Seq-ID:S-35050 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os07g030020043791AK120733Protein prenyltransferase domain containing protein.S-35050AATGCATGTCGTAGCCTTGTTTTTGTTTATTGATGAGGAATTAAACAGATTAATTTTTTC