Seq-ID:S-9740 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os08g054040011527AK103306Similar to Calcium-dependent protein kinase.S-9740GATGCTGCGCTTGGATTGTGAAATGAGAAATGGAACTGAAATGGGGATCGTACCGGTTTT