Seq-ID:S-4745 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os10g01474005651AK102729Similar to Auxin influx carrier protein.S-4745TTTGCTTCTTTCTTCTTCTTCTGGTTACTGAGAGAGAGTGAGAGTGAGAATGTTTGGTGG