Seq-ID:S-8260 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os09g05652009737AK069121Similar to Nucleic acid-binding protein precursor.S-8260CACGTAGGCTACTGTTATGATGCCCCTCTACCCCAATTTGTCGATGCATCCAAAAGTTTT