Seq-ID:S-25447 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g021750031043AK063270DJ-1 family protein.S-25447GAGTTGTCATTTGTCAAACCATCAACATTTGTTCTCCCATAAACTTATAAGGGTGTTTTC