Seq-ID:S-5221 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g05910006197AK105638NAD-dependent aldehyde dehydrogenase family protein.S-5221TGGTTAGTTGATTGCTTGTATCAAATATCAATTTGTCGGAATAAAGACAGTATATTTCAG
16011AB037421NAD-dependent aldehyde dehydrogenase family protein.
44511AK121462NAD-dependent aldehyde dehydrogenase family protein.