Seq-ID:S-1302 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os08g05358001693AK067906No apical meristem (NAM) protein domain containing protein.S-1302GATCTGCATCAATGCATGCCCCCCTTTAATTTCTTCTTCCTCCTTAATTATTTTTTCCCA
11667AK104766No apical meristem (NAM) protein domain containing protein.
24928AK061543No apical meristem (NAM) protein domain containing protein.