Seq-ID:S-22686 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os07g047910027471AK103576Zinc finger, RING-type domain containing protein.S-22686TAACAAGTTATGTACTAATATACATTCTGAAAAAAAGAACTAAACTAACAGTCTCTGAAT