Seq-ID:S-13975 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os02g075790016628AK071146Similar to Poly(A)-binding protein II-like.S-13975CGTTGGTTCTGCAGTACGCAAAACGTAGTGTTATCTTATTATATTATATATACCTGCATC