Seq-ID:S-32128 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g017090039773D87819Sucrose transporter.S-32128AATGAATGGTCAGGAGAAGTGCAGTGAACTAAGTGAAAGTGAGCTTCCATCATCATCATC