Seq-ID:S-33450 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os06g064420041543D45383Similar to Pyrophosphate-energized vacuolar membrane proton pump (EC 3.6.1.1) (Pyrophosphate-energized inorganic pyrophosphatase) (H+-PPase) (Vacuolar H+-pyrophosphatase).S-33450ATGGTGATGATTATTGTACGTGCACGGAATGCACCTGTCTCAGTGAAATTTTCCCGGGAA