protein transferase 1 (EC 2.3.2.8) (R-transferase 1) (Arginyltransferase 1) (Arginine-tRNA--protein transferase 1). Splice isoform ATE1-2.
6290	74	85	Os06g0273400|mRNA|AK108774|CDS+3'UTR	ATGTATCAGATTCTGCTCATTCGAAAACATTTGATTTATATAATATATGGTCATTTTCAT	Os06g0273400	AK108774	Conserved hypothetical protein.
6291	75	1	Os02g0188400|mRNA|AK111118|CDS+3'UTR	TTTTTTGGCCCAAGTTGTCTTGGGTTCATTCTATGTGTAGGATGACAATAAATTGTAAGT	Os02g0188400	AK111118	Conserved hypothetical protein.
6292	75	2	Os02g0129100|COMBINER_EST|Os02g0129100|8	TTGGTACCTGGGTATCATGGTTAGGTGTCAGACCTGGTACCCGTATGTATCAGGCCTGGA	Os02g0129100		Conserved hypothetical protein.
6293	75	3	Os05g0305200|COMBINER|CI435307|x	CATGACAATGATGGTAAACTGGCTAAATCTCGGGATGTAAGATCTCTTACTAATGTTGTA	Os05g0305200	CI435307	TRAF-like domain containing protein.
6294	75	4	Os08g0559200|mRNA|AK099010|CDS+3'UTR	TCAGAGATTTTGGTTATTAGTTGAGTACTGTTCTTGTTTGCCCTATATAACTTTTTCCGC	Os08g0559200	AK099010	Similar to Ribosomal protein S25 (40S ribosomal 25S subunit).
6295	75	5	Os03g0757600|mRNA|AK102229|CDS+3'UTR	ATTAATCGGTCAATAAAATAAACCGAATGCACACCATAATAAAGATTCCGTTGTTTGATG	Os03g0757600	AK102229	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
6296	75	6	Os09g0133800|mRNA|AK069372|CDS+3'UTR	GGGATTAATGTATGAGTTTGACCAAGTGTGGTTTACTGGTCATGGTCTAATGATGTCACG	Os09g0133800	AK069372	Conserved hypothetical protein.
6297	75	7	Os01g0564400|mRNA|AK068728|CDS+3'UTR	GTTCCTACTCATACATGAAAAATGGATTACCTCACATGCAGCTAAGTACAATTGAAGAGG	Os01g0564400	AK068728	Conserved hypothetical protein.
6298	75	8	Os06g0210000|COMBINER_EST|CI344199|0	TGTTATGCATGTAGCGTTGTCTGTTGTGACGTACTCTCTGCAATCGTGGAGACGGATTAA	Os06g0210000	CI344199	Conserved hypothetical protein.
6299	75	9	Os03g0182600|mRNA|AK104286|CDS+3'UTR	TCCCTATTTCGAACAACAATGCTGTGAGGGTGAGCTCGGCAAGATGTGTGGTATATGTTA	Os03g0182600	AK104286	Ribosomal protein S2 family protein.
6300	75	10	Os09g0281300|mRNA|AK104141|CDS+3'UTR	TGTAAGTCGATTGCCTGTATTTTATTTGTGTGCGCTAGAGAAGAGATGAATCTGCTGGTT	Os09g0281300	AK104141	Protein of unknown function DUF1218 family protein.
6301	75	11	Os01g0229200|mRNA|AK061937|CDS+3'UTR	CACGTGGCTTGATCATACGCTGTTGTAGCATTTGAATGTATAATCTTGTTCCGGTTTTGT	Os01g0229200	AK061937	VHS domain containing protein.
6302	75	12	Os05g0180600|mRNA|AK111532|5'UTR+CDS	ATTGATGTGGCTGATGCATTAGAGCTTCTCTCACCAGACTTTGAAAGTGAGGAGGTTCGA	Os05g0180600	AK111532	Similar to Phosphatidylinositol 3-kinase, root isoform (EC 2.7.1.137) (PI3- kinase) (PtdIns-3-kinase) (PI3K) (SPI3K-5).
6303	75	13	Os11g0209700|mRNA|AK073735|CDS+3'UTR	AGCCAAGTATGAAGAAAATTCTCCGAACTTCAAACTTGCCCAGAGAAACTTTGTGGAAAG	Os11g0209700	AK073735	Similar to Phosphatidylinositol 4-kinase (EC 2.7.1.67).
6304	75	14	Os01g0845800|COMBINER|AU075609|6	TATTTTCGAATGTCACCGGGTGGTGTGAACTTATTCCTTTGTTATGGCCAATTTGCATTG	Os01g0845800	AU075609	(No Hit)
6305	75	15	Os11g0704500|mRNA|U43529|CDS+3'UTR	GATGCCTGCCTGCATCTACCATCTATGTGAATTGTGATGCAGAAAAATAAAGAAGCTTGG	Os11g0704500	U43529	Metallothionein-like protein type 1.
6306	75	16	Os02g0790600|mRNA|AK101056|CDS+3'UTR	TGCATCCAACAGCAAGAGAAATTGTAAAACCCATATGCTACGAAGAGAAGAAATTTTCCT	Os02g0790600	AK101056	Similar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8).
6307	75	17	Os09g0487500|mRNA|AK108131|CDS+3'UTR	GTCCAATGATGGCGAATGCCCTGAACATTTTGAAATGCTTTGTAATTCTATTATTTTCTC	Os09g0487500	AK108131	Conserved hypothetical protein.
