Seq-ID:S-17079 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g019430020474AK120715Similar to NPR1.S-17079AGGTGTAATACAAGTGCTTGAATTTTGAGTTGTACTTGGAATTTCCAGTGGTTTGCTCGT