Seq-ID:S-6693 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os01g06127007902AJ620677Zinc finger, LSD1-type domain containing protein.S-6693CCTTGTTAGTACGACTAGATCTCCTTTGAAAGGGAAAATAAAAGAAAAATAGTTCGATTC