Seq-ID:S-17269 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g077080020722AK121805CSLC9.S-17269GTTGTTCTTGGACTGTAAATTTGCCTAGTTATTCCAAGACTATCCGATTCTTTTGTAAAC