6308	75	18	Os03g0178500|mRNA|AK109678|CDS+3'UTR	AGGCAGATGGCAGTACCACTAAAGTGGCTAATTTATTGTTGTGATCATTCTGAGATCGTC	Os03g0178500	AK109678	Alpha/beta hydrolase family protein.
6309	75	19	Os01g0837500|mRNA|AK105439|CDS+3'UTR	TGCATATGAATTATCGTGTATTTTGGTTTCCCATGCTAATTAGTTCCAGATTCCGTTTGT	Os01g0837500	AK105439	Similar to Ruvbl1 protein.
6310	75	20	Os11g0425600|mRNA|AK121882|CDS+3'UTR	TCATTAGATGCGGTATTTGTTGGGTCATAAATCTGTCATCTGTAAGCTTCAAATACTGAA	Os11g0425600	AK121882	Four F5 protein family protein.
6311	75	21	Os07g0586600|COMBINER|CI454989|6	TTCAACTGTGATATGATGATCGCATTGCTGAATGGAAGATAGAAAACGAGAGATGTTGGA	Os07g0586600	CI454989	Conserved hypothetical protein.
6312	75	22	Os01g0393000|mRNA|AK072836|CDS+3'UTR	GTTGGCAAGGATGTTATACTCTATGCTGTCACAAGAAATGATGTCCCAGTAGCCAAGGCA	Os01g0393000	AK072836	Conserved hypothetical protein.
6313	75	23	Os03g0381200|mRNA|AK061302|CDS+3'UTR	AGTTTGCATTTGCCGAACTCGTTGTCACTGCCCCTGAGAGCAATATTCTGTCATCTTTGT	Os03g0381200	AK061302	Similar to Capping protein beta 3 subunit (Fragment).
6314	75	24	Os01g0264100|COMBINER_EST|Os01g0264100|8	AAGTGATAGGTTCATACGCTGTTGAACTTAATTACGACATTGAGCACTATGCAGAACCGC	Os01g0264100		Similar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase).
6315	75	25	Os10g0404500|mRNA|AB071809|CDS+3'UTR	GCTATAGCTGCTGCTATCTCCAGTTAGAGCGGGTACTATAGCAGGCTATAAGCCAGCTGT	Os10g0404500	AB071809	Sucrose transporter.
6316	75	26	Os09g0327800|COMBINER_EST|AU085842|7	ACTTGTTGCTTCCAGTCGTCTTGATGAGGTAATTAAACTATCGAACGAATCCCTTTCATT	Os09g0327800	AU085842	Disease resistance protein family protein.
6317	75	27	Os10g0439700|COMBINER_EST|Os10g0439700|8	AGGCATGAATCTTGGCATGGCAGATGTAGAGTTTCCCTTGGCAAGCCTTCTTTACCATTT	Os10g0439700		Cytochrome P450 family protein.
6318	75	28	Os01g0772600|mRNA|AK069612|CDS+3'UTR	TGAGAATGGGTGTACTGATAAATCGGTGTATCGATTCCATTATTCGATGGTCTCATTGCA	Os01g0772600	AK069612	Similar to Casein kinase-like protein.
6319	75	29	Os11g0482000|mRNA|D29726|CDS+3'UTR	AACATCACTAGTGCTGAGAAAAATATGTAGTGCTCTATTCTATCTATCTATCGACATGGT	Os11g0482000	D29726	Similar to 40S ribosomal protein S5-1.
6320	75	30	Os06g0219600|mRNA|AK099019|CDS+3'UTR	GCAGCAGCATTATGTACTATTAACTTCGTTTATGTGGAAGTGCGCACTATTTTGGGTTTT	Os06g0219600	AK099019	Similar to Poly(A)-binding protein II-like.
6321	75	31	Os10g0476000|mRNA|AK100161|CDS+3'UTR	CCTTAAAGATTTGAGAACACTGTTATGAATGCGGCAGCTTATGTCACTGATGCCAAATTT	Os10g0476000	AK100161	Adaptin ear-binding coat-associated protein 1 NECAP-1 family protein.
6322	75	32	Os04g0269600|mRNA|AK100640|CDS+3'UTR	GGATGTATGTGCACTGCAGTGGTATGAACATAATTGAGAACCTGAAAGGAGCAGGCTTCA	Os04g0269600	AK100640	Copper amine oxidase family protein.
6323	75	33	Os01g0147900|mRNA|AK060920|CDS+3'UTR	ACTACCATACCAATAATGTTTAGCTCCTTTTGTCGTGAGTTATTATCATGTGAGTTTCAG	Os01g0147900	AK060920	Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase).
6324	75	34	Os06g0492900|COMBINER_EST|Os06g0492900|8	TGGCTTCTACAAGATTGGCCAATGAAGACTGTAAGCTGATTGTCTATGAGAGTCCATTTC	Os06g0492900		Cyclin-like F-box domain containing protein.
6325	75	35	Os09g0402100|mRNA|L24390|CDS+3'UTR	TTATGGTAATGTTGGTGACTTTCGTGTCGTTTGTGTTAATTCTAGATTGGTGGCTGCATT	Os09g0402100	L24390	PF1 protein.
6326	75	36	Os07g0489200|COMBINER|CI469946|x	GGCGACGGAGTTCAAGAGGCTCATCGCGTTCATCGAGCAGGTGAGCACGACGGCCCAGAA	Os07g0489200	CI469946	UDP-glucuronosyl/UDP-glucosyltransferase family protein.
