Seq-ID:S-3487 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os04g06270004216AB101645Similar to Roc1.S-3487CTGTGTCCCTGTCTTATACTTTTAGTTCTCTTCAGTGTTTGATCAGTGCTGTTTCAATCC
18926AK065819Similar to Roc1.