Seq-ID:S-6119 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os09g05543007242AK070682Auxin Efflux Carrier family protein.S-6119TGGACTTAGACTGGTGTAACGCACATCAGTCGTGGCGTTGGTAGGAAATACTTAACAATT