6327	75	37	POsControl0011|genome		
6328	75	38	Os07g0287800|mRNA|AK108333|5'UTR+CDS	TTTCTATTTTGTGTTACCGATTCATCATATATCAACATCTTGTGCACAGCGATATCTAGC	Os07g0287800	AK108333	Conserved hypothetical protein.
6329	75	39	Os05g0116100|mRNA|AK061836|CDS+3'UTR	GGAACCTTTGCTAGTACAATATGTTATATGAATAATGGAGATGCAGCCTGCAGCTGCTCT	Os05g0116100	AK061836	Dehydroascorbate reductase.
6330	75	40	Os05g0503300|mRNA|AK100773|CDS+3'UTR	GAAAACAAAAGGAACCCTGGCTGTTTACTTTGGAATAAATTGCTTGGAAAGTGTACTGAA	Os05g0503300	AK100773	Similar to Sulfite reductase (Fragment).
6331	75	41	Os01g0177400|mRNA|AB056519|CDS	TGTCACGTGGCCGGAGTACATGGCCGTCCGCAAGAAGGCCTTCGCCACCGGCGGCTCCGC	Os01g0177400	AB056519	GA 3beta-hydroxylase.
6332	75	42	Os10g0464500|COMBINER_EST|AU093335|7	GGCGCAGGAGCTGCGGCTGAGCGTCGAGTGCGGCGACGACGGCGTGCTGCTGACCTCCGT	Os10g0464500	AU093335	Zinc finger, RING-type domain containing protein.
6333	75	43	Os11g0648100|mRNA|AK071093|CDS+3'UTR	TGGGGGGTTCATGTTAAGTATAACTGTAATGGGTTTAACTGATGCTTTTGATTGCTCTCT	Os11g0648100	AK071093	Kinesin, motor region domain containing protein.
6334	75	44	Os01g0857700|mRNA|AK099794|CDS+3'UTR	ATTAATCTGCCGCATGGTCATTGCTTGATCATCGGCCTCAACACCCTGCATATGTGTATT	Os01g0857700	AK099794	Similar to G10.
6335	75	45	Os04g0536300|mRNA|AK070205|CDS+3'UTR	TATTCCTATTCGCCTGTACAGAGGCTGCTAGCTGTGCGTGCTGCCTCTTATATATCTTAT	Os04g0536300	AK070205	Similar to Yabby15 protein (Fragment).
6336	75	46	Os03g0298400|mRNA|AK069811|CDS+3'UTR	AATGTTCGGAGAATGTTTGCTTACACCCTTCTTATTCAGCAATGTCGAACTAAAGAACCC	Os03g0298400	AK069811	Similar to 26S proteasome subunit 4-like protein (26S proteasome subunit AtRPT2a).
6337	75	47	Os03g0296800|mRNA|AK058471|CDS+3'UTR	TTCATTTCAGCCAAGTTAATGTATTATTTTGCCTGCTGGGTCCAGATAATAATTACAAGG	Os03g0296800	AK058471	Mitochondrial substrate carrier family protein.
6338	75	48	osa-miR160f|Os08|Mature	TGCCTGGCTCCCTGAATGCCATGCCTGGCTCCCTGAATGCCATGCCTGGCTCCCTGAATG			miRNA
6339	75	49	Os02g0558500|mRNA|AK072724|CDS+3'UTR	ATTTGCCTTGTTATTAGGTCAAGTTCTGAAGTGTCAGTGTAGTCCTGGACTTTTGTCAGT	Os02g0558500	AK072724	Conserved hypothetical protein.
6340	75	50	Os07g0512200|mRNA|AK059939|CDS+3'UTR	GCCAATAAGAAATCAAGGCCTTCTTAATCGTCATATCTCGCATGGTTGCACGCATGATTG	Os07g0512200	AK059939	Similar to Symbiosis-related like protein.
6341	75	51	Os05g0288100|COMBINER|CI274096|6	CCATTTGCTGCTGATATGGGCACTCGATGAAGGTTTCAGAGGCTGTTGCTTAGGTAATTA	Os05g0288100	CI274096	(No Hit)
6342	75	52	Os05g0136200|mRNA|AK059282|CDS+3'UTR	ACAGTGTACAGAACCGAGTGGTTCAAAAACTAGCCACCGTTGTAAAGAGAAAGAAAGGAA	Os05g0136200	AK059282	Protein kinase-like domain containing protein.
6343	75	53	Os06g0702700|mRNA|AK100260|CDS+3'UTR	AAATGGCAGTTCGCTGTATTAGCATGTTAGTATGAAATAACCCATCTCCTCGAGAGTGTA	Os06g0702700	AK100260	AIG2-like family protein.
6344	75	54	Os01g0339500|mRNA|AK066107|CDS+3'UTR	CTATAAATTATTTATCTACAAATTTTACTCCATTTTTGTAAGTTAATGTTCATATTTACT	Os01g0339500	AK066107	Conserved hypothetical protein.
6345	75	55	Os07g0172900|mRNA|AK067304|CDS+3'UTR	AATTGGGTTGTGTTGTACTATCAATCAGCAGCAGCTTCACCAGTACATGTTGCACATGCA	Os07g0172900	AK067304	Similar to Integral membrane protein.
