Seq-ID:S-9001 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os12g063110010628AJ292320Ras small GTPase, Ras type family protein.S-9001CTGTTTCTTATTTTGTCATGTTCGTTCTGTAAATGTGAATACTAGGGTGTCGCTGCAGAA