Seq-ID:S-3220 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os12g06311003921AK066784Ras small GTPase, Ras type family protein.S-3220AGTCAGATTCGTTTTGTTTGCTTCAATTCAGATCATGCAGTGAGCTTGCTTTTTACATTC