Seq-ID:S-11522 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g080560013628AK111939Similar to Cyclin IaZm (Fragment).S-11522ATGGCCAGGATTTGGCCTTTATGTGATAATACACCTTGGTGTATATAAACTGTCATCTGA