Seq-ID:S-33929 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os02g055400042166AK106534Zinc finger, CW-type domain containing protein.S-33929CTCCCTCTGCGCTATGTGTAATCCCGATAGGAATAATTGATTTGATTCAAATCGTTTTAC