Seq-ID:S-32072 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os12g063110039695AK061116Ras small GTPase, Ras type family protein.S-32072CTACAGTGTATGCTCTTGCTTAAGTATTTCTCGACACTGAAACAGAGTAAAGCAAAGTCT