Seq-ID:S-3944 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os11g06841004744AK121102Disease resistance protein family protein.S-3944TGCACTACTATGTTCCATGTTAGGTTAATAGGTTTGTGACTTACTGACTTTGTGTCTGTC