Seq-ID:S-29875 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g059130036764AK101427Similar to Cytosolic aldehyde dehydrogenase RF2D.S-29875TGGATGTATAGAACTCATGTGCCATCGTTTGAAATCGTACAAAATGTGCCTCAAAGTTCA