6346	75	56	Os07g0643400|mRNA|AK061012|CDS+3'UTR	TGGCATTTCAAAATGTTAACCTGGACTGCTATTTCATATATATTTTGCTGAAATTTGATC	Os07g0643400	AK061012	Esterase/lipase/thioesterase domain containing protein.
6347	75	57	Os04g0539100|mRNA|AK100828|CDS+3'UTR	ACAAAAGGCCTGTTGATGGACATGTATGAATAAGCTGATACTGTATTGTACCAACCAGAA	Os04g0539100	AK100828	Conserved hypothetical protein.
6348	75	58	Os02g0816600|mRNA|AK058624|CDS+3'UTR	AGCGTTTTCGTCAGAACGGAGTATCACTTGTATATGCAAATTAACCAATGTTTATATAGC	Os02g0816600	AK058624	Conserved hypothetical protein.
6349	75	59	Os12g0159000|mRNA|AK107952|CDS+3'UTR	TAATCGTTTGTTCCAACTGTATTATGTGATACTACTATCCTTGAATTTCAATCTACAATT	Os12g0159000	AK107952	Harpin-induced 1 domain containing protein.
6350	75	60	Os09g0407200|mRNA|AK066105|CDS+3'UTR	CTAGATTACCTTTTTTACAGACTTGATAACGGAGGTATAAAAAGGTTCAGAGCCCGTCTG	Os09g0407200	AK066105	Similar to RAD23, isoform I.
6351	75	61	Os03g0131900|mRNA|AK099900|CDS+3'UTR	GCTGCTGCAAAATGTATCATTAGCGCTTTGATAATTTTTGAGTTGAGCAGAACTTTAACC	Os03g0131900	AK099900	Chromo domain containing protein.
6352	75	62	Os05g0147600|mRNA|AK111304|CDS+3'UTR	GAAGAGCCTCATGAAACAATCCATATATTTTGCCACAAGTATAATTATCAGAGCAGTATG	Os05g0147600	AK111304	Tetratricopeptide-like helical domain containing protein.
6353	75	63	PTaControl0001|mRNA|D86327|3'UTR		
6354	75	64	Os08g0366000|mRNA|AK061683|CDS+3'UTR	GCTCGTGCAGTTTCTAATTTCTTTCGGAAGATATTTTCAATAATGGAGTTGTACAAGAAC	Os08g0366000	AK061683	Phosphoenolpyruvate carboxylase.
6355	75	65	Os04g0377400|COMBINER|CI326562|6	AACATTATGCTGAACTCTGCAACAAAGAAACTTGTTACTGACTATTATGCAAAGGGCTGA	Os04g0377400	CI326562	(No Hit)
6356	75	66	Os11g0180900|COMBINER_EST|CI094517|6	TTAAAACCCAGCCACACATGCTTAGCTCTTTGTAATATTCATCAGGAAATGTGATCTCTT	Os11g0180900	CI094517	Similar to Typical P-type R2R3 Myb protein (Fragment).
6357	75	67	Os11g0451700|COMBINER_EST|CI050356|0	ATCGGTCATAGCTTCTTGTATTTCTGAAGTTTGTACTTGCCTGTCTTTTAAAATGTTTCC	Os11g0451700	CI050356	Similar to Dehydrin DHN1 (M3) (RAB-17 protein).
6358	75	68	Os06g0730800|mRNA|AK071566|CDS+3'UTR	CTCTTGTAAGTCAACTGTGCTTAGATTCTGATGCTGCCTGCCATGGAAACCAGTTAAACG	Os06g0730800	AK071566	mRNA splicing factor, Cwf18 family protein.
6359	75	69	Os03g0670700|mRNA|AK059164|CDS+3'UTR	GCTTGTTGCTATCTATCGGAATGAAATGAAATAGAAAACAAGGAGAAAAAAAAGAGTTCG	Os03g0670700	AK059164	Similar to Glycine-rich RNA-binding, abscisic acid-inducible protein.
6360	75	70	Os10g0455000|COMBINER_EST|Os10g0455000|8	GCAGGTGTTGGATCGGGATACGGTGACGCCAACCCTTAATTTCCTACGTTCAAAGGAATG	Os10g0455000		Similar to Glycine-rich cell wall structural protein 2 precursor.
6361	75	71	Os03g0291800|mRNA|AK099139|CDS+3'UTR	AAGAATTTTTGTGTATTACACCATTCTAGTACATTGATGCTCAAGAGAGGTATAAAGGCC	Os03g0291800	AK099139	Protein of unknown function DUF231, plant domain containing protein.
6362	75	72	Os04g0661800|COMBINER_EST|CI453918|0	ACATTGAACCTATCCTGGACTTGACGGTAGAAAAGCTTCAATGTTCTCCTGTAATGCATA	Os04g0661800	CI453918	MED7 family protein.
6363	75	73	Os12g0187800|COMBINER_EST|Os12g0187800|8	CTCGACATCGGATGCTTCCACGATGACTACGCCGGCAAGTCGTACTGCCGCCACCATGGC	Os12g0187800		Conserved hypothetical protein.
6364	75	74	Os01g0921400|mRNA|AK099844|CDS+3'UTR	TTTCTCATCTTTTGTTGATTGTAACATCTCGTGACTTGTTTGACATCGAAAGAATGGTTG	Os01g0921400	AK099844	Exo70 exocyst complex subunit family protein.
