Seq-ID:S-13028 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g083200015458AK061265Phosphatidate cytidylyltransferase family protein.S-13028ATATTTCAATAAGGAACTTTGGTTCCAATGGTATGAACAAAATTGCCCACTGGTACTTTT