Seq-ID:S-976 FeatureNum Information


FeatureNum Information

Locus IDFeatureNumAccessionDescriptionseq-IDprobe sequence
Os03g06246001294AK062675No apical meristem (NAM) protein domain containing protein.S-976TTTTGGTGGAGACGGGGCCCTCAAGTTTAATACAAAGCAGTAAGTCTATTTTGCATACTC