Seq-ID:S-12419 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g027760014708AK061425Similar to (clone wusl1032) mRNA sequence.S-12419ATAACTGGGAATAAAGATGTGAGTACTAGCTAAGCAATGTACGCGCACATTCGTGTGGAG