Seq-ID:S-14071 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os10g014740016752AK102295Similar to Auxin influx carrier protein.S-14071GTCTTGTAATGTGTCCTTTTTGTGTGGAGCTGCTTTTGAGAAAGAAAGAAGAGAGATCAA
35359AK063919Similar to Auxin influx carrier protein.