6365	75	75	Os09g0556700|mRNA|AK112101|CDS+3'UTR	GGGACTTAATCTGGCACTGATAATTTAGACATCCAAACTTAAATTTAGAATGGATTTAGA	Os09g0556700	AK112101	Nuclear protein SET domain containing protein.
6366	75	76	Os01g0948100|mRNA|AK111411|CDS+3'UTR	GAATTATCATGGAACGGGGCCGTTTAGCGTTTCACATCTGTTTACTCGGTTGCTTGGATT	Os01g0948100	AK111411	ERCC4 domain containing protein.
6367	75	77	Os01g0644000|mRNA|AK063835|CDS+3'UTR	ACTCGCCATCACTCGTGTATGAAATATGATACTAGTTGGGATCTCAATCCAAATTAAATT	Os01g0644000	AK063835	Twin-arginine translocation pathway signal domain containing protein.
6368	75	78	Os01g0801000|mRNA|AK064082|CDS+3'UTR	TTCACGTTTTCAGTGGAGTAGCTCAGTATTGGAATTCGATGGTAATATCATGATTCGTAG	Os01g0801000	AK064082	Similar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18).
6369	75	79	Os01g0960300|mRNA|AK105000|CDS+3'UTR	AGAAGTGAATGGTGTATGTAATCTGTAAACAGAATGAGTATAAAGAGGTTGCAGTATCAC	Os01g0960300	AK105000	Similar to Glucose inhibited division protein A.
6370	75	80	Os12g0438400|mRNA|AK109421|CDS+3'UTR	TTTGGAAATTTCGGTACCTCTTGGTACCTCATGAAATTCCCTCTGAGATGTGGAGTTGCC	Os12g0438400	AK109421	Hypothetical protein.
6371	75	81	Os06g0611900|mRNA|AY495085|CDS	CCTCAAGGTAAAATACTACTATACCGCTATCTGTTTTCATATATTAGATTGTCGCGTGGA	Os06g0611900	AY495085	Similar to Victorin binding protein.
6372	75	82	Os11g0199200|mRNA|AB039278|CDS+3'UTR	TGCAAAAGTGATAGTCGGTAGAGAAGTGGTTCTGGACAAGTTGAATAAAGCTGCCTCGGT	Os11g0199200	AB039278	Similar to Protein disulfide isomerase (Fragment).
6373	75	83	Os02g0453300|mRNA|AK071220|CDS+3'UTR	CTCTGCATGTACTTCAACACTGTCATGTGTGATCAAACTGTTTAGCTTGAAACAACACAC	Os02g0453300	AK071220	Conserved hypothetical protein.
6374	75	84	Os03g0296400|mRNA|AK105818|CDS+3'UTR	CATCGTCTTTGATTGGCCACTTCTATTGCCCGTTGTTTTTCATTCAAAATATCATTACTG	Os03g0296400	AK105818	Similar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment).
6375	75	85	Os03g0194900|mRNA|AK104041|CDS+3'UTR	ATTTTTTGTTACTGCTTCTGTAGACTACGTAGAGGTTCAGAGATTATTTCTTTTCCTTTT	Os03g0194900	AK104041	DOMON related domain containing protein.
6376	76	1	Os11g0241900|mRNA|AK066870|CDS+3'UTR	CATGTTTTGTTTCTCTAGCAGTATTATACTAATACACTAGGTGATACCTCGCACTTTGCT	Os11g0241900	AK066870	Protein of unknown function DUF231, plant domain containing protein.
6377	76	2	Os01g0190400|mRNA|AK064011|CDS+3'UTR	TCGCCCTGCATAGTTGTAACCTGAAATAAAATTGGAACTGCAAAACCTTCATTGTTACCT	Os01g0190400	AK064011	Similar to Hexokinase.
6378	76	3	Os01g0972200|mRNA|AY302058|CDS+3'UTR	AATCGTGGCCGAAACAGTTCATGTCCACTAATGATTGCTGTATCTATCTACATATATCAA	Os01g0972200	AY302058	Similar to Zinc transporter 2 precursor (ZRT/IRT-like protein 2).
6379	76	4	Os02g0596000|mRNA|AK062238|CDS+3'UTR	ATTTATTGTTCCCAAACAGGCCTGGATCATTGCTATCAAGTTTCAAGGAAATTAATGGTA	Os02g0596000	AK062238	Rhodanese-like domain containing protein.
6380	76	5	Os01g0102500|mRNA|AK100002|CDS+3'UTR	TCGTTGTATTTATAGCTTTGAACTCATTTCATGCATGAGGAAACCATGAAAGAACGCTAC	Os01g0102500	AK100002	Conserved hypothetical protein.
6381	76	6	Os10g0488100|mRNA|AK102742|CDS+3'UTR	TACATTTACTTGCAGATGGCTACGAAGAAGAAAAACATAGCCGACGAAATGGGTCGGCTT	Os10g0488100	AK102742	Similar to Prefoldin subunit 5 (C-myc binding protein Mm-1) (Myc modulator 1).
6382	76	7	Os08g0238600|mRNA|AK059758|CDS+3'UTR	TGGCTTGGACCCAGAATTTGGTTGCTAATTTCTTTATACCCACTCAATGCCTGTTGGGCT	Os08g0238600	AK059758	Similar to Endo-1,3;1,4-beta-D-glucanase precursor (EC 3.2.1.-).
