Seq-ID:S-11499 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os02g012860013599AK103009Similar to ADP-ribosylation factor-like protein.S-11499CCACATGATTGTTTGCTGATTGCCTATCAATAAGACGGTTGGATGATGGATGTTGTTTGG