Seq-ID:S-14491 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g093520017276CI473757Histone-like transcription factor/archaeal histone/DNA topoisomerase family protein.S-14491CTTGTTACCTTACTCCTCCATATGAACAGCTATTCCAGTGGCTAAGCTAATTAATAATTA