6383	76	8	Os02g0649300|mRNA|AK063685|CDS+3'UTR	AATGGAACGCAGTAGCATGATCATGCTAATCAATCAGCGTAGCATACAGTATATAAATAT	Os02g0649300	AK063685	Similar to Short highly repeated, interspersed DNA (Fragment).
6384	76	9	Os06g0603400|mRNA|AK102325|CDS+3'UTR	TATCTTATGTTTGTATTTAAATTAGTAAGATTTGTTTCTATAATCATTATTACTTAGCCT	Os06g0603400	AK102325	Similar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit).
6385	76	10	Os02g0503400|mRNA|AK119704|CDS+3'UTR	GGGGTTTGAGTACTTGCATGCTAACATTGATATATCTAATCTCATATCGTCGTCTTCGGT	Os02g0503400	AK119704	Similar to 60S ribosomal protein L35.
6386	76	11	Os08g0379400|mRNA|AK109433|CDS+3'UTR	TCATAGAGTTACACTGTTACACAAGTTGTATGCACTGTGATGAACTGCTGAGCAATGTCC	Os08g0379400	AK109433	Similar to Quinone oxidoreductase-like protein.
6387	76	12	Os03g0806600|mRNA|AK070959|CDS+3'UTR	TCATTCAACCAACCTCCTGTATATTTTCAGATCTACTAGATGTGCATATTTTGGTTGATC	Os03g0806600	AK070959	Conserved hypothetical protein.
6388	76	13	Os04g0249900|COMBINER|CI512545|x	AATAAACTATCAATTTGTCATCAAGTATACTTCTTTTGATGCTTTGGTATATACCATTCG	Os04g0249900	CI512545	(No Hit)
6389	76	14	Os07g0281200|mRNA|AK121421|CDS+3'UTR	ATGCATGATGTGCTGGGAATGTATTATGTGTGCATGCAAGTTTTGACTAATACATCGTGC	Os07g0281200	AK121421	Conserved hypothetical protein.
6390	76	15	Os07g0134700|COMBINER_EST|CI328791|6	GAAAAATAGAAAGAAAAAACGCTTTGCTTCCATGCCATTGATAAGCACAGCACAGGGGAC	Os07g0134700	CI328791	Mitochodrial transcription termination factor-related family protein.
6391	76	16	Os01g0716800|mRNA|AK101741|CDS+3'UTR	TGCCTCTTCTGACTATGAGGAGTTTGTACGCAATAATGGCCTCCGTGACGATCTGATTTT	Os01g0716800	AK101741	Endonuclease/exonuclease/phosphatase domain containing protein.
6392	76	17	Os07g0664600|mRNA|AK109386|CDS+3'UTR	GTGGGTGAGTTTGTTATCTAGGATTCTTGCATTTCTTTAGGCTTAAGCAGGTCATGTGCA	Os07g0664600	AK109386	Glucose/ribitol dehydrogenase family protein.
6393	76	18	(+)E1A_r60_a107		
6394	76	19	Os05g0289100|COMBINER|CI516481|x	ATTATGTCATTGAAAGGCAACTGAGATAGTGAGATTTGAGTAGAGCATATGTATCATCTG	Os05g0289100	CI516481	Non-protein coding transcript, putative npRNA.
6395	76	20	Os07g0641700|mRNA|AK122129|CDS+3'UTR	ACTTGCAAAAGATTGTTGCTTCCTTTTATCTGTTGCGATGAAATTCAGTAAACGTTAACG	Os07g0641700	AK122129	Similar to 10 kDa chaperonin (Protein CPN10) (Protein groES).
6396	76	21	Os02g0640300|mRNA|AK069079|CDS+3'UTR	GAATCTTTGTGTAGTGTGGAAATACCACTATAATGCAATAAGAATGTAATAAGCTTGCGC	Os02g0640300	AK069079	Similar to Membrane steroid binding protein 1 (AtMP1).
6397	76	22	Os08g0374900|COMBINER_EST|Os08g0374900|8	TATTTTCTCCCGCTGCACAAGCTACTTAACTATGAAGCCACAGAACTGAGGGATGACGAT	Os08g0374900		Conserved hypothetical protein.
6398	76	23	Os05g0574500|mRNA|AB015972|CDS+3'UTR	CATAAGAGTCTGAATTAGGCCAATGCATGCTAGTGTTAGCTTGTCTGTGGAATGTGGACG	Os05g0574500	AB015972	Similar to GTP-binding nuclear protein Ran1B (Fragment).
6399	76	24	Os02g0676000|mRNA|AK073916|CDS+3'UTR	TTTCTTCTATGTTATGACTACTACTACAACTACATAGGATATCGGCCTTGCGCCTTCGGT	Os02g0676000	AK073916	Membrane bound O-acyl transferase, MBOAT family protein.
6400	76	25	Os11g0258500|COMBINER_EST|Os11g0258500|8	ACACAAACTGGACATGGAAGATGGTAAAAGATGATGATGATGTTGGGATCAAATGCAAGG	Os11g0258500		Disease resistance protein family protein.
6401	76	26	Os02g0307300|COMBINER|CI120792|6	GAAATAAGTGCAATAAGTGCCTTTGGCGATCCAGATTCGCTAAATCTGTTGTAATTGTAA	Os02g0307300	CI120792	WD40-like domain containing protein.
