Seq-ID:S-31288 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g068140038646AK103809Similar to Ubiquitin-conjugating enzyme E2-18 kDa (EC 6.3.2.19) (Ubiquitin- conjugating enzyme 15) (Ubiquitin-protein ligase) (Ubiquitin carrier protein) (PM42).S-31288CCTAGACTTATTAATTACTATACCTTGGATATATAGAATAATTACATGTGTATCTTGCTT