Seq-ID:S-24249 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os05g051860029499AK067066Similar to SL-TPS/P.S-24249GATAGGATTCGCTCAAATACCATTATTAAAATGGGCTTCGCTATAATACCATTCTCAACC