6402	76	27	Os04g0226400|mRNA|AK120819|CDS+3'UTR	TCTTCATTGCTGACCTAGGCAGCAAGGCATATGGATATGCCTTCAACCAACTCGAGAATT	Os04g0226400	AK120819	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
6403	76	28	Os02g0822000|mRNA|AK062205|CDS+3'UTR	GGCTGTTCTGATACTGATGCTGTTTATGTACATAATAAACTAGCGAAAAGAGTAGAACTC	Os02g0822000	AK062205	Conserved hypothetical protein.
6404	76	29	Os03g0102700|mRNA|AK061423|CDS+3'UTR	CTTACTTGATTACATGTATGCATGCAAATTAATGAATCAATCAATGGTCGGATTTTCTAT	Os03g0102700	AK061423	Beta-expansin precursor.
6405	76	30	Os09g0530900|mRNA|AK105162|CDS+3'UTR	TCTCATTGTGTATGCTGCAATTTGTACTAGAGTGGAATGGTTGTTGTTCCAACGAAAAAT	Os09g0530900	AK105162	Similar to Oxydoreductase-like protein.
6406	76	31	Os01g0140500|mRNA|AK058868|CDS+3'UTR	GATCCTTGATGTTGATCTATATCTACGATGTGGCTCTGTCTGGGATTTTGAGTTATGAAG	Os01g0140500	AK058868	Similar to 60S ribosomal protein L26B.
6407	76	32	Os03g0423300|mRNA|AK070282|CDS+3'UTR	TAATGTAATGAAGCGGCAGGACGACTGCCATTTGATTAAGAAAAGACTCGCGCTTGTTTG	Os03g0423300	AK070282	Similar to Stearoyl-acyl carrier protein desaturse (EC 1.14.99.6) (Fragment).
6408	76	33	Os01g0201100|COMBINER_EST|CI559991|0	AGAGAGAGATAAGTATATAGTACTTGGTAGTACTAATTAACTGTAATCCATTTTCATTAT	Os01g0201100	CI559991	Glycosyl transferase, family 14 protein.
6409	76	34	Os07g0546000|mRNA|AF188065|CDS+3'UTR	GGGCTCTGCTGACTGAGAGATTCCCTTATAGAGTGTCTATGTTAATTTAGCAAACTTCTA	Os07g0546000	AF188065	Similar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment).
6410	76	35	Os05g0583500|mRNA|AK059334|5'UTR+CDS	ATCTCCAGGTTTCCATAAAGCAAAGAAGAACAGAAGTCATATTGGCAAGTTGAAAATGAC	Os05g0583500	AK059334	PX-associated domain containing protein.
6411	76	36	Os04g0391900|mRNA|AK101777|CDS+3'UTR	TTATTCTTTCTATTCGCTAATTGATAACCTGTTTAGGTTATCCTTTTTTGCAAGGTATTA	Os04g0391900	AK101777	Amidohydrolase 2 family protein.
6412	76	37	Os01g0170900|mRNA|AK111084|CDS+3'UTR	TGTGGCTAGCAATATACTCGTATACATACGTATTCTACATTTTCCATATACTTGTAGCCG	Os01g0170900	AK111084	Conserved hypothetical protein.
6413	76	38	Os01g0618500|mRNA|AK067476|CDS+3'UTR	TACCTGTTCTTGCGGCGCCACAAGACGCCACACCACATAAGCAGTGGCGTAATATAATGC	Os01g0618500	AK067476	Similar to RNA helicase (Fragment).
6414	76	39	Os01g0605400|COMBINER_EST|Os01g0605400|8	CATGATAAAGCGCCCAGCAAGAGAATGTATCTGAAGAGGAGGCGAACTTTTCCTTCAAGT	Os01g0605400		Quinonprotein alcohol dehydrogenase-like domain containing protein.
6415	76	40	Os09g0392400|mRNA|AK072609|UTR	ACACGAGGATTTTGAAAGACTTCTACTATTGTGGATTAACACGAGGATTTTGAAAGATTG	Os09g0392400	AK072609	Conserved hypothetical protein.
6416	76	41	Os04g0295400|mRNA|AK067477|CDS+3'UTR	GGGATGTCATGGGCATAATAGACATTCCGAACAAGATTTCACTTGATGACTTCGTGCATG	Os04g0295400	AK067477	Jacalin-related lectin domain containing protein.
6417	76	42	Os01g0242600|mRNA|AK067756|CDS+3'UTR	CTTGTAAGTATGTAAACATGACTACACGAGAGGTTTGAGGGTACCATTTTCTCATGTTTT	Os01g0242600	AK067756	C2 calcium/lipid-binding region, CaLB domain containing protein.
6418	76	43	Os08g0127300|mRNA|AK058548|CDS+3'UTR	ATGACTGATAGATGGAAAACATTGTCCTGAGCTATCTTGTGCCCATTCTTTGAGAACTTG	Os08g0127300	AK058548	Conserved hypothetical protein.
6419	76	44	Os02g0703900|mRNA|AK102115|CDS+3'UTR	CTGTATAAATTCAGTCCTGGAAATCATGCAAGTTGCAACTCTTGAATTGATGTTTTTGTG	Os02g0703900	AK102115	Similar to Nodulin-like protein.
6420	76	45	Os02g0653000|mRNA|AK062922|CDS+3'UTR	GTGTATATTTTTGGTGTATCATTTTCGGTGGCAGTTGAATAAAAAATCTCCATGCAGCTC	Os02g0653000	AK062922	Conserved hypothetical protein.
