Seq-ID:S-8127 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os02g05711009582AK072928Ent-copalyl diphosphate synthase.S-8127GTAAAGTGATGACTGCGAAAATTTTCTCAAAGTGAGATGAATTTAGTCGATATTTGTTTC