Seq-ID:S-24897 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g017090030343AK109355Sucrose transporter.S-24897TGTGTAATGAATGGTCAGGAGAAGTGCAGTGAACTAAGTGAAAGTGAGCTTCCATCATCA