6421	76	46	Os01g0692000|mRNA|AK064650|CDS+3'UTR	ACTGTGTCATGTGAAAATATTTTGTTAGTCTCTGTTGAGCGGTGTTCAGAATGCAAATGT	Os01g0692000	AK064650	Similar to Glutathione S-transferase GST 26 (EC 2.5.1.18).
6422	76	47	Os01g0871900|COMBINER_EST|Os01g0871900|8	GTGGACGGCGAGAGCGTTTGGGCGCAAGGACGCCATTTGAACAGAACGGTGAGCAAAATT	Os01g0871900		TGF-beta receptor, type I/II extracellular region family protein.
6423	76	48	Os03g0412200|mRNA|AK068458|CDS+3'UTR	CTGGGCTGGAGCAATGCGTTTGCTGATTTTCTTTCGAATGGAAAAATATGTGTTGTTCCG	Os03g0412200	AK068458	Conserved hypothetical protein.
6424	76	49	Os03g0192000|mRNA|AK066502|CDS+3'UTR	ATCTCAAATGCATGACTACCTTGAACAATGGGTGTTCCCTTTATCTGGAATGTGTTTTGC	Os03g0192000	AK066502	Phosphoesterase PHP, N-terminal domain containing protein.
6425	76	50	Os03g0152500|COMBINER|CI014544|6	TTTCATAAACTTCTTCGGATAATTACTCAGTAGCATACCCTTCGATGAATTCATGACAAA	Os03g0152500	CI014544	(No Hit)
6426	76	51	Os02g0725100|mRNA|AK071759|CDS+3'UTR	GACATGACGATGTTATCTTTATTTTGAACTGGAGGTGTTCTTCAGCATGTGGATGCATGC	Os02g0725100	AK071759	Sucraseferredoxin-like family protein.
6427	76	52	Os03g0296700|mRNA|AK121470|UTR	AGGGCTTGAACCTTTTTGTTCTGAGTTATATTGAGGGTTTCATATAGAAAGAACCTATCT	Os03g0296700	AK121470	Conserved hypothetical protein.
6428	76	53	PGmControl0002|mRNA|AF035254|3'UTR		
6429	76	54	Os06g0566700|COMBINER_EST|CI103906|6	TTCTTGAGGGGTGCATATCTAGAGATGCAGGTGAGGACTGGAGTTCCTTAGTTTTGAGAT	Os06g0566700	CI103906	Conserved hypothetical protein.
6430	76	55	POsControl0008|genome		
6431	76	56	osa-miR169d|Os09|3'seq	TTGATGGTGCGTGCATATATAAGTTGGCGCCGGCAAGTCATTTCAGGCTACATGTTTGCC			miRNA
6432	76	57	Os04g0480200|mRNA|AK109571|CDS+3'UTR	CCAGCACACACACCTCCGTATGTTCAACCTACAAAACCAACGGAATAATAGATGGATCTT	Os04g0480200	AK109571	Fibronectin, type III-like fold domain containing protein.
6433	76	58	Os08g0517300|mRNA|AK069175|CDS+3'UTR	AATGGATCACAGGAAAACCTGGGACAAGGAGCATATTCTCATTCACCAATCACCACTCAC	Os08g0517300	AK069175	Zinc finger, C2H2-type domain containing protein.
6434	76	59	Os08g0243900|mRNA|AK121452|CDS+3'UTR	GTAGTGACGCTTGTTTGTTTTTTGAGGCTGGAAATTACATCATGTTTTTGATTTGTCTAT	Os08g0243900	AK121452	Mu2 adaptin subunit (AP50) of AP2 domain containing protein.
6435	76	60	Os01g0951200|mRNA|AF210323|CDS+3'UTR	ATGGATTATTGGGTTTGAAAGGCTAAAGTCTATAATACCCTCAGCTATCTGTTCGGTTGA	Os01g0951200	AF210323	Similar to Orotidine 5'-phosphate decarboxylase (EC 4.1.1.23) (OMP decarboxylase) (OMPDCase) (OMPdecase) (Uridine 5'-monophosphate synthase) (UMP synthase).
6436	76	61	Os04g0413100|mRNA|AK120745|CDS+3'UTR	CTCCTTCCTGCGATAATGTGCATGATCTTGCCGTTAATCAATACATGCATTGGCTTGCAG	Os04g0413100	AK120745	Conserved hypothetical protein.
6437	76	62	Os01g0571000|mRNA|AK066090|CDS+3'UTR	TGGATAAGCTTGTGTATTGAATGTGCTACCTGTATTATACAATTTGATCAAATATTGCAA	Os01g0571000	AK066090	Mitochondrial substrate carrier family protein.
6438	76	63	Os02g0210700|mRNA|AK111879|CDS+3'UTR	GGATGTTTGTACAACTACTTTTAATACACTTTGAGAGTTGTAACGAATTCCATTTGGTAT	Os02g0210700	AK111879	Protein kinase-like domain containing protein.
6439	76	64	Os12g0610100|COMBINER|CI514110|6	TTTGTAGTGATGAAAACACATGAAAATTGTTCACTTATATCCTGTCCCACCGTTTAAAAT	Os12g0610100	CI514110	Conserved hypothetical protein.
6440	76	65	Os02g0787000|COMBINER_EST|Os02g0787000|8	CCTGCTCCTCCGGCGAGACGCTCATGGCGTGCCACTACGAGCCGCAGGGCAACATCATGG	Os02g0787000		Allergen V5/Tpx-1 related family pro