Seq-ID:S-28013 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g061270034332AK065375Zinc finger, LSD1-type domain containing protein.S-28013TCATATGAATGATAACAGAGTAGTTTTCAGATGGTTCTTTCGCGGTGACCATCATGTTGC