Seq-ID:S-8567 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os05g012720010110AK064924Similar to Phospholipase C (Fragment).S-8567AAATTTTGTGCGAAACGGAAGGTGTGATTGTACATTTTGTACGTACATTGTTTGTTGTTG
18224AK119748Similar to Phospholipase C (Fragment).