Seq-ID:S-2052 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g03937002585AK101332Peptidase S10, serine carboxypeptidase family protein.S-2052CAGAAGGCAAACAGATATACCTCACTCTCAATTAGCAGAGTGACATTGTACCGTTTCTTC
36311AK058801Peptidase S10, serine carboxypeptidase family protein.