Seq-ID:S-26144 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os07g058870031938AY395294Zinc finger, C2H2-type domain containing protein.S-26144GAGCTCACATTCAGAGGCCAAAGCGCGGATGATGACACTCCCCTAACCAGCGCAATACTT