Seq-ID:S-5636 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os04g06270006690AK101563Similar to Roc1.S-5636AAATTGTGTGTGCTGTGCTTGTTATTAGTTCTTCCTTGCTGCTTCAATGAAGGCGATGTT