Seq-ID:S-26138 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os05g058280031928AK105906Peptidase S10, serine carboxypeptidase family protein.S-26138CTCTAATCTGATTTTAGAATCGAGCAGAGTACATCGAGGAATACAAGCATTTGAGTCTAT